ID: 1124595257

View in Genome Browser
Species Human (GRCh38)
Location 15:31086593-31086615
Sequence CTCTCCCAGCAGGGGCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 414}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124595248_1124595257 -4 Left 1124595248 15:31086574-31086596 CCTAGGTCAGCATCCCCACCTCT 0: 1
1: 0
2: 4
3: 35
4: 332
Right 1124595257 15:31086593-31086615 CTCTCCCAGCAGGGGCTCCAGGG 0: 1
1: 0
2: 5
3: 37
4: 414
1124595247_1124595257 6 Left 1124595247 15:31086564-31086586 CCTGTGGGTGCCTAGGTCAGCAT 0: 1
1: 0
2: 1
3: 9
4: 100
Right 1124595257 15:31086593-31086615 CTCTCCCAGCAGGGGCTCCAGGG 0: 1
1: 0
2: 5
3: 37
4: 414
1124595244_1124595257 21 Left 1124595244 15:31086549-31086571 CCTGGCTTCTGGGTGCCTGTGGG 0: 1
1: 0
2: 7
3: 52
4: 392
Right 1124595257 15:31086593-31086615 CTCTCCCAGCAGGGGCTCCAGGG 0: 1
1: 0
2: 5
3: 37
4: 414
1124595242_1124595257 22 Left 1124595242 15:31086548-31086570 CCCTGGCTTCTGGGTGCCTGTGG 0: 1
1: 0
2: 3
3: 42
4: 388
Right 1124595257 15:31086593-31086615 CTCTCCCAGCAGGGGCTCCAGGG 0: 1
1: 0
2: 5
3: 37
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124595257 Original CRISPR CTCTCCCAGCAGGGGCTCCA GGG Intronic
900101508 1:964065-964087 CACTCCCAGCAGGAGTGCCACGG + Intronic
900436670 1:2634306-2634328 TACTCTCAGCAGGGGCTCCCTGG + Intergenic
900465684 1:2824367-2824389 CTCGCCCAGCAGCGGCTCCTGGG - Intergenic
900547178 1:3235636-3235658 CTCCATCAGCAGGGGCTCCCAGG + Intronic
900621753 1:3590730-3590752 CCCTGCCAGCAGGGGCTGGAGGG + Intronic
900791713 1:4685043-4685065 CTCTCCCAGCAGGGCTTCTCTGG + Intronic
900934337 1:5755808-5755830 CCCTGACAGCAGGAGCTCCAGGG + Intergenic
902849356 1:19141447-19141469 GCCTGCCAGCAGGGCCTCCAGGG + Exonic
902978826 1:20108917-20108939 TTCCCCCAGCAGAGGCCCCAAGG + Intergenic
903461939 1:23526421-23526443 ATCCCCCAGCAGGAGCACCAAGG + Intronic
904330555 1:29755547-29755569 GACCCCCAGCAGGGGCTGCAGGG + Intergenic
904918421 1:33986800-33986822 CTCTGTCAGCATGGACTCCAGGG + Intronic
905470502 1:38188218-38188240 CTCTCCCTGCAGGGTCACTAGGG - Intergenic
907278175 1:53328238-53328260 TTCTCTCAGCGGGCGCTCCACGG + Intergenic
908930576 1:69312458-69312480 CCCTCCCACAAGGAGCTCCAAGG + Intergenic
910366494 1:86470853-86470875 CTGTCCCCACAGGGGCACCAGGG - Intronic
910989685 1:93042212-93042234 CCCTCCCAACAGCGGCTCAAAGG + Intergenic
911318819 1:96387183-96387205 CTCACCATGCAGGGGCTACAAGG - Intergenic
911793495 1:102047598-102047620 CTCCCCTAGCAGGGGATCAAGGG + Intergenic
913439149 1:118878976-118878998 CTCCCCCAGCCGGGGCCCCAGGG - Intergenic
913560908 1:120018486-120018508 CACTCCAAGCAGGGGATCCTAGG + Intronic
913637220 1:120775116-120775138 CACTCCAAGCAGGGGATCCTAGG - Intergenic
913688341 1:121255052-121255074 TTCTCCCTGAAGGGGCTCCCTGG + Intronic
914040198 1:144042695-144042717 TTCTCCCTGAAGGGGCTCCCTGG + Intergenic
914149259 1:145025225-145025247 TTCTCCCTGAAGGGGCTCCCTGG - Intronic
914281493 1:146177898-146177920 CACTCCAAGCAGGGGATCCTAGG + Intronic
914542538 1:148628834-148628856 CACTCCAAGCAGGGGATCCTAGG + Intronic
914624095 1:149442410-149442432 CACTCCAAGCAGGGGATCCTAGG - Intergenic
915016545 1:152739288-152739310 CTCTCTGAGAAGGGGCTCCTTGG - Intronic
915492569 1:156259273-156259295 CTCAGCCAACAAGGGCTCCAGGG + Intronic
916231870 1:162548832-162548854 CTGACCCAGCAGGGGCACAAAGG - Intergenic
917387391 1:174491933-174491955 ATCCCCCAGCAGTGGCTGCATGG - Intronic
918355957 1:183706723-183706745 CTCTGCCATCAGGGGCTCTGTGG - Intronic
920261593 1:204692030-204692052 CTTTCCCAGCAGCTACTCCATGG + Intergenic
920475662 1:206273551-206273573 TTCTCCCTGAAGGGGCTCCCTGG + Intronic
921185537 1:212666556-212666578 CCCTCTCAGAAGGGGCTCCCTGG - Intergenic
922079989 1:222286376-222286398 CTCTCCCAACAGTTGCTACAAGG + Intergenic
922338805 1:224639126-224639148 CCCTCCCAGCAAGGACCCCAGGG + Intronic
922372493 1:224925305-224925327 CACTGCCTGCAGAGGCTCCAAGG - Intronic
922765014 1:228152087-228152109 CTGTGCCTGCAGGAGCTCCAGGG + Intronic
924173897 1:241369696-241369718 CTCTCTCTGCAGTGGCTCAACGG - Intergenic
1064007479 10:11709996-11710018 CTCTCCCTTCCCGGGCTCCAGGG + Intergenic
1064368268 10:14727727-14727749 CTCTCCCACCAGGGCTTCTAGGG + Intronic
1067234499 10:44436538-44436560 CTCTCCCAGGAAGCTCTCCAGGG + Intergenic
1067308699 10:45092145-45092167 CTCCCTCAGCAGGGGATTCAGGG + Intergenic
1069628071 10:69880491-69880513 CTCTCCCCGCAGGGGTCCCCCGG + Exonic
1071876574 10:89849471-89849493 CTCTCCCTCCAGAGGTTCCAGGG - Intergenic
1073175420 10:101553525-101553547 CTCTCCCAGCAGGCTATACAGGG - Exonic
1073931348 10:108580311-108580333 CTCTTGCAGCCGGGGCTGCATGG - Intergenic
1074228017 10:111506329-111506351 GTCTCTGAGCAGGGGCTCCCAGG + Intergenic
1074863593 10:117532039-117532061 CTGTCCCTGAAGGGGCTCCCAGG - Intergenic
1075125909 10:119698658-119698680 CACTCACAGCAGGGGCTGGAGGG + Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1075395283 10:122122567-122122589 TTCTCCCTGCGTGGGCTCCAGGG + Intronic
1075588960 10:123677714-123677736 CTCTCACAGCTGGGGCTTCACGG + Intronic
1076291392 10:129348543-129348565 CCCTCCAAGCCGGGGCTGCATGG + Intergenic
1076556052 10:131322198-131322220 CCCTCCCAGCAGGGGAGCCCAGG + Intergenic
1076651688 10:131994015-131994037 CACTCCCTCCAGAGGCTCCAGGG + Intergenic
1076904646 10:133355934-133355956 CTCCCCCGGCAAGGGCCCCACGG + Intronic
1076918703 10:133440329-133440351 CTCTGCATGCAGGGGCCCCACGG + Intergenic
1077467627 11:2741082-2741104 GTGTCCAAGCAGGGGCTGCAGGG - Intronic
1078180199 11:9004449-9004471 CGCCGCCAGCCGGGGCTCCAGGG + Intergenic
1079964114 11:26959759-26959781 CTTTCTCAGCAAGGGCTCTAAGG - Intergenic
1080049861 11:27848418-27848440 GTCTCCCAACTGGGGCTCAAAGG + Intergenic
1081536009 11:43996734-43996756 CTGTCCCAGCTGAGTCTCCAAGG - Intergenic
1081644507 11:44780335-44780357 CAAGCCCAGCAGGGGCTCCAGGG + Intronic
1082648391 11:55756613-55756635 CACTCCCTGCAGAGACTCCAGGG + Intergenic
1083528946 11:63398677-63398699 ATCTCCCAGCAGTGGCTGCCTGG - Intronic
1083692005 11:64415080-64415102 CACTCCCTCCAGGGCCTCCAGGG - Intergenic
1083864115 11:65444500-65444522 CACTAGCAGGAGGGGCTCCAGGG + Intergenic
1083925162 11:65801648-65801670 CTCTCCCACCTTAGGCTCCAGGG + Intergenic
1084063012 11:66687904-66687926 TTGTCCCAGCAGGGGCTGCAAGG + Exonic
1084195056 11:67519869-67519891 CTCCCCCAGCAGGGCCTTGAGGG + Exonic
1084438167 11:69156053-69156075 CAGTCCAGGCAGGGGCTCCAGGG + Intergenic
1084681384 11:70668460-70668482 CGCTCCCTCCGGGGGCTCCAGGG - Intronic
1084715610 11:70871516-70871538 CTCTCCCTCCAGGGGCTCACAGG - Intronic
1085815479 11:79732857-79732879 CTGTCCCAGCAGGTGTGCCAGGG - Intergenic
1085942577 11:81222658-81222680 CCCTCCCACAAGGGGCTCCAAGG + Intergenic
1086476429 11:87179983-87180005 TTCTCCCAGCTTGGACTCCAGGG + Intronic
1089157668 11:116414704-116414726 CATTCCCAGGCGGGGCTCCAGGG + Intergenic
1093420465 12:18968700-18968722 GTCTCCCAGGAGGGCCTCCCTGG - Intergenic
1094550310 12:31444848-31444870 CACTTCCTGAAGGGGCTCCAGGG + Intronic
1096152850 12:49325489-49325511 CTTTCCTTGCAGAGGCTCCAGGG + Exonic
1097513055 12:60567757-60567779 CTCTCCCATCACAGGCCCCAAGG + Intergenic
1097989274 12:65818071-65818093 CTGTCACAGCAAGGGCTCCTTGG + Intergenic
1100932971 12:99632011-99632033 CTCTCCCATCACAGGCTCAAAGG + Intronic
1102203813 12:111076541-111076563 TCCTCCCAGCAGCTGCTCCAAGG + Intronic
1102304901 12:111797398-111797420 CTCCCCCAGCCTGGGCTACAAGG + Intronic
1102349724 12:112183630-112183652 CTCTCCCAGCAGGCTCTGCAAGG - Intronic
1102929862 12:116853997-116854019 CTCTCCCCTAAGAGGCTCCAAGG + Intergenic
1103944475 12:124518397-124518419 CTGGCCCTGCAGGGCCTCCAGGG - Intronic
1103949714 12:124544096-124544118 CCCTCCCCGCTGGGGCTCCCCGG - Intronic
1104044690 12:125153519-125153541 CTCTGCCAGAAGGGCCTCCCTGG + Intergenic
1104556992 12:129809437-129809459 CTCTCCCAGCTGGCACCCCAGGG - Intronic
1104964871 12:132504426-132504448 CTCTCCCAGGAGGACCACCAGGG - Intronic
1104969093 12:132523146-132523168 CACTCCCAGCAGGAGCTGGAGGG - Intronic
1104981176 12:132573714-132573736 GTTTCCCACCAGGGGCGCCAGGG - Intronic
1104987290 12:132604116-132604138 CTCTCCCAGCAGGGGTGCCTGGG + Intronic
1105705341 13:22964721-22964743 GGCTCCCATCAGGGGCTCCCGGG + Intergenic
1106319698 13:28625718-28625740 CTCTCAGGGCAGGGGCCCCAGGG - Intergenic
1106469251 13:30039955-30039977 CTCTGCCATCAGAAGCTCCAGGG + Intergenic
1106550367 13:30765723-30765745 CTCATCCAGCAGGAGCTCCTTGG + Intergenic
1107309574 13:39062428-39062450 CTCTGCCAGAAGGAGCCCCATGG - Intergenic
1108126737 13:47252671-47252693 CTCTCCCAGCCTGGGCTCCTGGG + Intergenic
1109100837 13:58181708-58181730 ATCCCCTAGCAGTGGCTCCATGG - Intergenic
1109142398 13:58730649-58730671 CTTCCCCAGCAGCTGCTCCAAGG - Intergenic
1112651188 13:101400448-101400470 CTCTCCTATCTGGTGCTCCATGG + Intronic
1113095616 13:106660868-106660890 CTATCCCATCAGGGGCTTCGTGG - Intergenic
1113531883 13:111033084-111033106 CACTCCCTCCACGGGCTCCAGGG - Intergenic
1113763975 13:112869400-112869422 AGCTCCCAGCTGGGGCTCCCTGG - Intronic
1113813545 13:113156475-113156497 CCCTCCCAAAAGAGGCTCCAGGG + Intergenic
1115965907 14:38887938-38887960 CTCTCTCAGCAGGGGTTCCAGGG - Intergenic
1118258505 14:64225654-64225676 CTTACCCAGCACGGGCTCCCTGG + Exonic
1120262120 14:82198952-82198974 CTGCCCCAGCTGGGGCTTCATGG - Intergenic
1122113701 14:99517610-99517632 CTCGCCCACCGGTGGCTCCAGGG - Intronic
1122255346 14:100472204-100472226 CCTGCCCAGCCGGGGCTCCAGGG - Intronic
1122745225 14:103893885-103893907 CTGACACAGCAAGGGCTCCAGGG - Intergenic
1122809648 14:104281646-104281668 CTGTCCCTTCAGGGCCTCCAGGG - Intergenic
1122854895 14:104555265-104555287 CCCTCCCAGCCTGGGCTCCCTGG - Intronic
1123029578 14:105445342-105445364 AGCTCCCAGGAGGGGCTCCAAGG - Intronic
1124003308 15:25777265-25777287 CTCTCAAAGGTGGGGCTCCACGG + Intronic
1124050896 15:26196856-26196878 TTCTCCCTCCAGAGGCTCCAGGG - Intergenic
1124595257 15:31086593-31086615 CTCTCCCAGCAGGGGCTCCAGGG + Intronic
1124692721 15:31839037-31839059 CTCTCCCAGCCCCTGCTCCATGG + Intronic
1124964517 15:34423264-34423286 CTCTTCCAACAGGAGCTGCAGGG - Intronic
1124981137 15:34569490-34569512 CTCTTCCAACAGGAGCTGCAGGG - Intronic
1125722513 15:41852070-41852092 GGCTCCCAGCACTGGCTCCAGGG + Intronic
1125724342 15:41860723-41860745 CTTCCACAGAAGGGGCTCCATGG + Exonic
1126152426 15:45535635-45535657 CTCTAACAGCTGGGGCTCCTTGG + Intergenic
1127379507 15:58418978-58419000 CTCTCTCAGCATGGGCTCCAGGG + Intronic
1127699433 15:61483794-61483816 CGCTCCCTCCAGAGGCTCCAGGG - Intergenic
1127993015 15:64134570-64134592 CTCTCCCAGCAGCTGCACCAGGG - Intronic
1128564020 15:68687474-68687496 CTCACCCAGCAGGCTGTCCAGGG - Intronic
1129070444 15:72946239-72946261 CCCTAGCAGCAGGGGCCCCAAGG + Intergenic
1129152103 15:73695841-73695863 CAATCCCCGCAGGGGCTCCTTGG - Intronic
1129241085 15:74252698-74252720 CTCTTCCAGCAGGATCCCCATGG + Intronic
1129666268 15:77581181-77581203 CTCCTCCAGCAGGGTCCCCAGGG + Intergenic
1130403955 15:83581471-83581493 CTCTCTCTGCAGGGGCTCCAAGG - Intronic
1130892019 15:88141440-88141462 CTCACACTGCAGGGGCTGCAAGG + Intronic
1131885447 15:96907465-96907487 CCCTCCCACCAGGGGTTCGAGGG - Intergenic
1132207645 15:99997554-99997576 GTCGCCGAGCAGGGGCTCCACGG + Exonic
1132242273 15:100266902-100266924 CTATCCCAGCAGAGGATGCAAGG + Intronic
1132375742 15:101327156-101327178 CCGTCCCACCAAGGGCTCCAAGG - Intronic
1132414031 15:101607899-101607921 CGCTCCCTCCAGAGGCTCCAGGG - Intergenic
1132514949 16:361908-361930 TCCTCTCAGCAGGGGCTGCAAGG - Intergenic
1132588359 16:715784-715806 CTCGGCCAGCAGCAGCTCCAGGG - Exonic
1132619112 16:856045-856067 CTCTCCCATCAGGCGCCTCAGGG - Intronic
1133221233 16:4319991-4320013 ATCCCCCAGCAGGGGCTGCTGGG - Intronic
1134243365 16:12522056-12522078 CTGTGCCAGCAGGGGCCCCTCGG - Intronic
1136590923 16:31217157-31217179 CCCTCCCAGCAGGAGCCACAGGG - Exonic
1137549498 16:49427589-49427611 CCCTCCCAGTAGGAGCTCCAAGG + Intergenic
1137733787 16:50709549-50709571 CTCTCCCTGCATGGGGTGCATGG + Intronic
1137777814 16:51071177-51071199 CACTCCCTGCGGGGGCTCTAAGG - Intergenic
1138129974 16:54471303-54471325 CCCTCCCAGCAAGTGCACCAGGG + Intergenic
1138352996 16:56356433-56356455 GCCCCCCAGCAGGAGCTCCAGGG - Intronic
1138443908 16:57051400-57051422 CCCTCCCAGCACTGGGTCCATGG - Intronic
1141420501 16:83912296-83912318 TTGACCCAGCAGGGACTCCAAGG + Exonic
1141578697 16:84982519-84982541 CCCTGTCAGCAGGGGCTACAGGG - Intronic
1141647147 16:85373660-85373682 CGCTCAGAGCAGGTGCTCCAGGG + Intergenic
1141727629 16:85800009-85800031 CTCGGCCAGCGGGCGCTCCAAGG - Intronic
1141769914 16:86083557-86083579 CTCACAGAGCAGGGGCTTCATGG - Intergenic
1141895468 16:86956244-86956266 CTCTCCCGGCGGTGGCTTCAGGG - Intergenic
1142162328 16:88564513-88564535 CTCTCCTAGCAGGTGCTCTAAGG + Intergenic
1142280618 16:89145815-89145837 CTGTCCAAGGACGGGCTCCAGGG + Intronic
1142377148 16:89712007-89712029 CCCTCCCCGCAGCGGCCCCAGGG + Intronic
1142685160 17:1573342-1573364 CACCCCCAGCAGAGGCTCCCGGG - Intronic
1142766143 17:2065335-2065357 CTCCCCCACCTGGGCCTCCATGG + Intronic
1142919129 17:3169295-3169317 ATCCCCCAGCAGTGGCTACATGG + Intergenic
1143037194 17:4006141-4006163 GTCTCCCTGGAGGGGCTCGAGGG - Exonic
1143321678 17:6072429-6072451 CCCTCCGAGCAGGGCCTCTAGGG + Intronic
1143917044 17:10301803-10301825 CTCTGCCATCAGGGAATCCAGGG - Intronic
1144781553 17:17810747-17810769 CGCTCCCAGGCTGGGCTCCAGGG - Exonic
1145011920 17:19373120-19373142 CAGTCCCAGCATGGGTTCCAGGG - Intronic
1145867454 17:28250257-28250279 CTCCCACAGCAGGAACTCCAGGG + Intergenic
1145957962 17:28867919-28867941 CACTCCCTGGAAGGGCTCCAGGG - Intergenic
1146054045 17:29572500-29572522 CTCGCGCAGCAGCGCCTCCACGG + Exonic
1146062791 17:29615825-29615847 CTCTTCCAGCAGCGTCTCCAGGG + Exonic
1146077403 17:29744138-29744160 CTACCCCAGCAGGGGCTTCTGGG - Intronic
1146936738 17:36816729-36816751 CTCTACCAGCAGGGGAGCCCAGG + Intergenic
1147428539 17:40357494-40357516 CTCCCCCAGCTGGGGGTGCAGGG - Intronic
1147748601 17:42711954-42711976 CTTTCCCAGAAGGGACTCCCAGG - Intronic
1148561188 17:48607379-48607401 CCTTCCCAGCAGCGGCACCAAGG - Exonic
1149008768 17:51833133-51833155 TTCTCCCAGCAGAGGCACTAAGG - Intronic
1149320701 17:55477992-55478014 CTCTGCCAGCATGGGCAACATGG + Intergenic
1149998545 17:61417547-61417569 CTCTCCCAGCAAGGTCCCCAGGG - Intergenic
1149998896 17:61419845-61419867 CTCTCACATCTGGGTCTCCAAGG - Intergenic
1150541381 17:66103772-66103794 ATCCCCCAGCAGTGGCTACATGG + Intronic
1151575790 17:74952053-74952075 CTCTCCCCGCAGGGGCCTGACGG - Exonic
1151745674 17:76010436-76010458 CTCTTCCAGCTGGGCCTTCAGGG + Exonic
1152121930 17:78424143-78424165 CTGTCCCTGCAGGGGCTCGCTGG - Exonic
1152212647 17:79010474-79010496 CTCTCCTGCCAGAGGCTCCACGG - Intergenic
1152288989 17:79428255-79428277 CCCTCACTGCAGGGGCTCCGGGG - Intronic
1152330838 17:79671600-79671622 GTCTCCCACCAGGGGCACCGTGG - Intergenic
1152571255 17:81122196-81122218 GTGGCCCAGCAGCGGCTCCATGG + Exonic
1153356723 18:4144466-4144488 GTCTCCCAGCAGGGGCCCTGTGG - Intronic
1153685935 18:7545402-7545424 CGCTCCCTCCAGGGGCTCTAGGG + Intergenic
1157695929 18:49723677-49723699 CTCTCACAGCCGTGGCTCAAAGG + Intergenic
1158505854 18:58045014-58045036 CTCTCCAAGCAGCGTCTCCCGGG + Intronic
1158670353 18:59468625-59468647 CTATCCTAGCAGGGGCTCTAGGG - Intronic
1159092151 18:63861336-63861358 ATCCCCCAGCAGGGGCCACATGG - Intergenic
1159665184 18:71149825-71149847 CACTCCCTCCAGGGGCTCAAGGG - Intergenic
1160465784 18:79074627-79074649 CTCTCCCATCAGGGGATACCGGG - Intronic
1160746997 19:716511-716533 CCCACCCAGGAGGGGCTCCCAGG - Intronic
1160970745 19:1766738-1766760 CTGTCCCACCCGGCGCTCCAGGG + Intronic
1161057969 19:2200150-2200172 CACTGCCAGCAGGGTCTGCAGGG - Intronic
1161063116 19:2225159-2225181 CTGTCCTGGCAGGGACTCCAGGG - Intronic
1161102136 19:2426488-2426510 CCCTCCGAGCTGGGGTTCCAGGG + Exonic
1161331852 19:3692339-3692361 CGCTCCCTACAGGGGCTCCTGGG + Intronic
1161454066 19:4361509-4361531 CCCTGGCAGCAGGGGCTCCGTGG + Exonic
1162027108 19:7900651-7900673 CTCTTCGGGCAGGGCCTCCAGGG - Exonic
1163153466 19:15428049-15428071 CCCCCCCGGGAGGGGCTCCAGGG + Intronic
1163309012 19:16501347-16501369 CTTTCCCAGCAGGTGCTTCAGGG - Exonic
1163439375 19:17313949-17313971 GTCACCCTGCAGGTGCTCCAGGG + Intronic
1163605688 19:18274190-18274212 CCCTCACAGCAGGGGCTCTAGGG - Intronic
1163689719 19:18731926-18731948 CTCTCCCTGCAGGAGCCCCCGGG - Intronic
1163829534 19:19541114-19541136 CTCCCCGAGCAGGGACCCCACGG - Exonic
1165157919 19:33798985-33799007 CTCCCCCAGCAGAGCCTCCTAGG + Intronic
1165596636 19:37015041-37015063 CTCTCCCCGGAGGGGCTTCCTGG + Intronic
1166219998 19:41358012-41358034 CTCTCACTGCAGGGGCGGCATGG - Exonic
1166854670 19:45777617-45777639 CTCTCCCGGTAGGCGCTCCCAGG - Intronic
1167035758 19:46994197-46994219 CTGTCCCAGTAGGGACACCAGGG + Intronic
1167355804 19:49003318-49003340 CTCTACCTGCCGAGGCTCCAAGG - Exonic
1168048441 19:53810712-53810734 TCCTCCCAGCAGAGGCACCAGGG + Exonic
1168305627 19:55433597-55433619 ATCGCCCAGCAGGTGCTCCTGGG + Exonic
1168483203 19:56738922-56738944 CTCTTGCAGGAGGGGCTCCCAGG - Intergenic
925298902 2:2795995-2796017 CTCTCTCTGCTAGGGCTCCAAGG - Intergenic
925958550 2:8993687-8993709 CTCTACCAGGAAGTGCTCCAAGG + Intronic
926075371 2:9938389-9938411 CTCTCCCAGCCGGGGCAGCCCGG - Intergenic
926197715 2:10773818-10773840 GTCCCCCAGCAGGGGCCCCAGGG - Intronic
926198313 2:10776686-10776708 GTCCCCCAGCAGGGCCTCCCTGG - Intronic
926693567 2:15754502-15754524 TTCTCCCAGCACGGCCTCCATGG - Intergenic
926796647 2:16625214-16625236 GGCTCCCAGCTGGGGCTCCCAGG + Intronic
926886337 2:17602172-17602194 TTCTTCCCGCAGGTGCTCCATGG - Intronic
927937410 2:27083487-27083509 CTCTCCTTGCAGGGCCTGCAGGG - Exonic
928282857 2:29964173-29964195 CTGTCCCAGCAGGCTCTACAGGG - Intergenic
928715661 2:34056748-34056770 ATCCCCCAGCAGTGGCTGCATGG - Intergenic
930028705 2:47045311-47045333 CAGTCACAGCAGGGCCTCCAGGG + Intronic
930933659 2:56919909-56919931 TTCTCCCAGCAGAGCTTCCAGGG + Intergenic
932839898 2:75072412-75072434 CTCTCACATCTGGGTCTCCAAGG - Intronic
933969042 2:87455318-87455340 CTCTTCCAGGAAGGGCTGCAGGG + Intergenic
934033795 2:88071603-88071625 CCCTTCCAGCAGGTCCTCCAGGG + Intronic
934047041 2:88180808-88180830 CTCTCCCTGCACAGGCACCAGGG - Intronic
936324749 2:111495189-111495211 CTCTTCCAGGAAGGGCTGCAGGG - Intergenic
937076778 2:119112988-119113010 CTCTCCCAGCAGCTGCTGCCAGG + Intergenic
937084663 2:119162996-119163018 CTCTTTCAACATGGGCTCCAAGG - Intergenic
937246587 2:120497746-120497768 CTCTGACAGCTGGGACTCCATGG + Intergenic
937924001 2:127153959-127153981 CTATCCCAGCAGAGGCTCTGAGG + Intergenic
938243029 2:129757717-129757739 CTCTCCCAGCATGTGGTTCAAGG - Intergenic
939985913 2:148829821-148829843 CTCCACCAGCAGGGGCTCTCAGG + Intergenic
940416164 2:153422374-153422396 CTATCCCATCAGGGGCTGGAGGG + Intergenic
940429892 2:153576605-153576627 AACCCCCAGCAGGGGCTGCATGG - Intergenic
942208343 2:173646136-173646158 CTCTCCCTGCAGGCTCTTCAGGG - Intergenic
942391903 2:175503416-175503438 ATCTCCCAGCAGCAGCTACATGG - Intergenic
942811661 2:180007033-180007055 CTCTGCCTGCGGGGACTCCACGG + Exonic
944227232 2:197360039-197360061 CTGGCCCAGCAGGGGCCCCTAGG - Intergenic
945062697 2:205923150-205923172 CTCACCCAGCAGGTACACCATGG + Intergenic
945147900 2:206758216-206758238 ATGTCCCAGCAGGAGCTGCAAGG + Intronic
945985773 2:216352359-216352381 CTGCCCCAGCAGATGCTCCAGGG + Intronic
946158703 2:217823067-217823089 CTTGGCCAGCAGGGGCTGCAGGG - Intronic
947385576 2:229587277-229587299 CTCTACCAGCAGGGGGACCCCGG - Intronic
947525054 2:230872610-230872632 CTCTCCTGGCAGGAGCTCCCTGG + Intronic
948394195 2:237632433-237632455 CTGTCCCAGCAGGGGCATGAGGG - Intronic
948450718 2:238069445-238069467 TTCTTCCACCAGGTGCTCCAGGG - Exonic
948632330 2:239310106-239310128 TTCCCCCAGCAGGGGGTCCTGGG - Intronic
948756449 2:240162262-240162284 CGCTCGCCGCAGAGGCTCCAGGG - Intergenic
1168789030 20:563646-563668 CTCTCCCCTCAGTGGCTCTAGGG - Intergenic
1168991765 20:2102114-2102136 ATCCCCAGGCAGGGGCTCCAGGG + Exonic
1173329601 20:42063389-42063411 CACCCCCAGCAGGGCCTCAAGGG - Intergenic
1173426175 20:42945564-42945586 TTGTCCCATCAGGGCCTCCAAGG + Intronic
1173771933 20:45667159-45667181 CTCACTGTGCAGGGGCTCCATGG - Exonic
1173809669 20:45948232-45948254 CTCCCCCAGCAGGGCCTGTATGG + Intergenic
1173867192 20:46319932-46319954 GTGGCCCAGCAGGGCCTCCAGGG - Intergenic
1174166340 20:48586216-48586238 CTTTCCCACCAGGCGCTCCCGGG + Intergenic
1174388406 20:50200804-50200826 CTGTCCCTGCCAGGGCTCCAGGG - Intergenic
1174589699 20:51635344-51635366 CTCTCACAGCCTGGGCTCAAGGG - Intronic
1175527337 20:59644514-59644536 TGCTCCCAGCTGGGACTCCAGGG + Intronic
1175934152 20:62507442-62507464 CTCCCCCAGCATGGCCTCCTGGG + Intergenic
1176000510 20:62829443-62829465 CTCTCCTGGCAGGGCCTCCCTGG + Exonic
1176041392 20:63067755-63067777 CTCACCCACCATGAGCTCCACGG - Intergenic
1178488765 21:33034699-33034721 CCCTGCCAGCAGGGGCTCCCAGG - Intergenic
1178630188 21:34252739-34252761 CGCTCCCTGCAGAGGCTCTAGGG - Intergenic
1179012736 21:37568633-37568655 GCCTCCCAGCAGGGCCTCGAGGG + Intergenic
1179189622 21:39112421-39112443 CTCTCCCTGAAGAGTCTCCAAGG - Intergenic
1179612557 21:42561857-42561879 CACCCCGAGCAGGGGCACCAGGG - Intronic
1179792175 21:43762105-43762127 CTCCCTCAGCAGGGGGACCACGG - Exonic
1180048362 21:45320072-45320094 CTCCCACAGCAGAGCCTCCAAGG - Intergenic
1180070219 21:45432171-45432193 CTGCCCCAGCAGGGCCTCCCTGG + Intronic
1180140993 21:45893281-45893303 CTGTCACAGCAGGGGCTGGAGGG + Intronic
1180144531 21:45911970-45911992 CTCGGCCCGCAGGGCCTCCAGGG - Intronic
1180701730 22:17784994-17785016 GTGTCCCAGCAGCAGCTCCAGGG - Intergenic
1180847825 22:18994077-18994099 CTCTCTCATCAGGGCCTCCAAGG - Intergenic
1181039476 22:20185005-20185027 CTCTGCCAAGAGGGGCCCCACGG - Intergenic
1181185828 22:21103017-21103039 TTCTCCCCGCAGGTGCTGCATGG + Intergenic
1181495870 22:23287236-23287258 GTCTCCCAGCATGGCCTTCAGGG + Exonic
1182486309 22:30641153-30641175 CTTTCTCAGCAGGGGCAGCATGG - Intronic
1183018653 22:35009799-35009821 CTGTCCCAGCAAGGACTCCCAGG + Intergenic
1184234252 22:43174605-43174627 CTCTCCCCACAGGGTCTACACGG - Exonic
1184242978 22:43221168-43221190 CTCACCCAGCAGCGGCTGCCTGG + Exonic
1184472803 22:44705188-44705210 CGCTCCCACCAGAGGCTCTAGGG + Intronic
1184530022 22:45049474-45049496 CTCTTCCACCAGGGCATCCACGG - Intergenic
1184785910 22:46671984-46672006 CCCTCCCTGCAGGGGCCCCAGGG - Intronic
1185125632 22:49009186-49009208 CACTCCCTGCAGGGGCTCTAGGG + Intergenic
1185182003 22:49369045-49369067 CTCTCCCAGGAGCGTCCCCATGG + Intergenic
1185244445 22:49765709-49765731 CACTCCCCGCAGGGGCTGTAAGG - Intergenic
1185272310 22:49935144-49935166 CGCTCCGAGCAGGGACTCCGAGG - Intergenic
1185275649 22:49949290-49949312 CTCTCCCTGACGGGGCTCCTTGG + Intergenic
1185301775 22:50084634-50084656 CTGTCCCACCTGGGGCTCCAGGG + Intronic
950077379 3:10196611-10196633 CTCTCCCAACCTGGGCTCCACGG - Intronic
950118231 3:10464875-10464897 CTCTGCCAGCACCTGCTCCATGG - Intronic
950422568 3:12907463-12907485 TTCTCCCAGGAGGGGCCCCGGGG - Intronic
950540556 3:13609741-13609763 CACTCCCAGGAGGAGCCCCAAGG - Intronic
953709680 3:45259634-45259656 GCCTCCCAGAAGGGGCTCCAGGG - Intergenic
953809809 3:46102455-46102477 CTCTCCCCAAAGTGGCTCCAGGG + Intergenic
953855820 3:46498569-46498591 CTCTCCTCCTAGGGGCTCCAAGG - Intronic
954132230 3:48566668-48566690 CTCTCTCGCCAGGAGCTCCAGGG + Exonic
954293271 3:49660894-49660916 CTCAACCAGCTGCGGCTCCAGGG + Exonic
954700211 3:52446912-52446934 GACACCCAGCAGGGGCTGCAGGG + Intergenic
954712800 3:52513313-52513335 CTCCCACATCAGGGGCCCCATGG + Intronic
954713552 3:52516376-52516398 CTGTGCCAGGAGGGGCTGCAAGG + Exonic
954985416 3:54786451-54786473 CCCTCCCTGCACTGGCTCCATGG + Intronic
955274502 3:57534217-57534239 CAATCCCAGCAGTGGCTGCATGG - Intronic
955328156 3:58025493-58025515 CTCTCCCAGCAGCGGCAGTAAGG + Intronic
958060533 3:88474251-88474273 CCCTCCCATCACAGGCTCCAAGG + Intergenic
959474232 3:106790128-106790150 ATCTCCCAGCAGTGGCTGCATGG + Intergenic
960818414 3:121699091-121699113 ATCTCCCAGCTGGACCTCCAAGG + Intronic
961367271 3:126407993-126408015 TTCTCCCAGCCTGTGCTCCATGG + Intronic
961444507 3:126972836-126972858 GGCTCCCAGCAGGCTCTCCATGG + Intergenic
961567748 3:127775844-127775866 CTCTCGCAGCAGCGCCTCCTGGG + Intronic
961567912 3:127776609-127776631 CTGTCCCAGCAGCGCATCCATGG + Intronic
962482104 3:135806755-135806777 CTCAGTCGGCAGGGGCTCCAGGG + Intergenic
963286079 3:143435910-143435932 CCCTCCCTGCAGGGGCTGCCTGG + Intronic
964803983 3:160587091-160587113 GTCCCCCAGCAGTGGCTGCATGG + Intergenic
966870359 3:184286361-184286383 CTTTCACAGATGGGGCTCCATGG + Intronic
967311020 3:188106277-188106299 CTCTCCAGGCACTGGCTCCAGGG + Intergenic
968038593 3:195569509-195569531 CTCTGCCAGCAGCGGCATCATGG + Intronic
968359651 3:198138126-198138148 CTCTCCCAGTAGCAGCTCCCAGG - Intergenic
968503839 4:963043-963065 CTCGGCCGGCAGGAGCTCCACGG - Intronic
968663875 4:1810325-1810347 CTGCCCCACCAGGGGCTCCCTGG + Intergenic
968734081 4:2286196-2286218 CTCTCCCAGCATGGGCTGCATGG + Intronic
969645841 4:8428346-8428368 CTCACCCAGCAGGCGCTCAGGGG + Intronic
974260470 4:59518735-59518757 CCCTCCCAGCAGTGGCCGCAGGG + Intergenic
978069365 4:104447567-104447589 CTCACCCAGCAGGATCTGCAAGG + Intergenic
981663976 4:147200480-147200502 CTCTGCCAGCCTGGGCTTCATGG + Intergenic
984915474 4:184719297-184719319 ATCTCCCAGCAGTGGCTGCGTGG + Intronic
985670872 5:1206019-1206041 CTCTCTGAGCTGGGGTTCCAGGG - Intronic
985820367 5:2156048-2156070 CACTCCCTCCAGCGGCTCCAGGG + Intergenic
985971280 5:3380644-3380666 CTCTCCCTCCAGGGGCTCCAGGG - Intergenic
986663956 5:10083793-10083815 TTCTCCCAGCGTGGGCACCAAGG + Intergenic
986672512 5:10155296-10155318 CTTGCCCAGCATGGCCTCCATGG - Intergenic
986798875 5:11239647-11239669 CGAGCCCAGCAGGGCCTCCAAGG - Intronic
987203584 5:15602122-15602144 TGCTCCCTGCAAGGGCTCCATGG - Intronic
988227050 5:28426258-28426280 CCCTCCCATCACAGGCTCCAAGG + Intergenic
989130839 5:38105273-38105295 ATCTCCCAGAAGGGTCTGCAGGG + Intergenic
990977116 5:61569888-61569910 TTCTCCAAGCAGGGGCAGCAAGG - Intergenic
991003896 5:61809363-61809385 CTCCCCCAGCTGGAGCTCCTGGG - Intergenic
997691167 5:135828467-135828489 CTCCCCCAGCAGGAGCTCACTGG - Intergenic
997695376 5:135857085-135857107 CTCACCCAGCTGGGACGCCAAGG + Intronic
997950895 5:138241905-138241927 CTCGCCCAGCAAGGACTCCAGGG + Intergenic
999128478 5:149264605-149264627 CCCTCCCTGCATGGGCTCCCTGG - Intergenic
999323132 5:150626876-150626898 CTCTCTCTCCAGGTGCTCCATGG - Intronic
999438165 5:151580553-151580575 CCCTCCCACAAGGGGCTCCTGGG - Intergenic
1001579047 5:172786000-172786022 CATGCCCAGCAAGGGCTCCATGG - Intergenic
1002299089 5:178247542-178247564 CTCCTCCTGCAGGGCCTCCAGGG - Exonic
1002435194 5:179227326-179227348 CTCTCCCAGCAGCTCCCCCAGGG + Intronic
1002632395 5:180590594-180590616 CTTTACCAGCAGGGCCTTCAGGG + Exonic
1003606658 6:7567869-7567891 CTGTTCCAGCAGGTGCTGCAGGG - Exonic
1004309683 6:14533889-14533911 TTCTTCCAGCTGGGGCTGCAAGG + Intergenic
1005947094 6:30602665-30602687 CTGGCCCACCAGGGCCTCCATGG + Exonic
1006164884 6:32058302-32058324 CTCCCCCAGGAGAGGCTCCTCGG + Intronic
1006168386 6:32079277-32079299 CTCCCCCAGGAGCGGCTCCTCGG + Intronic
1006523952 6:34588335-34588357 GTTTCCCAGCAGGGGCTTCATGG - Exonic
1006808470 6:36804668-36804690 CACCCCCAGCATAGGCTCCAAGG + Intronic
1007272554 6:40649540-40649562 CCCTCCCCGAAGGGTCTCCATGG + Intergenic
1008885873 6:56431265-56431287 CTCCCCCACCAGGGGAGCCAGGG + Intergenic
1012265062 6:97131729-97131751 CTCCCCCAGCAGCAGCTGCAAGG - Intronic
1015796397 6:137016236-137016258 GGCACCCAGCTGGGGCTCCATGG + Intronic
1015848829 6:137550932-137550954 CTTTCCCAGCAGGTTCACCATGG - Intergenic
1017377345 6:153786634-153786656 CTCTCCCTTCAGTGGCTCCAGGG - Intergenic
1017818842 6:158034430-158034452 CTCTCCCAGCAGCGGCAGCGAGG - Intronic
1018356421 6:163022011-163022033 GCCTCCCAGCAGGGGGTCCGTGG - Intronic
1018905265 6:168072209-168072231 CCCTCCCAGCAGGGGGTGCAGGG - Intronic
1019064828 6:169288139-169288161 TCCTCCCTCCAGGGGCTCCATGG + Intergenic
1019260340 7:78524-78546 CTCTCCCAGTAGCAGCTCCCAGG + Intergenic
1020067240 7:5197995-5198017 CCCTCCCAGCAGGGGCCTCGGGG - Intronic
1023643332 7:42283472-42283494 CTCACCCAGCAGAGTCTGCAGGG + Intergenic
1023716127 7:43046251-43046273 ATCCCCCAGCAGTGGCTGCATGG + Intergenic
1025812298 7:64882855-64882877 CTCTCCCGGGAGGGGCTTCCCGG + Intronic
1026533544 7:71221146-71221168 ACCTCCCACTAGGGGCTCCAGGG - Intronic
1026601976 7:71784795-71784817 CACTTCCAGCTGGGGCTACATGG + Exonic
1027360157 7:77400096-77400118 CTCTACCAGCAAAGGCTGCATGG + Intronic
1030266679 7:107628971-107628993 CAATCCCACCAGGGGATCCAAGG + Intronic
1030408449 7:109144008-109144030 CTCTTCCAGCAGTGGCAACATGG - Intergenic
1031086330 7:117305050-117305072 CCCTTGCTGCAGGGGCTCCAAGG + Intronic
1032095583 7:128937134-128937156 CCCTCCCAGGTGGGGTTCCAGGG - Intergenic
1033060058 7:138097526-138097548 CTGTCCCAGCAGGGGGAGCAGGG + Intronic
1034557649 7:151860206-151860228 CTCCAGCAGGAGGGGCTCCACGG - Intronic
1034896677 7:154880592-154880614 GTCTCCCAGAAGGGGCTCTGCGG + Intronic
1035169229 7:157008829-157008851 CTCTCCGGGCTGGGGCTCCGGGG - Intronic
1036648996 8:10630163-10630185 CACTCCCAGCTGGGGGTCAAGGG - Intronic
1036712157 8:11086944-11086966 ATCTCCAGGCAGTGGCTCCATGG + Intronic
1037722972 8:21460258-21460280 CTCTCCAAGCAAGGCCTCCAAGG + Intergenic
1037795440 8:21989712-21989734 TTTTCTCAGCAGGGGTTCCAAGG - Intronic
1037819583 8:22129192-22129214 CTCTCCCAGAGGGGGGTCCCTGG + Exonic
1038404322 8:27310599-27310621 TTCTCCCAGCACGGGCCCCTGGG + Intronic
1038419342 8:27422392-27422414 CCCTCCCAGCAGAGGCCTCAGGG - Intronic
1039402197 8:37279414-37279436 CTCTCCCACAAGGAGCTCAAAGG - Intergenic
1039457560 8:37717607-37717629 CTGGCCCAGCAGGGGCTCTCTGG + Intergenic
1039589523 8:38734881-38734903 CTCTCACAGCTGGCTCTCCAGGG + Intronic
1041691627 8:60693394-60693416 CTCTCTCTGCAGGTGCCCCAAGG - Intronic
1042576555 8:70227066-70227088 CTTTCCCAGGAGAGGGTCCACGG + Intronic
1044320644 8:90797071-90797093 GACTCTCAGCTGGGGCTCCATGG + Intronic
1044708443 8:95031260-95031282 CTCTTTCAGCAGGTGCTGCAAGG + Intronic
1045494733 8:102698836-102698858 CTTTCCCAGCCAGGACTCCAGGG - Intergenic
1045823698 8:106371993-106372015 CTCTCCCACAAGGAGCTCAAAGG + Intronic
1049093480 8:140534330-140534352 CTCACCCACCAGGGCCTCCTGGG - Intronic
1049229619 8:141475194-141475216 CCTTCCCAGCAGCGGCCCCAGGG - Intergenic
1049397054 8:142405763-142405785 CTGTCCAGGCAGGGGCTGCAGGG - Intergenic
1049631169 8:143658437-143658459 CTCTCCCATCAGAGGCTCAGAGG - Intergenic
1050888067 9:10790468-10790490 CTCTCCCAGCACCCACTCCAGGG + Intergenic
1055058623 9:72046502-72046524 CTCTCCCAGTGGCTGCTCCATGG - Intergenic
1056306701 9:85297933-85297955 CACTCCCTCCAGAGGCTCCAGGG + Intergenic
1056799566 9:89681533-89681555 CTCCCCCACCACGGGCTCCTGGG + Intergenic
1057049069 9:91908211-91908233 CTATGCCAGGAAGGGCTCCAAGG + Intronic
1059275649 9:113094702-113094724 CTCTTCAAGGAGAGGCTCCAAGG + Intergenic
1059306483 9:113357192-113357214 GTGTCCCAGCATGGGTTCCAAGG + Intronic
1059414984 9:114156730-114156752 CTCTCCCAGGAGCGGCTGCGCGG + Intronic
1060015974 9:120086778-120086800 CTCTCCTAGAAGTGGCTTCAAGG - Intergenic
1060584166 9:124775835-124775857 CTCTCCCAGCCTGGGCAACATGG - Intergenic
1060884466 9:127140795-127140817 CTCTTCCAGCGTGGACTCCATGG - Intronic
1061192957 9:129092955-129092977 CTGACCCAGAGGGGGCTCCAGGG - Intergenic
1061251622 9:129429645-129429667 GTCTCCCTGCAGGGTCTCCCCGG - Intergenic
1061406716 9:130396300-130396322 CTCTCCCACCTGGGGCTCCTGGG - Intronic
1061817608 9:133206178-133206200 GTCTCCTCGCAGGGGCTCCCGGG - Intronic
1061820617 9:133225538-133225560 CTCTCCCCTCGGGGGCACCAGGG + Intergenic
1061834562 9:133320369-133320391 CTCACCAAGCAGGCACTCCACGG - Intergenic
1062245526 9:135564033-135564055 CCCCCTCAGCCGGGGCTCCATGG + Intronic
1062365734 9:136208152-136208174 CCCTCCAAGCAAGTGCTCCAGGG - Exonic
1062413464 9:136436279-136436301 CGGGCCCAGCAGGGGCTCCTCGG + Intronic
1062445538 9:136592602-136592624 CGCTCCCTCCAGAGGCTCCAGGG - Intergenic
1062744358 9:138201947-138201969 CTCTCCCAGTAGCAGCTCCCAGG - Intergenic
1185918583 X:4063598-4063620 CACTCCCTCCAGGGGTTCCAGGG - Intergenic
1185975973 X:4720407-4720429 ATCTCCAAGCAGGGGCTTCCAGG - Intergenic
1187038772 X:15570711-15570733 CTGTCCAAGCAGGGGCACAAGGG - Intronic
1187700482 X:21960213-21960235 CTCTCCCAGAACTGGCTCCAAGG - Intronic
1188993718 X:36856017-36856039 CTCTCACAGCCAGGGCTCTATGG + Intergenic
1190602766 X:52109184-52109206 ATCCCCCAGCAGTGGCTACATGG - Intergenic
1190808486 X:53861721-53861743 ATCCCCCAGCAGTGGCTGCAAGG - Intergenic
1193366840 X:80644407-80644429 TACCCCCAGCAGGGGCTGCATGG - Intergenic
1193563477 X:83048392-83048414 CTCCCCCAGCAGTGGCTACATGG - Intergenic
1193697204 X:84723818-84723840 CTGTGCAAGCAGGGGCTACAGGG - Intergenic
1196655184 X:118210711-118210733 CTCTTCCAGCAGGATGTCCAAGG + Intergenic
1199455314 X:148021249-148021271 ATCCCCCAGCAGTGGCTGCATGG - Intronic
1199593957 X:149492407-149492429 TGCTCCAAGCAGGGGCTGCAGGG + Intronic
1200228772 X:154433728-154433750 CCCTTCCAGCAGGGGCTCTGGGG + Intronic
1200742368 Y:6868142-6868164 CTGTGGCAGCAGGGGCTGCATGG + Exonic
1201639296 Y:16161594-16161616 CTCTCCCTCCACAGGCTCCAAGG - Intergenic
1201663517 Y:16423733-16423755 CTCTCCCTCCACAGGCTCCAAGG + Intergenic