ID: 1124595562

View in Genome Browser
Species Human (GRCh38)
Location 15:31088960-31088982
Sequence TGGGGCTCCCAGCACTTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124595561_1124595562 -9 Left 1124595561 15:31088946-31088968 CCTCTGTGAGGCAGTGGGGCTCC 0: 1
1: 0
2: 2
3: 28
4: 240
Right 1124595562 15:31088960-31088982 TGGGGCTCCCAGCACTTTCTTGG 0: 1
1: 0
2: 2
3: 16
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124595562 Original CRISPR TGGGGCTCCCAGCACTTTCT TGG Intronic
900203305 1:1420724-1420746 TGGGGGTCCCAGCACTGGGTGGG - Intronic
901036123 1:6337248-6337270 AGAAGCTCCCAGCACCTTCTGGG + Intronic
901665910 1:10826037-10826059 CTGGGGACCCAGCACTTTCTTGG + Intergenic
902331121 1:15731712-15731734 TGGGGCTCCCAGACCTCTCCTGG + Intronic
902544860 1:17183886-17183908 TGGGGCTCCCTGAACTCCCTGGG - Intergenic
902956314 1:19926248-19926270 CAGGGCTCCCAGCACTTTGATGG + Intergenic
904477675 1:30775415-30775437 TTGGGCTTCCAGAACATTCTTGG - Intergenic
904857985 1:33514497-33514519 TGGGGCACCCAGCACTCTGCTGG - Exonic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
909128485 1:71706507-71706529 TGGGGATGCCAGCATTCTCTTGG - Intronic
916599239 1:166276148-166276170 TGGGTCCCCCAGGACTTCCTGGG + Intergenic
922257061 1:223901479-223901501 TGGTGCTCCCTGCTCTCTCTAGG - Intergenic
923072004 1:230574287-230574309 TGGGGCTGCCAGCAGGTTCAGGG + Intergenic
924338254 1:243004290-243004312 TGGTGCTCCCTGCTCTCTCTAGG - Intergenic
1062958273 10:1554287-1554309 TGGGGCTCCCAGTCCTTCCCTGG + Intronic
1063193820 10:3721253-3721275 TGAGGCTCTCAGCTCTTTATCGG - Intergenic
1064434091 10:15295683-15295705 TGGGGAACCCAGCATTTTATGGG + Intronic
1065952074 10:30661286-30661308 TGGTAATCCCAGCACTTTGTGGG - Intergenic
1067145849 10:43693333-43693355 TGGGGATCAAAGCACTTTCTGGG - Intergenic
1072443568 10:95478681-95478703 TGGGGGTCCCAGAACTGTGTTGG - Intronic
1073137876 10:101229759-101229781 TGGGGTTCCCACCACTCTTTCGG - Exonic
1074373389 10:112918930-112918952 ATGGGCTCCCACCCCTTTCTGGG + Intergenic
1074490002 10:113931457-113931479 TGGTGCTTCCAGCACTTGGTGGG - Intergenic
1077093276 11:789028-789050 TGGGGCTCCGATCACCTCCTTGG - Intronic
1077340323 11:2023496-2023518 TGGCTCTCCCTGCACTGTCTGGG + Intergenic
1077361361 11:2141603-2141625 TGGGGATCCAAACACATTCTTGG + Intronic
1084547403 11:69821305-69821327 TGGGGCCCCCAGCAGTTCCCAGG + Intergenic
1084683623 11:70681125-70681147 TGGGGCTGCCGGCACCTGCTGGG + Intronic
1202823308 11_KI270721v1_random:78685-78707 TGGCTCTCCCTGCACTGTCTGGG + Intergenic
1092387187 12:8044807-8044829 GGGGACCCTCAGCACTTTCTCGG - Exonic
1093147368 12:15582356-15582378 TTGGTCTCCCAGCACTTCCCTGG - Intronic
1095347547 12:41169309-41169331 TGGTTCTCCCAGGACTTTCCTGG + Intergenic
1096186646 12:49585969-49585991 GGGGGCTCCCTGCATTGTCTTGG - Intronic
1096245783 12:49984996-49985018 TGGGCCTCCCTGCTCTTTCTGGG + Intronic
1098214399 12:68200339-68200361 TAGGGCTCTCAGCATTTTCCAGG - Intergenic
1100518281 12:95349495-95349517 AGGGGCTGCCCGGACTTTCTGGG - Intergenic
1101965022 12:109276643-109276665 TGTGGCTCCCAGCCCTTTCCTGG + Intergenic
1102063095 12:109949979-109950001 TGTGTCTCCCAGCCCTGTCTAGG - Intronic
1103804941 12:123565100-123565122 TGGGGCCCCCAGCATGCTCTGGG - Intergenic
1103844756 12:123893582-123893604 TGGGGCTCACTGCCCCTTCTAGG + Intronic
1103907952 12:124336932-124336954 CGGGGCTCCGAGCCCTTGCTGGG + Exonic
1104000872 12:124859139-124859161 TTGCGATCCCAGCACTTTATGGG - Intronic
1104553597 12:129779946-129779968 TGGGGCTGACAGTGCTTTCTCGG - Intronic
1104694254 12:130851745-130851767 TGGGCCTCCCAGATCCTTCTGGG + Intergenic
1105019782 12:132808370-132808392 TGGGGCTTCCGGCACATCCTAGG - Exonic
1105444135 13:20437932-20437954 TGGAGACCTCAGCACTTTCTAGG - Intronic
1105696859 13:22897691-22897713 GGGGGCTGCCTGCTCTTTCTCGG + Intergenic
1106418207 13:29563730-29563752 TGGGTCTCCCAGCACATGCAGGG + Intronic
1106480523 13:30133798-30133820 TGGGGCTCCCAGCTCTGGCCCGG - Intergenic
1111342734 13:86909501-86909523 TGGTTCTGCCAGCACTTTGTTGG + Intergenic
1118815879 14:69313515-69313537 TGGGCCTCCCTCCACTTTCTTGG + Intronic
1119337543 14:73846684-73846706 TTGTAATCCCAGCACTTTCTGGG - Intergenic
1121083740 14:91129008-91129030 CTGGGCTCTCAGCACATTCTTGG + Intronic
1123028143 14:105438279-105438301 TGGGGCTCCCGGCAGGGTCTGGG + Intronic
1123427023 15:20180914-20180936 TGGGGCTGACAGCACATTCCTGG + Intergenic
1123536252 15:21187423-21187445 TGGGGCTGACAGCACATTCCTGG + Intergenic
1123924128 15:25091651-25091673 AGGGGCTCCCTGCCCTCTCTAGG - Intergenic
1124409471 15:29424251-29424273 TGGGGCTCCCACCGCTGACTGGG + Intronic
1124595562 15:31088960-31088982 TGGGGCTCCCAGCACTTTCTTGG + Intronic
1127973484 15:63980143-63980165 TGGTGCTCCCATGACTTGCTTGG - Intronic
1129458237 15:75687104-75687126 TTGTGCTCCCAGGAGTTTCTGGG - Intronic
1129725545 15:77899762-77899784 TTGTGCTCCCAGGAGTTTCTGGG + Intergenic
1129931379 15:79413746-79413768 TGTGTATCCCAGCACTATCTAGG + Intronic
1130748814 15:86687221-86687243 TGAGGCTCACAGCAGCTTCTAGG - Intronic
1131487278 15:92831893-92831915 TGGGGCTCCCTGCAGCCTCTGGG + Intergenic
1132010558 15:98272510-98272532 TGCGACTCCCAACACCTTCTAGG - Intergenic
1132939196 16:2498649-2498671 TGGAGCTCACAGCATTGTCTTGG + Intronic
1133146540 16:3791257-3791279 TGGGGCTCCCTGCCATTTGTAGG - Intronic
1136098573 16:27976595-27976617 TGGAGCCCTCAGCTCTTTCTTGG - Intronic
1137599129 16:49744158-49744180 TGGGGCTCCAAACACCCTCTTGG - Intronic
1137612838 16:49830387-49830409 GGGAGCACCCAGCACTGTCTGGG - Intronic
1139015402 16:62683947-62683969 TGGGTATCCCTGCACTTTCATGG + Intergenic
1143118978 17:4595712-4595734 TGGGGCTCCCAGCTCTGGCCAGG - Intronic
1143826218 17:9609898-9609920 TGCTGCTCCCAGCATTCTCTGGG - Intronic
1144954156 17:19010805-19010827 TGGGGCCCCCGGCTCTGTCTTGG + Intronic
1145887927 17:28395824-28395846 TGGGCCTCCCAGCACCTGCCTGG + Exonic
1145971589 17:28959548-28959570 GGGGGGTCCCAGCAATTTGTGGG - Intronic
1146936031 17:36813225-36813247 TGGGGCTCCCAGTCCTTCGTTGG + Intergenic
1149098696 17:52876571-52876593 TGGTAATCCCAGCACTTTGTGGG + Intronic
1151095243 17:71490079-71490101 TGGAGTTCCCAGCACATCCTTGG - Intergenic
1151368259 17:73630914-73630936 GGTGGTTTCCAGCACTTTCTAGG + Intronic
1151632079 17:75317932-75317954 TGGGGCTCACAGGCCTTCCTGGG - Intergenic
1152040356 17:77898919-77898941 TGGGGCTCCTGGTGCTTTCTTGG - Intergenic
1152091810 17:78251365-78251387 CGGGGCTCCCAGCTCCTCCTTGG - Intergenic
1152129468 17:78467202-78467224 AGGGACTCCCTGCCCTTTCTGGG - Intronic
1152431923 17:80253050-80253072 TGGGGCTGGCAGCACCTTCCCGG + Exonic
1152529669 17:80910184-80910206 CGGGGAGCCCAGCACTTTCAGGG - Intronic
1152893911 17:82898933-82898955 TGGAGCTCCCACCACTTCCACGG + Intronic
1154209016 18:12363193-12363215 TGAGGCTCCCAGGACTTGCTAGG - Intronic
1155506536 18:26538895-26538917 TGGGGCCCCCAGCCTTTGCTGGG - Intronic
1156496190 18:37526738-37526760 AAGGGGTCCCTGCACTTTCTGGG + Intronic
1156521332 18:37724507-37724529 TGGGGCTCCCAGGGCTCTATGGG + Intergenic
1156539851 18:37898721-37898743 TGGGGCTCCCTGCAGTTCATGGG - Intergenic
1160378548 18:78431535-78431557 TGGGGCTCTCAGCACCTCCCAGG - Intergenic
1160779433 19:871310-871332 AGGGGCTCCCAGCACGTCCCGGG - Intronic
1161614088 19:5260512-5260534 TGGGGCTCCCAGCACTCTGGGGG + Intronic
1161728685 19:5945804-5945826 CGGGGCTCCCAACAGTCTCTTGG + Intronic
1162472903 19:10883065-10883087 CTGGCCTCCCAGCACTCTCTGGG + Intronic
1163126457 19:15246795-15246817 TGGGGGCCCCAGCACTTGCAAGG - Intronic
1163948789 19:20565342-20565364 TGGTGGTCCCTGCACATTCTGGG + Intronic
1165091244 19:33389421-33389443 TGGGACCCCCAGCAGCTTCTGGG - Intronic
1165378531 19:35461103-35461125 TTGGCCTCCCATCACTTTCTTGG - Intergenic
1167263296 19:48470662-48470684 TGTGGCCCCAAGCACCTTCTTGG - Exonic
926910543 2:17848788-17848810 TGAGGCTCCCCACACTTTCAAGG + Intergenic
927233698 2:20850339-20850361 TAGGGCTATCAGCTCTTTCTGGG + Intergenic
928189383 2:29148170-29148192 TGGGGCTCCCAGGGCTGTCAAGG - Intronic
928862525 2:35875493-35875515 GGGAGATACCAGCACTTTCTTGG + Intergenic
929029242 2:37635533-37635555 TGGGGCTCCCAGGCCTTTCTGGG + Intergenic
929074780 2:38071650-38071672 TAGGGCTCACAACACTTTTTAGG + Intronic
932436046 2:71703087-71703109 TGTGGCCCCCAGCCCTTTCCAGG - Intergenic
936983665 2:118287898-118287920 TGGGCCACCCAGGACCTTCTTGG + Intergenic
939739568 2:145888748-145888770 TGGGGCTGCCTGAATTTTCTGGG + Intergenic
945190546 2:207183130-207183152 TGCGGCTGCCAGCAATTTCATGG - Intergenic
948643230 2:239388394-239388416 TGCGGCTTCCAGGACTATCTGGG + Intronic
948718413 2:239881079-239881101 TGGGTCTCCAAGCAGGTTCTGGG - Intergenic
1169772557 20:9217610-9217632 AGGATCTCCCAGCACTTTCTAGG + Intronic
1171194766 20:23188063-23188085 CGGGGCTCCCATCTCTTGCTGGG + Intergenic
1172885473 20:38228099-38228121 GGTGGCTCCCAGGACTTACTAGG + Intronic
1173370540 20:42430638-42430660 TGGGGCTTCCAGGACCCTCTGGG + Intronic
1174635210 20:51993618-51993640 TGGTAATCCCAGCACTTTGTGGG + Intergenic
1175553714 20:59833017-59833039 TGGGGCCCACAGCACTGTCTAGG + Intronic
1175997716 20:62818891-62818913 TGGGGCTCAGAGCCCTGTCTGGG + Intronic
1176429343 21:6566574-6566596 TGGGGCTCCCTGCTCCTCCTGGG + Intergenic
1178509139 21:33188159-33188181 TGGAGCTCCCTGCAATTTATAGG + Intergenic
1179566403 21:42251747-42251769 TGAGTCTCCCAGCTCTCTCTGGG - Intronic
1179704735 21:43174036-43174058 TGGGGCTCCCTGCTCCTCCTGGG + Intergenic
1180796364 22:18607719-18607741 TGGGGCTCCCCGCAGCTTCCAGG + Exonic
1180935580 22:19622977-19622999 TGGGGCTGCCAGAGCTGTCTCGG - Intergenic
1181225359 22:21387552-21387574 TGGGGCTCCCCGCAGCTTCCAGG - Exonic
1181253274 22:21547261-21547283 TGGGGCTCCCCGCAGCTTCCAGG + Exonic
1182286847 22:29253865-29253887 GAGGGCTCCCAGCAGCTTCTGGG + Intronic
1183140558 22:35934620-35934642 TAGGACCCCCATCACTTTCTAGG + Intronic
950630134 3:14276730-14276752 TGGGGCTCGCAGCTCTTCCTGGG + Intergenic
950859762 3:16137642-16137664 TGGTGCCCCCAGCACTTTCTAGG - Intergenic
954406112 3:50345844-50345866 TTGGATTCCCAGCGCTTTCTCGG + Exonic
955864669 3:63370663-63370685 TGGATCTCTCAGCACTTTGTGGG + Intronic
958617545 3:96514977-96514999 GGGTGATGCCAGCACTTTCTTGG - Intergenic
963253184 3:143120421-143120443 TGGGGGTCCCCGCACCTTCGAGG - Exonic
963693466 3:148535096-148535118 TGGGGCTCAAAGGACTTTATTGG - Intergenic
964746946 3:160021283-160021305 TGGAACTGCCTGCACTTTCTGGG - Intronic
964927366 3:161975368-161975390 TGGGCATCCCTGCACTTTCAGGG - Intergenic
966757514 3:183385355-183385377 TGGGGCTCCGATCTCTTCCTTGG + Intronic
969022138 4:4145822-4145844 ACCGGCTCACAGCACTTTCTAGG - Intergenic
969518890 4:7664389-7664411 TGGGGCTGTCAGCATCTTCTCGG - Exonic
972726695 4:41751433-41751455 CCGAGCTCCCAGCACTTTTTAGG - Intergenic
973178132 4:47233388-47233410 TGAGGGTCCAAGCTCTTTCTAGG + Intronic
974831130 4:67191036-67191058 TGGGGCTGCCCTCAGTTTCTTGG - Intergenic
974907036 4:68070820-68070842 TGGGGCTCGCATCCCTTTTTGGG - Intronic
979238865 4:118430989-118431011 TGGTGCTCCCTGCTCTCTCTAGG + Intergenic
979483051 4:121240310-121240332 TGGGGCTCACACGCCTTTCTTGG + Intergenic
988737254 5:34035029-34035051 TGGGGCTCCCAAGCCTATCTTGG - Intronic
991118916 5:62988105-62988127 TAGGGCTCCCAGTACTATGTTGG - Intergenic
991580348 5:68148349-68148371 CGGGTTTCCCAGGACTTTCTTGG + Intergenic
993211941 5:84962420-84962442 TGGGCCTCCCTGCACTCTCAGGG - Intergenic
994525707 5:100902965-100902987 TGGGGCAACCAGGACTTTCTCGG - Exonic
997331121 5:133062674-133062696 GGCTACTCCCAGCACTTTCTAGG + Intronic
997467962 5:134100757-134100779 TGGGAGGCACAGCACTTTCTTGG - Intergenic
997513507 5:134468681-134468703 TGGGGCTCCCAGAAATTCTTGGG + Intergenic
998510948 5:142713491-142713513 AGGAGCTCCCAGGGCTTTCTAGG + Intergenic
998984334 5:147739155-147739177 TGGGTCTCCCAGAACTTTAGAGG + Intronic
1001533640 5:172482728-172482750 TGTGGCTTCCATCACCTTCTAGG + Intergenic
1001952483 5:175825975-175825997 TGGGGCACTAAGCAATTTCTTGG + Intronic
1002783327 6:383270-383292 GTGGCCTCCCAGAACTTTCTTGG - Intergenic
1003456939 6:6292045-6292067 TTGAGGTCCCAGCACTTTCCAGG + Intronic
1005332305 6:24761666-24761688 TGGGGCTCCCACCAGTTGCATGG + Intergenic
1008496912 6:52143563-52143585 TGAGGCTCACAGCACTGGCTGGG - Intergenic
1013095303 6:106939586-106939608 TGGGGCCCCCAACACTTCCTTGG - Intergenic
1013158942 6:107522799-107522821 TTGTAATCCCAGCACTTTCTGGG - Intronic
1013268752 6:108526455-108526477 TGAGGCTCAGAGCACTATCTTGG - Intronic
1014553975 6:122823038-122823060 TGGTAATCCCAGCACTTTCGGGG - Intergenic
1018211525 6:161487294-161487316 TGGGACTCCCAGCACTTGCCTGG + Intronic
1018810297 6:167293894-167293916 TGGGGCACCCAGCACCCTCGTGG + Intronic
1019274909 7:171165-171187 TGGGGCTGCCGGCACTGCCTGGG - Intergenic
1019572980 7:1721950-1721972 TACGGCTCCCAGAACATTCTGGG + Intronic
1019653239 7:2172152-2172174 TGCTGCTCCAAGCACTTCCTGGG - Intronic
1020309562 7:6857864-6857886 ACCGGCTCACAGCACTTTCTAGG - Intergenic
1021442786 7:20697601-20697623 TGGGTCTGCCAGCCCTTCCTAGG - Intronic
1023119028 7:36890840-36890862 TGGGGCTCCCTGCACTTTTCTGG + Intronic
1025150811 7:56546715-56546737 TGGGACTTCCAGTACTATCTTGG - Intergenic
1032020439 7:128404844-128404866 TGGGCCTCATAGCATTTTCTAGG + Intronic
1035964241 8:4172745-4172767 TGTGGCTTCCACCTCTTTCTTGG + Intronic
1036738181 8:11338192-11338214 TGGGGATGCCAGAACTTCCTCGG + Intergenic
1040287600 8:46108394-46108416 GGAGGCTCACAGCATTTTCTGGG + Intergenic
1040304647 8:46205755-46205777 GGAGGCTCCCAGCACTCCCTGGG - Intergenic
1048063055 8:130940241-130940263 TGGGGCTCCATGCTCTCTCTTGG + Intronic
1048843522 8:138585174-138585196 TGGAGTGACCAGCACTTTCTAGG - Intergenic
1048876602 8:138841410-138841432 TGGGGCTTCAAGCAGTTTCCTGG + Intronic
1049176284 8:141194522-141194544 TGTGGATTCCAGAACTTTCTAGG - Exonic
1049184577 8:141243013-141243035 TGTGGCTCCCAGCAAAGTCTTGG - Intronic
1049288492 8:141789330-141789352 GGTGGCACCCAGCACTTCCTGGG - Intergenic
1049657859 8:143806668-143806690 TGGGGCCACGAGCCCTTTCTCGG - Intronic
1049997755 9:1047692-1047714 TCGGGATCCCAGCAATTACTGGG - Intergenic
1053177500 9:35938645-35938667 TGGAGGGCCCAGCACTTTCCAGG + Intergenic
1053617236 9:39781217-39781239 TGGGGCTCCCACCAGCTTCATGG - Intergenic
1053875418 9:42540582-42540604 TGGGGCTCCCACCAGCTTCATGG - Intergenic
1053897224 9:42754053-42754075 TGGGGCTCCCACCAGCTTCATGG + Intergenic
1054236282 9:62561142-62561164 TGGGGCTCCCACCAGCTTCATGG + Intergenic
1054266930 9:62926220-62926242 TGGGGCTCCCACCAGCTTCATGG + Intergenic
1054550423 9:66595674-66595696 TGGGGCTCCCACCAGCTTCATGG + Intergenic
1057195437 9:93113724-93113746 AGGGGTTCCCAGCACCTTCTGGG - Intergenic
1057555860 9:96087106-96087128 CGGGGCACACAGCGCTTTCTTGG - Intergenic
1060517973 9:124277624-124277646 TGACGCTCCCAGCACTGCCTGGG + Intronic
1060548301 9:124473513-124473535 TGGGGCTCCTAGCACGTGCCAGG - Intronic
1061734595 9:132645339-132645361 TCGGGTTCCCAGTTCTTTCTCGG - Intronic
1186339559 X:8629517-8629539 TGGTGCTCCCAGATCTCTCTGGG + Intronic
1186753578 X:12646960-12646982 TGGGGCTCCCAGTTGTTCCTAGG - Intronic
1187723304 X:22174554-22174576 TTGGGCTCAGAACACTTTCTGGG - Intronic
1189235995 X:39487834-39487856 TTTGGCACCCAGCTCTTTCTGGG - Intergenic
1190498672 X:51053720-51053742 AGGTGATTCCAGCACTTTCTTGG + Intergenic
1190905398 X:54722209-54722231 TGGTTTTCCCAGCACTGTCTTGG - Intergenic
1191797254 X:65034660-65034682 TGGGGTTTTGAGCACTTTCTAGG + Intronic
1192583311 X:72302109-72302131 TGGGGCTCCCACTAGTTCCTCGG - Exonic
1194655688 X:96570531-96570553 TGGGCATCCCAGCACTGTCCAGG + Intergenic
1196483901 X:116181890-116181912 TGGGGCTCCCTGCCCTGTCCTGG - Intergenic
1196858148 X:120002419-120002441 TGGGGGTCCCAGTTCTTTTTAGG - Intergenic
1197703931 X:129620272-129620294 TGGGTCTCACAGCACTTTAAGGG - Intergenic
1198401696 X:136274908-136274930 TGTGACTCCCAGCACTTACAGGG + Intergenic
1200064280 X:153497238-153497260 TGGGGCTCCCAGGCCTGTCGGGG - Intronic
1200078786 X:153565418-153565440 TGGGGCTCCCTTCACTTGGTGGG + Intronic
1200126214 X:153816183-153816205 TGGGGCTCCCAGGCCTGTCGGGG + Intronic
1201391711 Y:13504532-13504554 TGGATCTCCCAGCAGTTTTTTGG - Intergenic