ID: 1124592262

View in Genome Browser
Species Human (GRCh38)
Location 15:31063784-31063806
Sequence ATGGCCTCATTGGGAAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 146}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124592256_1124592262 14 Left 1124592256 15:31063747-31063769 CCAGCCCAGTTATCATTCTTGCA 0: 1
1: 0
2: 3
3: 8
4: 180
Right 1124592262 15:31063784-31063806 ATGGCCTCATTGGGAAAACCAGG 0: 1
1: 0
2: 1
3: 13
4: 146
1124592257_1124592262 10 Left 1124592257 15:31063751-31063773 CCCAGTTATCATTCTTGCATTCT 0: 1
1: 0
2: 0
3: 32
4: 285
Right 1124592262 15:31063784-31063806 ATGGCCTCATTGGGAAAACCAGG 0: 1
1: 0
2: 1
3: 13
4: 146
1124592258_1124592262 9 Left 1124592258 15:31063752-31063774 CCAGTTATCATTCTTGCATTCTG 0: 1
1: 0
2: 1
3: 15
4: 235
Right 1124592262 15:31063784-31063806 ATGGCCTCATTGGGAAAACCAGG 0: 1
1: 0
2: 1
3: 13
4: 146
1124592254_1124592262 23 Left 1124592254 15:31063738-31063760 CCACTGTGCCCAGCCCAGTTATC 0: 1
1: 11
2: 159
3: 1124
4: 5749
Right 1124592262 15:31063784-31063806 ATGGCCTCATTGGGAAAACCAGG 0: 1
1: 0
2: 1
3: 13
4: 146
1124592255_1124592262 15 Left 1124592255 15:31063746-31063768 CCCAGCCCAGTTATCATTCTTGC 0: 1
1: 0
2: 0
3: 16
4: 198
Right 1124592262 15:31063784-31063806 ATGGCCTCATTGGGAAAACCAGG 0: 1
1: 0
2: 1
3: 13
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124592262 Original CRISPR ATGGCCTCATTGGGAAAACC AGG Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907329588 1:53662366-53662388 ATTACCTCATTGGGAACACATGG - Intronic
908470343 1:64437949-64437971 ATGGCCTCTTTGGAAAAACATGG + Intergenic
908760313 1:67505539-67505561 GTGGCCTACTTGGGAAAACTGGG + Intergenic
910682117 1:89877341-89877363 ATTTCCTCATTGGCAAAACAAGG + Intronic
912130960 1:106599575-106599597 ATACTCTGATTGGGAAAACCAGG + Intergenic
915502693 1:156330244-156330266 ATGGACTTTTAGGGAAAACCTGG - Intronic
918756827 1:188348623-188348645 ATGTTATTATTGGGAAAACCTGG - Intergenic
921159818 1:212464914-212464936 GTGGCCTCCTTGGGCAAGCCAGG - Intergenic
922885213 1:229014935-229014957 GTGGCCTCCCTGGGAAAACTTGG + Intergenic
923159205 1:231302724-231302746 ATGGCCTCATGGGCAAGATCAGG - Intergenic
923179822 1:231505785-231505807 CTGGCCTCATAGGAAAAACTGGG + Intergenic
924641257 1:245835753-245835775 ATGGGATCATTAGGAAAAACAGG + Intronic
1068327163 10:55507650-55507672 ATAGCATAATTGGGAAAAACTGG + Intronic
1070321302 10:75356722-75356744 AGGGCCTCAATGGGAGAACCTGG - Intergenic
1070643372 10:78184823-78184845 ATGCTCTCATTTGTAAAACCGGG + Intergenic
1072168598 10:92838377-92838399 AAGGGCTCATTGGGAAAGTCAGG - Intronic
1073041980 10:100614088-100614110 ATGGCATCATTAGGGAAACAAGG - Intergenic
1073852447 10:107636647-107636669 ATGGCCACATTGGCAATACAGGG - Intergenic
1074208353 10:111303940-111303962 ATGACCTCATTGGAAAAATCAGG - Intergenic
1075903798 10:126063809-126063831 AAGGCCTCATTGGGCAGCCCTGG - Intronic
1076053063 10:127350553-127350575 ATGGCTTTATAGGGAAAACATGG - Intronic
1079940712 11:26677102-26677124 AAGGCCTCATTTGGAAGACAGGG + Intronic
1080663616 11:34316900-34316922 ATGACCTCACTGGGGAAGCCCGG + Intronic
1080776425 11:35391368-35391390 AGAGCCTCATTGGTAAAACAGGG - Intronic
1080952679 11:37054010-37054032 TTGGCTTCATTGGTAAAACTGGG + Intergenic
1082216766 11:49580236-49580258 ATGCACTCATTTGGAAAACCTGG - Intergenic
1084633698 11:70375453-70375475 ATGGGCTCATTTGAAAAACAGGG + Intronic
1084742154 11:71146784-71146806 ACAGCCTCATAGAGAAAACCCGG - Intronic
1085319920 11:75567836-75567858 TTGGCCTCATTTGTAAAACGAGG - Intronic
1085335615 11:75691971-75691993 ATGTCACCATTGGGAAAGCCTGG - Intergenic
1086632785 11:89043839-89043861 ATGCACTCATTTGGAAAACCTGG + Intronic
1086774508 11:90813666-90813688 TTGTCCTCATTGGTTAAACCAGG - Intergenic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1087365111 11:97208787-97208809 GAGCCCTCATTTGGAAAACCAGG - Intergenic
1087686644 11:101272947-101272969 AGGCCTTGATTGGGAAAACCTGG + Intergenic
1091745463 12:2989241-2989263 AGAGCCTCATTGAGAAAATCAGG - Intronic
1094286327 12:28798548-28798570 ATGCTTTCATTAGGAAAACCAGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098873823 12:75846122-75846144 ATGGCCTCAATGGGGAGACAAGG - Intergenic
1099871149 12:88350840-88350862 ATGGCCTCATTTATAAAACTAGG - Intergenic
1102085454 12:110134466-110134488 ATTGGTTCATTGGAAAAACCAGG + Intronic
1102194081 12:111012004-111012026 ATGACCTGATTGGCCAAACCTGG + Intergenic
1103038970 12:117678961-117678983 ATGGCATCAGTGGGAAAGACTGG + Intronic
1106079375 13:26487857-26487879 ATGGCCCCAATGGGCAAACAAGG + Intergenic
1107235605 13:38166268-38166290 ATAGCCTCATGGGGAAAGCTTGG - Intergenic
1109286507 13:60415510-60415532 ATGCCATTATTGGGAAAACTAGG + Intronic
1110450343 13:75633581-75633603 ATTGCCTTATTGAAAAAACCAGG - Intronic
1111111360 13:83714636-83714658 ATGTCCTCATTCAGAAAACGGGG + Intergenic
1114404932 14:22447798-22447820 AAGGCCTCATGGGGAGAACCAGG - Intergenic
1114551391 14:23534639-23534661 ATGGCCCCATGGGGAACAGCGGG - Exonic
1115896873 14:38099053-38099075 ATTGTATCATTGGGAAAACTAGG + Intergenic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1122359771 14:101152333-101152355 ATGTCCTCAATGGGAAAAGGAGG + Intergenic
1124040372 15:26096557-26096579 ATGGTCTAGTTGGGAATACCAGG - Intergenic
1124592262 15:31063784-31063806 ATGGCCTCATTGGGAAAACCAGG + Intronic
1128231882 15:66040931-66040953 GTGGCCTCTTTGTGAAAACCGGG - Intronic
1133930083 16:10224943-10224965 AGGGCCTTAGAGGGAAAACCAGG + Intergenic
1134114991 16:11541395-11541417 ATCACCTCATTGAGAACACCTGG - Intergenic
1134358203 16:13504395-13504417 GTGGCCTCACTTGGAAAACACGG + Intergenic
1135058349 16:19249825-19249847 TTGGAGTCATTGGGATAACCTGG + Intronic
1135461153 16:22644141-22644163 GTGTCCTCATGGGGAAAAACAGG + Intergenic
1135549020 16:23384235-23384257 ATGGCCTCATTGCTAAAAGCAGG + Intergenic
1137468446 16:48732666-48732688 ATGCCATCATTGGGAGAAACTGG - Intergenic
1139645184 16:68324259-68324281 ATGGGATCATTGGGAAAAGTTGG + Intronic
1146919935 17:36703706-36703728 ATGGTCTTATTGGGAAGACATGG + Intergenic
1148451474 17:47780927-47780949 CTGGCCTCTTTGGCAGAACCTGG + Intergenic
1149186263 17:54001332-54001354 GTGCCCTCATTGGGGAAAACTGG - Intergenic
1153182256 18:2447818-2447840 ATGGACTGAGTGGGGAAACCAGG + Intergenic
1153409850 18:4781539-4781561 ATGGCCACATAGGGAAAAGAAGG + Intergenic
1155592330 18:27441351-27441373 AAGGCCTTATTTGAAAAACCTGG + Intergenic
1155666797 18:28318618-28318640 ATTGCCTCATTGGGAAAACTGGG + Intergenic
1156995002 18:43454748-43454770 GTGGTCCCATTGGAAAAACCTGG - Intergenic
1157865760 18:51183038-51183060 GTGGCATTATTGAGAAAACCTGG + Intronic
1161374729 19:3933568-3933590 CCGGCTTCATTGAGAAAACCTGG - Exonic
1161477187 19:4493420-4493442 ATGTCCCCACTGGGAAACCCGGG + Intronic
1161827449 19:6577889-6577911 ATGGCCCCCATGGGGAAACCAGG + Intergenic
1162194942 19:8977312-8977334 ATGGCTTCAGTAGTAAAACCTGG - Exonic
1168363894 19:55767851-55767873 ATGTTCTCTTTGGGAATACCAGG - Intergenic
1168711235 19:58501071-58501093 GTGTCCTCATTTGGAAAACAGGG - Intronic
928062011 2:28123510-28123532 ATGGCAGCATTTGGAAAACAGGG - Intronic
928318952 2:30268331-30268353 ATGGCATGACTGGGAAAGCCTGG + Intronic
934559488 2:95305400-95305422 ATGCTGTCATTGGGGAAACCAGG - Intronic
935859751 2:107316246-107316268 CTGGCCTCAATGGGAACACAAGG + Intergenic
938767117 2:134467700-134467722 AGGTCATCAGTGGGAAAACCGGG + Intronic
943303240 2:186229692-186229714 ATGGCTTCATGGGCAAAGCCAGG + Intergenic
945186818 2:207147750-207147772 ATGGCGCCATTGGGAGAAGCTGG + Intronic
1172142163 20:32730599-32730621 ATGGCATAGTGGGGAAAACCAGG + Intronic
1175257459 20:57655953-57655975 AAGACCTCATTGACAAAACCAGG + Intronic
1175746438 20:61460412-61460434 CTGGCCTCATTGGAGAAACTGGG + Intronic
1176953940 21:15078351-15078373 ATGGGCTCTTTGTTAAAACCTGG + Intergenic
1178124098 21:29498971-29498993 TTTGCCTCATTTGGAAAATCAGG + Intronic
1179140800 21:38723201-38723223 ATGGCCTCATTAGAATAATCGGG + Intergenic
1179367718 21:40773682-40773704 ATGGCATCAGAGGGAAAATCAGG - Intronic
1179881787 21:44296122-44296144 GTGGCCTCCTGGGGAAAACGAGG - Intronic
1180947186 22:19702648-19702670 ATGGCATCATTGGGGAAAACTGG + Intergenic
1182780480 22:32863466-32863488 TTGGCCTAGTTGGGAACACCAGG + Intronic
1183277063 22:36905307-36905329 ATGGCCTCAGTGAGGAATCCAGG - Intergenic
1184808186 22:46809830-46809852 ATGGCCTCAGTGGAAAATCTGGG - Intronic
1185103462 22:48854067-48854089 ATGGTCTCATGGAGAAAAGCAGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951053697 3:18123129-18123151 ATGACTTCCTTGGGAAAACATGG + Intronic
952831185 3:37566439-37566461 ATGTTATCATTGGGAAAAGCCGG - Intronic
953665098 3:44920098-44920120 ATTGGCTCATTGGTAAAACTTGG - Intronic
956431361 3:69189513-69189535 ATGTCACCATTGGGAAAAGCTGG + Intronic
958686537 3:97405221-97405243 ATGGCTCCATTGGAAAAAGCAGG - Exonic
961954907 3:130791428-130791450 ATGCACTCATTGGGCAAGCCAGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967051199 3:185786259-185786281 ATGGCCCCACTGAGAAATCCTGG + Intronic
981233035 4:142380869-142380891 ATTGCATGATTGGGAAAAGCAGG - Intronic
982282906 4:153704102-153704124 TTGGCATCATTGGAAAAAACCGG + Exonic
983987713 4:174080278-174080300 ATTGCCTAATTGGGTAACCCTGG + Intergenic
986122359 5:4853263-4853285 ATGTCCTTATTGGGAGAAACTGG - Intergenic
994707171 5:103220652-103220674 GTTGCCTCATTGGTAAAACTGGG + Intergenic
994873231 5:105380293-105380315 ATAGCTGCATTGAGAAAACCAGG + Intergenic
995958366 5:117808425-117808447 ATGACATCATTGGTAAAACTGGG + Intergenic
996308818 5:122079713-122079735 ATGGCTTGATTGGCCAAACCTGG - Intergenic
999307959 5:150532873-150532895 CTGCCCTCAGTGGGAAAAGCAGG + Intronic
1000577967 5:162999311-162999333 ATTGGATCATTGGGAAAACAAGG - Intergenic
1001440267 5:171737464-171737486 GTGTCCTCATTTGGAAAACAGGG + Intergenic
1003392744 6:5727594-5727616 ATGGCCTCAGTAGGAAGACAGGG - Intronic
1003907000 6:10710736-10710758 ATGTTATCATTGGGAAAACCGGG - Intergenic
1004373701 6:15074248-15074270 CTGGCTTCAATGGGAGAACCTGG + Intergenic
1005064131 6:21801808-21801830 GTGGCCTCATTAGGAAATACGGG - Intergenic
1010940594 6:81912178-81912200 ATGGCTTCTGTGGCAAAACCTGG + Intergenic
1012538228 6:100325957-100325979 ATGCCCTCAGTTGGAGAACCTGG - Intergenic
1013636804 6:112036875-112036897 ATTATCTCATTGGGAAAACTGGG + Intergenic
1016304582 6:142670573-142670595 ATGGCCTCTATGGGTAAAGCAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1020442183 7:8229477-8229499 ATGGTATCAATGAGAAAACCTGG + Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1028552748 7:92088888-92088910 ATGGTATCATTGGGAAAAGCTGG + Intronic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1032443297 7:131958966-131958988 ATCACCTCCTTGGGAAGACCAGG + Intergenic
1033349068 7:140547049-140547071 TTGGCCTCATGGGGAAAGCAGGG - Intronic
1035456748 7:159013884-159013906 CTGGCCTCAGTGGGCAAACCTGG + Intergenic
1037685760 8:21138194-21138216 ATGGCCTCATCTGTAAAACAGGG + Intergenic
1038753552 8:30318968-30318990 ATGGCCTCTTTTGAACAACCCGG - Intergenic
1044602132 8:94015820-94015842 ATGGCAAAATGGGGAAAACCGGG + Intergenic
1045552288 8:103183349-103183371 ATGGGCTAATGGGCAAAACCAGG - Intronic
1047962528 8:130021309-130021331 ATGGACCCATGGGGAAAACCGGG + Intergenic
1050069719 9:1798071-1798093 ATGGCCTCAAGGGGACAACATGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052899818 9:33782937-33782959 ATTTCATCATTGCGAAAACCTGG + Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056844016 9:90021970-90021992 ATGGTCTCCTTTGGAAATCCAGG - Intergenic
1060570919 9:124639430-124639452 TTGGCCTCATTTGTAAAATCGGG - Intronic
1060681576 9:125569638-125569660 ACAGCCTCCTTGGGAAAAACAGG + Intronic
1061371223 9:130198603-130198625 AATTCCTCATTGGGAAAACGGGG + Intronic
1186792109 X:13009490-13009512 ATGGCCTCATACAGAAACCCTGG - Intergenic
1188247222 X:27850928-27850950 AGGTCCTCATTGTGAGAACCTGG + Intergenic
1192250711 X:69411262-69411284 ATGGGCTCCTTTGGAAAGCCGGG - Intergenic
1196928544 X:120658432-120658454 ATGGTGTCATTAGGAGAACCTGG + Intergenic
1198662648 X:138986765-138986787 ATGGATTCAATGGGAAAATCAGG - Intronic
1198752991 X:139954058-139954080 AGGGCATCATTGAGAAAATCAGG - Intergenic
1198825389 X:140693259-140693281 ATGGGGTAATGGGGAAAACCTGG - Intergenic
1199620485 X:149696549-149696571 ATGGCCTCCTAGGGATGACCTGG + Intronic
1199661094 X:150051928-150051950 ATGGCCTCAATGGCAGAAGCAGG + Intergenic