ID: 1124592376

View in Genome Browser
Species Human (GRCh38)
Location 15:31064626-31064648
Sequence ATCGTTGGTCTCAGCTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 341}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124592376 Original CRISPR ATCGTTGGTCTCAGCTCTGA AGG Intronic