ID: 1124598015

View in Genome Browser
Species Human (GRCh38)
Location 15:31107133-31107155
Sequence TTCATTCTTCTTTACAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1859
Summary {0: 1, 1: 3, 2: 39, 3: 353, 4: 1463}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124598013_1124598015 16 Left 1124598013 15:31107094-31107116 CCACTTATATTTTCTGTAAGAGT 0: 1
1: 2
2: 33
3: 237
4: 906
Right 1124598015 15:31107133-31107155 TTCATTCTTCTTTACAAGTTTGG 0: 1
1: 3
2: 39
3: 353
4: 1463
1124598011_1124598015 20 Left 1124598011 15:31107090-31107112 CCCGCCACTTATATTTTCTGTAA 0: 1
1: 0
2: 3
3: 45
4: 479
Right 1124598015 15:31107133-31107155 TTCATTCTTCTTTACAAGTTTGG 0: 1
1: 3
2: 39
3: 353
4: 1463
1124598012_1124598015 19 Left 1124598012 15:31107091-31107113 CCGCCACTTATATTTTCTGTAAG 0: 1
1: 0
2: 11
3: 89
4: 490
Right 1124598015 15:31107133-31107155 TTCATTCTTCTTTACAAGTTTGG 0: 1
1: 3
2: 39
3: 353
4: 1463
1124598010_1124598015 21 Left 1124598010 15:31107089-31107111 CCCCGCCACTTATATTTTCTGTA 0: 1
1: 0
2: 0
3: 15
4: 242
Right 1124598015 15:31107133-31107155 TTCATTCTTCTTTACAAGTTTGG 0: 1
1: 3
2: 39
3: 353
4: 1463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124598015 Original CRISPR TTCATTCTTCTTTACAAGTT TGG Intronic
900084207 1:880723-880745 TTAATTCTGCTTTAAACGTTGGG + Intergenic
900910038 1:5589737-5589759 TTAATTCTTCTTTAAAAGCTTGG - Intergenic
901105363 1:6751685-6751707 TTAATTCTTCTTTAAACATTTGG + Intergenic
901164015 1:7203417-7203439 TTCATTATTATTTACATATTTGG + Intronic
901250622 1:7776468-7776490 TTTATTCTTCTTTTCCAATTTGG + Intronic
901917891 1:12513952-12513974 TTCATTATTATTTAGAAGTTTGG + Intergenic
902084295 1:13846586-13846608 TTAATTCTTCTTTAAATGTTTGG + Intergenic
902101399 1:13992903-13992925 TTTATTTTTCTTTTTAAGTTTGG + Intergenic
904448219 1:30592254-30592276 TTAATTCTTCTTTAAATATTTGG - Intergenic
904704123 1:32377653-32377675 TACAGTCTTCTTTAGAAGGTGGG + Intronic
904802710 1:33106332-33106354 TTAATTCTTTTTTACATGTTTGG - Intronic
904924383 1:34035277-34035299 TTAATTCTTCTTTATATGTTTGG - Intronic
905053304 1:35071817-35071839 TTAGTTCTTCTTTAAATGTTTGG + Intronic
905406500 1:37736032-37736054 TTCCTGCTTCTTTTCCAGTTTGG - Intronic
905757239 1:40521147-40521169 TTGCTTCTTCTTTAAATGTTTGG + Intergenic
905964188 1:42076941-42076963 TTATTTCTACTTTATAAGTTTGG + Intergenic
905966299 1:42099636-42099658 TTAATTCTTCTTTAAAAGTTTGG - Intergenic
906092296 1:43191041-43191063 TTAATTCTTCTTTAAGTGTTTGG + Intronic
906352440 1:45074310-45074332 TTAATCCTTCTTTAAATGTTTGG + Intronic
906438909 1:45823076-45823098 TTCACTCTTCTTTTTATGTTTGG + Intronic
908567771 1:65375966-65375988 TTCATTCTTTTTTAAATATTTGG + Intronic
909259589 1:73470020-73470042 CTCATTCTTCTTTGCATCTTGGG - Intergenic
909271901 1:73633294-73633316 TTGCTTCTTCTTTAAATGTTTGG - Intergenic
909355317 1:74702025-74702047 TTCATTATTCTGTGAAAGTTAGG + Intergenic
909385154 1:75046507-75046529 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
909473962 1:76061576-76061598 GTAATACTTCTTTAAAAGTTGGG - Intergenic
909582288 1:77251096-77251118 TTAATTCTTCTTTAAATGTTTGG - Intergenic
909800005 1:79795606-79795628 TTAATTCTTCTTCAAATGTTTGG + Intergenic
909830326 1:80180921-80180943 TTAATTCTTATTTAAAAGGTTGG - Intergenic
909870960 1:80738236-80738258 TTAATTCTTCTTTAAATATTAGG - Intergenic
909922258 1:81397053-81397075 TTCATTCTCCTTTAAATCTTTGG + Intronic
909948665 1:81692946-81692968 TTCATTAATCTTTACTAGCTTGG + Intronic
910101061 1:83577602-83577624 TTCATTCTTGTTTTCAACTTTGG + Intergenic
910103276 1:83601314-83601336 TTAATTATTCTTTGAAAGTTTGG - Intergenic
910165005 1:84317770-84317792 TTAATTCTTCCTTAAATGTTTGG + Intronic
910351284 1:86300797-86300819 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
910378954 1:86604912-86604934 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
910606799 1:89094696-89094718 TTATTTCTTCTTTAAACGTTTGG - Intergenic
910650793 1:89564761-89564783 TTCATGCTTCTTTAGCATTTAGG - Intronic
911129135 1:94371506-94371528 TTAATTCTTTTTTAAATGTTTGG + Intergenic
911140044 1:94490566-94490588 TTCCTTCTTTTTTAAAAGTGGGG + Intronic
911343538 1:96669443-96669465 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
911486191 1:98508950-98508972 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
911607557 1:99925582-99925604 TGCATTATTCTTTACTAGTAGGG + Intergenic
912117292 1:106422503-106422525 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
912146878 1:106804979-106805001 TTCATTTTTCTTTTCAAAGTAGG - Intergenic
912201132 1:107459611-107459633 TTAATGATTCTTTACAGGTTGGG + Intronic
912882086 1:113425181-113425203 TTAATTTTTGTTTACATGTTTGG + Intronic
913036620 1:114971995-114972017 TTAATTCTTCTTTAAATGTTTGG + Intronic
913101100 1:115567337-115567359 TTAATTCTTCTTTATAAGTTTGG - Intergenic
913146696 1:115998366-115998388 TTAGTTCTTCTTTAAATGTTTGG + Intronic
913415704 1:118604279-118604301 TTCATTGTCTTTTACAATTTTGG - Intergenic
914746486 1:150505165-150505187 TTCATACATCTCTACAAGGTAGG - Intronic
914906010 1:151745162-151745184 TTAATTCTTCTTTAGACATTTGG + Intergenic
915044938 1:153004476-153004498 TGCAGTCTTGTTTACGAGTTAGG + Intergenic
915804897 1:158836303-158836325 TTAATTCTTCTTTATATATTTGG + Intronic
916258507 1:162815758-162815780 TTAATTCTTCTTTAAATATTTGG + Intergenic
916396631 1:164396719-164396741 TTAATTCTTCTTTAAATGTTTGG - Intergenic
916794966 1:168158112-168158134 TTAATTCTTCTTTAAAGGTTTGG + Intergenic
916882989 1:169039581-169039603 TTAGTTCTCCTTTACATGTTTGG - Intergenic
917061337 1:171044540-171044562 TTCATTCTTCTTTAAATGTTTGG + Intronic
917187018 1:172369045-172369067 TTAATTCTTCTTTTAAGGTTTGG - Intronic
917300270 1:173566256-173566278 ATTATTCTTCTTTAAATGTTTGG + Intronic
917363959 1:174208831-174208853 TTATTTCTTCTTTAAATGTTTGG + Intronic
917375305 1:174346319-174346341 TTAATTCTTCTTTAAATGTTGGG + Intronic
917386814 1:174485916-174485938 TTATTTCTTCTTTAAATGTTTGG + Intronic
917427362 1:174928958-174928980 GCCAATCTTCTTTACAAGGTGGG - Intronic
917604609 1:176613961-176613983 TTCTTTGTTCTTTTTAAGTTGGG - Intronic
917991350 1:180382617-180382639 TTAGTTCTTCTTTGAAAGTTTGG - Intronic
918154812 1:181834450-181834472 TTAATTCTTCTTTAAATGTGAGG - Intergenic
918189507 1:182159904-182159926 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
918224250 1:182465727-182465749 TTAATTCTTCTTTAAATGTTTGG - Intronic
918267488 1:182858209-182858231 TTCCTTCTTCTTTGTAAGTCCGG - Exonic
918493382 1:185107350-185107372 TTAATTCCTCTTTAAACGTTTGG - Intergenic
918620622 1:186600479-186600501 TTAATTCCTCTTTAAATGTTTGG + Intergenic
918678148 1:187316289-187316311 TTCATTATTCTTTAAATGTTTGG - Intergenic
918835283 1:189454710-189454732 TTGGTTCTTCTTTAAATGTTTGG + Intergenic
919006217 1:191902303-191902325 TTCATGATCCTTTACAAATTAGG + Intergenic
919226837 1:194715190-194715212 TTAGATCTTCTTTATAAGTTTGG - Intergenic
919269622 1:195322833-195322855 TCAATTCTTCTTTATATGTTTGG + Intergenic
919696735 1:200584270-200584292 TTAATTCTTCTTTAATTGTTCGG - Intronic
919959666 1:202453519-202453541 TTAATTCTTCTTTAGGTGTTTGG + Intronic
921197257 1:212770608-212770630 TTAATTCTTCTTTATAAGTTTGG - Intronic
921994335 1:221401118-221401140 TTAATTCTTCTTTAAATGTTTGG - Intergenic
922378694 1:224997631-224997653 TTAATTCTTCTTTAAACATTTGG + Intronic
922393774 1:225175237-225175259 TTAGTTCTTCTTTAAAAGTTTGG + Intronic
922395005 1:225189451-225189473 TTAATTCTTCTTTAAGTGTTTGG + Intronic
922403336 1:225284552-225284574 TTAATTCTTCCTTAGATGTTTGG - Intronic
922602320 1:226866068-226866090 TTAATTTTTCTTTAAAGGTTTGG + Intergenic
922667393 1:227483076-227483098 TTAATTCTGCTTTAAATGTTGGG - Intergenic
922710006 1:227820796-227820818 TTAATTCTTCTTTAAATATTTGG + Intronic
922965093 1:229683184-229683206 TTAATTCTTCTTTAAATGATTGG + Intergenic
923245325 1:232124746-232124768 TTCATTCTTCCTTAAATGCTTGG + Intergenic
923692095 1:236204473-236204495 TTAGTTCTTCTTTAAATGTTTGG + Intronic
923960362 1:239075353-239075375 TTAATTCTTCTTTTAAGGTTTGG - Intergenic
924059719 1:240160120-240160142 TTATTTCTTCTTTAAATGTTTGG - Intronic
924097903 1:240573515-240573537 TTTATTTATCTTTACAACTTAGG + Intronic
924327026 1:242905737-242905759 TTAATTCTTCTTTAAATGTTAGG - Intergenic
924488323 1:244509654-244509676 TTAGTTATTCTTTATAAGTTTGG + Intronic
924649289 1:245909367-245909389 TTCATTCTTTTTTAAATGTTTGG - Intronic
924894515 1:248321409-248321431 TTCCTTCCTCTTTACCAATTTGG - Intergenic
924935754 1:248768166-248768188 TTACTTCTTCTTTACCAATTTGG - Intergenic
1062762325 10:33901-33923 TTAATTCTGCTTTAAACGTTGGG - Intergenic
1062913701 10:1231278-1231300 TCCATTCTTCTTTAAAGGGTTGG - Intronic
1063750402 10:8938265-8938287 TTTATTTTTCTTTACAAATTTGG - Intergenic
1063774765 10:9250237-9250259 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1063997647 10:11635703-11635725 TTAATTCTTCTTTAACTGTTCGG + Intergenic
1064087407 10:12355683-12355705 TGCAGTCTTCTTTAGATGTTTGG + Intronic
1064166765 10:12993422-12993444 TTCTTTCTTCTTTTGGAGTTGGG - Intronic
1065097032 10:22291807-22291829 TTAATTCTTCTTTAGATGTTTGG + Intergenic
1065227840 10:23563623-23563645 TTACTTATTCTTTAAAAGTTTGG + Intergenic
1065459590 10:25944475-25944497 TTAATTATTCTTTAAATGTTTGG + Intronic
1065622414 10:27596230-27596252 TTGATTTTTCTTTAAATGTTTGG + Intergenic
1065906967 10:30263886-30263908 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1065907254 10:30267530-30267552 TTAGTTCTTCTTTATATGTTTGG - Intergenic
1065948683 10:30630295-30630317 TTCATTGTTTTTTAAAAATTTGG + Intergenic
1066110974 10:32196602-32196624 TTAATTTTTCTTTAAATGTTTGG + Intergenic
1066165267 10:32781221-32781243 TTAATTCTTCTTTAAATATTTGG - Intronic
1066655097 10:37690904-37690926 TTAATTCTTCTTTAAACATTTGG - Intergenic
1066676434 10:37892550-37892572 TTTTTTCTTCTTTACATCTTTGG - Intergenic
1066724950 10:38381444-38381466 TTAATTCTTCTTTAAATATTTGG + Intergenic
1067027185 10:42853998-42854020 TTGATTCTTCTTTAAATATTTGG + Intergenic
1067040143 10:42946986-42947008 TTAATTCTTCTTTAAACATTTGG - Intergenic
1067264585 10:44727978-44728000 TTAATTCTTCTTTAAATTTTTGG + Intergenic
1067326446 10:45272009-45272031 TTTGTTCTTCTTTAAATGTTTGG - Intergenic
1067430862 10:46244245-46244267 TTAGTTCTTCTTCATAAGTTTGG - Intergenic
1068103630 10:52587167-52587189 TTGATTCTTCTTTAAACATTTGG + Intergenic
1068448121 10:57149930-57149952 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1068451185 10:57191104-57191126 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1068492782 10:57745001-57745023 TTGATTTTTCTTCACAAATTAGG - Intergenic
1068642066 10:59420565-59420587 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1068781736 10:60926293-60926315 TTAATTCTTCTTTAAGTGTTTGG - Intronic
1068858760 10:61824961-61824983 TACATTCTTGTTTCAAAGTTTGG - Intergenic
1069148088 10:64920857-64920879 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1069392295 10:67949349-67949371 TTAATTCTCCTTTAAATGTTTGG - Intronic
1069415119 10:68192589-68192611 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1069758709 10:70792493-70792515 GTCATTCTTCTTTTGAAATTTGG - Intergenic
1070058965 10:72963351-72963373 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1070245404 10:74726675-74726697 TTCTTTCTTCCTTAAATGTTTGG - Intergenic
1070317613 10:75330428-75330450 TCGGTTCTTCTTTACAGGTTTGG + Intergenic
1070701887 10:78609635-78609657 TTTCTTCTTCTTTAAATGTTTGG + Intergenic
1070854693 10:79597678-79597700 TTATTTCTTCTTTAAAAGTTTGG - Intergenic
1070936633 10:80303512-80303534 TTAATTCTTCTTTGAATGTTTGG - Intergenic
1071014674 10:80981823-80981845 TTAATTCTTTTTTACATGTCTGG + Intergenic
1071039944 10:81295678-81295700 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1071341786 10:84655711-84655733 TTCAAACTTCTTTTCAATTTTGG - Intergenic
1071420192 10:85488010-85488032 TTAATTTTTCTTTAAATGTTTGG - Intergenic
1071667167 10:87570147-87570169 TTAGTTCTTCTTTGAAAGTTTGG - Intergenic
1071869424 10:89777243-89777265 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1071881389 10:89902160-89902182 TTCATTCATGTTAACAAGTAAGG - Intergenic
1071928946 10:90443801-90443823 TTCATTCTTCTTTGAAAGTTTGG - Intergenic
1071954437 10:90742853-90742875 GTCATTATTCTTTTCAAGTGGGG - Intronic
1072070875 10:91916030-91916052 TTAATTCTTCTTTGAAAGTTTGG + Intergenic
1072211662 10:93252043-93252065 TTCATTGCTTTTTCCAAGTTAGG - Intergenic
1072344071 10:94485674-94485696 TCAATTCTTCTTTAAATGTTTGG + Intronic
1072380353 10:94862433-94862455 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1072390422 10:94979417-94979439 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1072392629 10:95003515-95003537 TTCATTCTTCTTTAAGTGTTTGG - Intergenic
1072867090 10:99074633-99074655 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1073658420 10:105444362-105444384 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1074143053 10:110693338-110693360 TTAATTCTTCTTTAAATGTTTGG + Intronic
1074400448 10:113137491-113137513 TTCATTCTTCCTCACCAGGTTGG - Intronic
1074623340 10:115149918-115149940 TTAATTCTTCTTTGAAAGTTTGG + Intronic
1074627309 10:115204849-115204871 TTAATTCTTCTTTAGATATTTGG + Intronic
1074640498 10:115373945-115373967 TTTATTCTTCTTTAAACATTTGG + Intronic
1074975068 10:118573259-118573281 TTAATTCTTCTTTAAGTGTTTGG - Intergenic
1074975233 10:118575225-118575247 TTAATTCTTCTTTAAGTGTTTGG - Intergenic
1075008533 10:118848216-118848238 TTCTTTCTTATTTACTAGCTGGG - Intergenic
1075179188 10:120195298-120195320 TTAGTTCTTCTTTTTAAGTTTGG + Intergenic
1075195333 10:120352432-120352454 CTAGTTCTTCTTTAAAAGTTTGG - Intergenic
1075364534 10:121873822-121873844 TTCCTTTTTCTTTAAAAGATAGG - Intronic
1075496677 10:122926761-122926783 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1076094932 10:127724836-127724858 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1076592485 10:131594691-131594713 TTAACTCTTCTTTAAATGTTTGG + Intergenic
1076592803 10:131599392-131599414 TTAACTCTTCTTTAAATGTTTGG + Intergenic
1077276247 11:1710941-1710963 TTAAGTCTTCTTTGCATGTTTGG - Intergenic
1077527988 11:3079472-3079494 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1077822278 11:5759115-5759137 TTCATTGTTCAGTACAATTTAGG - Intronic
1077839880 11:5962470-5962492 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1077845469 11:6019087-6019109 TTATTTCTTCTTTACAAATTTGG - Intergenic
1077990771 11:7409448-7409470 TTAGTTCTTCTTTATATGTTTGG + Intronic
1078393896 11:10961650-10961672 ATGACTCTTCTTTACACGTTTGG - Intergenic
1078948851 11:16104954-16104976 TTAATTCTTCTTTAAACATTTGG - Intronic
1079183904 11:18219570-18219592 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1079576389 11:22008539-22008561 TTCATTCTTCTCTAGCACTTTGG - Intergenic
1079593149 11:22206029-22206051 TTAATTCTTCTTTAAACATTTGG - Intronic
1079677571 11:23249934-23249956 TTAGTTGTTCTTTATAAGTTTGG + Intergenic
1079687233 11:23374919-23374941 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1079706345 11:23624747-23624769 TTAATTTTTCTTTAAATGTTTGG + Intergenic
1079722904 11:23841849-23841871 TTAATTCTTCTTTAAAGATTTGG + Intergenic
1080096206 11:28410178-28410200 ATCATTCTTCTTTGTATGTTTGG - Intergenic
1080097082 11:28421276-28421298 TTAGTTCTTCTTTAAATGTTCGG - Intergenic
1080171696 11:29311327-29311349 TTCCTGTTTCTTTACAAGTCAGG + Intergenic
1080213375 11:29813393-29813415 TTATTTCTTCTTTAAATGTTTGG + Intergenic
1080299057 11:30763834-30763856 TCCATTCTTTTGTTCAAGTTTGG - Intergenic
1080318253 11:30974773-30974795 TAAATTCTTCTTTGTAAGTTTGG - Intronic
1080377754 11:31733778-31733800 TTAATTCTTTTTTAAACGTTTGG - Intronic
1080549987 11:33365474-33365496 GTCATACTCCTTTGCAAGTTTGG + Intergenic
1080706119 11:34695626-34695648 TTAGTTCTTCTTTATAAGTTTGG + Intergenic
1080706907 11:34703697-34703719 TTAGTTCTTCTTTACATGTTTGG + Intergenic
1080740142 11:35056219-35056241 ATCAGTCTTTTTTAAAAGTTGGG + Intergenic
1080789094 11:35504455-35504477 TTAATTTTTCTTTAAATGTTTGG + Intronic
1081073391 11:38638222-38638244 TTCATTCTTCTTTAAATGTTTGG + Intergenic
1081369266 11:42278899-42278921 TTCATTCTTTTTTAAATGTTTGG - Intergenic
1081404875 11:42685808-42685830 ATAATTCTTCTTTAAATGTTCGG + Intergenic
1081422486 11:42887316-42887338 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1081531654 11:43964520-43964542 TTAATTCTTCTTAAAATGTTTGG - Intergenic
1082187287 11:49199380-49199402 TGCAATCTTGTTTGCAAGTTGGG - Intronic
1082955021 11:58861169-58861191 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1083040782 11:59683998-59684020 TTAATTCTTCTTTAAATGTTGGG - Intergenic
1084342670 11:68517292-68517314 TTCATTCATATTTAAAAGTCAGG + Intronic
1084479169 11:69408628-69408650 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1084756669 11:71243931-71243953 TTCATTCTTCTTTAAATGTTTGG - Intronic
1085191163 11:74624231-74624253 TTTACTCTTCTATACAATTTGGG + Intronic
1085217650 11:74846364-74846386 TTAATTCTTTTTTAAATGTTTGG - Intronic
1085328887 11:75630343-75630365 TTAATTTTTCTTTGCATGTTTGG + Intronic
1085499160 11:77002672-77002694 TTAACTCTTCTTTAAATGTTTGG + Intronic
1085568277 11:77535722-77535744 TTAATTCTTCTTTAAATGTTTGG - Intronic
1085687545 11:78637852-78637874 TTCATTCTTCTTTATAAGTTTGG - Intergenic
1085980818 11:81722320-81722342 TTAGTTCTTCTTTAAAAGATTGG - Intergenic
1086003500 11:82008174-82008196 TTACTTCTTCTTTAAATGTTCGG + Intergenic
1086069080 11:82779811-82779833 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1086142695 11:83516958-83516980 TTTTTTCTTCATTACAACTTTGG + Intronic
1086158929 11:83699325-83699347 TCCATTCTTTCTTACAAGTGTGG - Intronic
1086201347 11:84206308-84206330 TTATTTCTTCTTTACATATTTGG - Intronic
1086282238 11:85203605-85203627 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1086320558 11:85642878-85642900 TTATTTCTTCCTTACATGTTTGG - Intergenic
1086379218 11:86234871-86234893 TTCCTTCCTCTTTATAATTTAGG - Intergenic
1086397176 11:86428286-86428308 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1086447323 11:86881672-86881694 TTAATTCTTCTTTAAATGTTTGG + Intronic
1086679049 11:89646044-89646066 TGCAATCTTGTTTGCAAGTTGGG + Intergenic
1086732528 11:90267955-90267977 TTCTTTCTTCTTTATTAGTCTGG + Intergenic
1086833075 11:91589536-91589558 TTAGTTCTTCTTTGCATGTTTGG + Intergenic
1086849008 11:91786398-91786420 TTCTTTCTATTTTACAAGTTAGG + Intergenic
1086874550 11:92079319-92079341 TTAATTCTTCTTTGAATGTTTGG - Intergenic
1087053999 11:93914692-93914714 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1087080294 11:94163808-94163830 TTAGTTCTTTTTTAAAAGTTTGG + Intronic
1087299717 11:96417997-96418019 TTACTTCTTCTTTAAATGTTTGG - Intronic
1087313811 11:96582259-96582281 TTAGTTCTTCTTTATAAGTTTGG - Intergenic
1087402065 11:97680210-97680232 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1087598070 11:100279387-100279409 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1087714272 11:101590180-101590202 CTAATTCTTCTTTAAATGTTTGG - Intronic
1087823646 11:102740271-102740293 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1087832063 11:102830048-102830070 TCCATTGTTCATTACAATTTAGG + Intergenic
1087850307 11:103020189-103020211 TTAATTCTTCTTTACGTGCTTGG - Intergenic
1088046702 11:105461376-105461398 TTATTTCTTCTTTAAATGTTTGG - Intergenic
1088093304 11:106068603-106068625 TTAATTCTTCTTTAAACTTTTGG - Intronic
1088179311 11:107091484-107091506 TTAATTCCTCTTTAAATGTTTGG - Intergenic
1088187633 11:107190324-107190346 TTAATTCATCTTTATATGTTTGG + Intergenic
1088447845 11:109951467-109951489 TTAATTCTTCTTTAAACATTAGG - Intergenic
1088879648 11:113963372-113963394 TTCTTTTTTCTTTTCAGGTTTGG - Intergenic
1089082718 11:115790496-115790518 TTCATTCATCATCATAAGTTGGG + Intergenic
1089181165 11:116583773-116583795 TTCATTCTTCTCTCTAAGTGGGG + Intergenic
1089371527 11:117963132-117963154 TTGATACTTCTTTACTAGTATGG - Intergenic
1089382191 11:118042521-118042543 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1089664784 11:120011429-120011451 TTAAATCTCCTCTACAAGTTGGG - Intergenic
1089824350 11:121260881-121260903 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1089853867 11:121523604-121523626 TTTTTTTTTTTTTACAAGTTTGG - Intronic
1089876926 11:121732015-121732037 TTAATTCTTCCTTAAATGTTTGG + Intergenic
1089886993 11:121835840-121835862 TTAGTCCTTCTTTAAAAGTTTGG - Intergenic
1089937633 11:122381519-122381541 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1089983708 11:122793514-122793536 TTCTTGCTTCTTTACAATTTGGG - Intronic
1090088865 11:123675985-123676007 TTTTTTCTTCTTTACATGATTGG + Intergenic
1090506019 11:127315434-127315456 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1091320898 11:134649115-134649137 TTAATTCTTCTTTATGTGTTTGG + Intergenic
1091340170 11:134805834-134805856 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1091884341 12:4004894-4004916 TTCTTACTTCTATACCAGTTAGG + Intergenic
1092116099 12:6008100-6008122 TTAATTCTTCTTTAAATCTTTGG - Intronic
1092319539 12:7457572-7457594 TTTCTTCTTCTTTAAATGTTTGG - Intronic
1092438233 12:8471362-8471384 TTAATTCTTCTTTAAATGTATGG + Intronic
1092671866 12:10871788-10871810 TTCCTTTTTCCTTATAAGTTTGG - Intronic
1093063859 12:14636021-14636043 TTAGTTCTTCTTTGGAAGTTTGG - Intronic
1093206073 12:16251734-16251756 TTAATTCTTCTTTAAATGTTTGG - Intronic
1093366018 12:18300109-18300131 TTAGTTCTTCTTTATAAGTTTGG + Intronic
1093400088 12:18735327-18735349 TTAATTCTTCTTTAAATCTTTGG + Intronic
1093476266 12:19558099-19558121 TTAATTCTTCTTTAAATGTTTGG + Intronic
1093601887 12:21036750-21036772 TTAATTCTTCTTTAAATGTTTGG + Intronic
1093617522 12:21245030-21245052 TTAATTCTTCTTTAAACATTTGG - Intergenic
1093676696 12:21949209-21949231 TTAATTTTTCTTTAAATGTTTGG - Intergenic
1093716308 12:22386774-22386796 TTAATTCTTCTTTAGTTGTTTGG - Intronic
1093900236 12:24623707-24623729 TTCAATGGTCTTTACAATTTGGG + Intergenic
1093941399 12:25058870-25058892 TGCATTCTGCTTTACATGTTTGG - Intronic
1094060238 12:26306859-26306881 TCAATTCTTCTTTAAATGTTTGG - Intergenic
1094228503 12:28075405-28075427 CTAATTCTTCTTTAAATGTTTGG - Intergenic
1094755076 12:33459096-33459118 CTCATTTTTCTTTAAATGTTTGG - Intergenic
1095348688 12:41184338-41184360 TTTATTGTTCTTATCAAGTTTGG + Intergenic
1095520579 12:43060022-43060044 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1095717405 12:45362063-45362085 TTAATTCTTCTTTAAATGGTAGG + Intronic
1095760180 12:45823847-45823869 TTGGTTCTTCTTTATAAGTTTGG - Intronic
1095769386 12:45936003-45936025 ATAATTTTTCTTTATAAGTTTGG - Intronic
1096962045 12:55589717-55589739 TTAATTTTTCTTTAAATGTTTGG - Intergenic
1097029915 12:56082731-56082753 TTCACTCTTCTTTGCAAATGTGG - Intronic
1097425754 12:59442032-59442054 TTATTTCTTCTTTAAATGTTTGG + Intergenic
1097704687 12:62855747-62855769 TTCATGCTTCTTTGCATGTCTGG + Intronic
1097714376 12:62950697-62950719 TTCATTCTTCTTTAAATGTTTGG + Intergenic
1097764409 12:63508651-63508673 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1098068389 12:66644491-66644513 TTCAATCTTCTTTTGAGGTTTGG - Intronic
1098099123 12:66994070-66994092 TTAATTCCTCTTTAAATGTTTGG - Intergenic
1098396535 12:70024580-70024602 TTAGTTCTTCTTTGTAAGTTTGG - Intergenic
1098491722 12:71089201-71089223 TTAGTTCTTCTTTAAAAGTCTGG + Intronic
1098546106 12:71713070-71713092 TTAATTAGTCTTTACATGTTTGG - Intergenic
1098734980 12:74089911-74089933 TTTATTCTTCTTTAAATGTTTGG + Intergenic
1098810856 12:75089635-75089657 TTCCATTTTCTTTACAAGTGAGG + Intronic
1099045529 12:77712676-77712698 TTGATTTTTCTTTACAAATGGGG + Intergenic
1099134754 12:78882237-78882259 TTCATACTTCTTTAAAGATTAGG - Intronic
1099390820 12:82076834-82076856 TTAATTTTTCTTTAAAAATTTGG + Intergenic
1099423288 12:82491538-82491560 TTAATTCTTCTTCATATGTTTGG - Intergenic
1099613120 12:84901184-84901206 TTCATTCTTCTTTAAAAGTTTGG + Intronic
1099613370 12:84904977-84904999 TTAATTCTTCTTTAAATGTTTGG - Intronic
1099689397 12:85932815-85932837 ATATTTCTTCTTTACATGTTTGG + Intergenic
1099808547 12:87550870-87550892 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1100360468 12:93874022-93874044 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1100414738 12:94359696-94359718 TTAGTTCTTTTTTAAAAGTTTGG - Intronic
1100627353 12:96348874-96348896 TTAATTCATCTTTAAATGTTTGG - Intronic
1100662161 12:96710987-96711009 TTAACTCTTCTTTAAATGTTTGG + Intronic
1100683912 12:96964179-96964201 CTAATTCTTCTTTAAACGTTTGG - Intergenic
1100804728 12:98270426-98270448 TTCAGTTTTCTTTAAATGTTTGG - Intergenic
1100833379 12:98540416-98540438 TTCATTCTTTTTGCCAAGGTTGG + Intronic
1100873249 12:98935552-98935574 TTAATTCTTCTTTAAATGTTTGG + Intronic
1100958303 12:99934347-99934369 TTAATTTTTCTTTAAATGTTTGG + Intronic
1101167839 12:102056829-102056851 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1101227016 12:102698656-102698678 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1101745137 12:107534854-107534876 TTAATTCTTCTTTAAAAGTTTGG - Intronic
1102318327 12:111908410-111908432 TTGGTTCTTCTTTAAATGTTTGG - Intergenic
1102443544 12:112982752-112982774 TTAATTCTTCTTTATAAGTTTGG + Intronic
1103022357 12:117545370-117545392 TTAATTCTTCTTTAAACATTTGG + Intronic
1103169865 12:118808055-118808077 TTAATTGTTCTTTAAATGTTTGG + Intergenic
1104209525 12:126674969-126674991 TCCATTCCTCTTTAAATGTTTGG + Intergenic
1104303065 12:127583167-127583189 TCAATTCTTCTTTAAACGTTTGG + Intergenic
1104819840 12:131670130-131670152 TTGGTTCTTCTTTAAATGTTTGG - Intergenic
1105478681 13:20752723-20752745 TTGATTATTCTTTTTAAGTTTGG + Intronic
1105696464 13:22893949-22893971 TTCCTTCTTCTTGCCAACTTCGG - Intergenic
1105716653 13:23072555-23072577 TTTATTCTTCTTTAAAATTACGG + Intergenic
1105733262 13:23241533-23241555 TTAATTCTTCTTTAAATGTTTGG - Intronic
1105906627 13:24817190-24817212 TTAATTCTTCTTTAAATGTTTGG + Intronic
1105938469 13:25124829-25124851 TTAATTCTTCTTTGAATGTTTGG - Intergenic
1106075108 13:26452848-26452870 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1106485666 13:30170560-30170582 TTAATTCTTCATTAAATGTTTGG - Intergenic
1106779730 13:33046218-33046240 TTAATTCTTCTTTAAATATTTGG + Intronic
1106860278 13:33899067-33899089 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1107166184 13:37282690-37282712 TTATTTCTTCTTTAAATGTTTGG + Intergenic
1107179447 13:37441515-37441537 TTAATTTTTCTTTAAATGTTTGG + Intergenic
1107181427 13:37464859-37464881 CTAATTCTTCTTTAAATGTTTGG + Intergenic
1107201990 13:37732500-37732522 TTACTTCTTCTTTTCCAGTTTGG - Intronic
1107244635 13:38279123-38279145 TTCTCTCTTCTTTACTAGTCTGG - Intergenic
1107258258 13:38456996-38457018 TTCCTGCTTCTTTACATGTCTGG + Intergenic
1107265641 13:38550506-38550528 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1107586432 13:41853454-41853476 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1108037029 13:46301490-46301512 TTAAGTCTTCTTTAAAAGTCTGG - Intergenic
1108097300 13:46916821-46916843 TTAATTCTTCTTTAAACATTTGG + Intergenic
1108138314 13:47389921-47389943 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1108229703 13:48323097-48323119 TTAATTCTTCTTTAAATATTTGG + Intronic
1108231898 13:48353506-48353528 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1108324457 13:49316388-49316410 TTAATTCTTCTTTAAATGTTAGG - Intronic
1108439323 13:50433952-50433974 TTAATTCTTCTTTGAATGTTTGG + Intronic
1108631375 13:52286537-52286559 TTCGTTCTTCTTTAAATGTTTGG + Intergenic
1108655316 13:52526061-52526083 TTCGTTCTTCTTTAAATGTTTGG - Intergenic
1108941573 13:55962714-55962736 TTAATTCTTCTTCAAATGTTTGG - Intergenic
1108961873 13:56243718-56243740 TTACTTCTTCTTTAAATGTTTGG + Intergenic
1109037896 13:57289145-57289167 CTCAATCTGTTTTACAAGTTAGG - Intergenic
1109089083 13:58016239-58016261 AACATTTTTCTTTACCAGTTAGG + Intergenic
1109212716 13:59552672-59552694 TTAGTTCTTCCTTAAAAGTTTGG - Intergenic
1109218944 13:59621380-59621402 TTAATTATTCTTTAAAAGTTTGG - Intergenic
1109226491 13:59702271-59702293 CTCAGTCTTCATTATAAGTTAGG - Intronic
1109336329 13:60999345-60999367 TTCATTCCTCTTTAGATATTTGG + Intergenic
1109570904 13:64188324-64188346 TTTACTCTTCTTTACAGATTGGG - Intergenic
1109671300 13:65612104-65612126 TTAATTCTTCTTTTCCAGTCTGG - Intergenic
1109722747 13:66296764-66296786 TTAATTTTTCTTTAAATGTTTGG - Intergenic
1109826215 13:67725737-67725759 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1109913492 13:68948214-68948236 AGCATTCATCTTTGCAAGTTGGG + Intergenic
1110036312 13:70689762-70689784 TTAATTCTTCTTTAAATATTCGG + Intergenic
1110061637 13:71047119-71047141 TTCCTACTTCTTTACATGTTTGG - Intergenic
1110211260 13:72976266-72976288 TTCTTTCTTTTTTAAAAGATAGG - Intronic
1110220875 13:73071803-73071825 TTTATTCTACTTTAAAAGTTTGG + Intronic
1110262715 13:73503272-73503294 TTGATTTTTCTTTATTAGTTGGG + Intergenic
1110331165 13:74274637-74274659 TTCTTTTTTCTTTGCTAGTTTGG + Intergenic
1110491560 13:76115587-76115609 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1110768629 13:79308982-79309004 TTAATTCTTCTTTAAATATTTGG + Intergenic
1110788742 13:79563769-79563791 TTCTTTCTTCTTTATTAGTCTGG - Intergenic
1110888879 13:80673525-80673547 TTAGTTCTTCTTTACATGTTTGG + Intergenic
1111082433 13:83328801-83328823 TTAGTTCTGCTTTATAAGTTTGG - Intergenic
1112404829 13:99109899-99109921 TTAATTCTTCTTTAAACATTAGG - Intergenic
1112641242 13:101277957-101277979 ATCATTCTCTTTTACAAGATGGG + Intronic
1112838170 13:103543048-103543070 TTTATTTTTCTTTATAATTTTGG - Intergenic
1112901196 13:104359264-104359286 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1113233914 13:108247918-108247940 TTAATTCTTCTTTAAAGATTTGG - Intergenic
1113510694 13:110852884-110852906 TTTATTCTTCTTTTGAAATTTGG - Intergenic
1113631454 13:111888785-111888807 TTCATTATTCTTTAAATATTTGG + Intergenic
1114326547 14:21594846-21594868 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1114593108 14:23887039-23887061 TTAATTCTTCTTTTAATGTTTGG - Intergenic
1114821100 14:26020034-26020056 ATCATCCTGCTTTACAAGTGAGG + Intergenic
1114900795 14:27055097-27055119 TTCAATCTTCTTTGCATGCTTGG + Intergenic
1114924683 14:27380993-27381015 TACATTTTTCTTTCCAATTTGGG - Intergenic
1115108188 14:29786418-29786440 TTAGTTCTTCTTTATAAGTTTGG + Intronic
1115200333 14:30846758-30846780 TTAGTTTTTCTTTACATGTTTGG + Intergenic
1115477773 14:33832721-33832743 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1115578129 14:34731145-34731167 TTAGTTCTTCTTTAGATGTTTGG - Intergenic
1116072305 14:40063555-40063577 TTTATTCTTCTCTAAATGTTTGG + Intergenic
1116080082 14:40161107-40161129 TTATTTCTTCTTTACAAATCTGG - Intergenic
1116086804 14:40250772-40250794 TTAATTCTTCCTTAGATGTTTGG + Intergenic
1116110027 14:40566294-40566316 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1116253727 14:42521810-42521832 TTAATTCTTTTTTAAATGTTTGG - Intergenic
1116355121 14:43918673-43918695 TTATTTCTTCTTTAAAGGTTTGG - Intergenic
1116385894 14:44329287-44329309 TGCATTCTTGTTTACAAGAGTGG + Intergenic
1116401959 14:44518161-44518183 TTAATTCTTGTTTAAAGGTTTGG + Intergenic
1116422291 14:44746248-44746270 TTAGTTCTTCTTTAAAGGTTTGG - Intergenic
1116497817 14:45583474-45583496 TTAATTCTCCTTCAAAAGTTTGG + Intergenic
1116530020 14:45959454-45959476 TTTCTTCTTCTTTTCAAATTTGG + Intergenic
1116536098 14:46032418-46032440 TTAATTCCTCTTTAAATGTTTGG + Intergenic
1116559019 14:46353208-46353230 TTCGTCCTTCTGTACAAATTAGG + Intergenic
1116668549 14:47811191-47811213 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1116894151 14:50299387-50299409 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1117264286 14:54070201-54070223 TTAATTCTTCTTTAAATGTCTGG + Intergenic
1117572765 14:57064453-57064475 TTAATTCTTCTTTGTAAGTCTGG + Intergenic
1117795051 14:59384334-59384356 TTAATTATTCTTTAAATGTTTGG + Intergenic
1117842726 14:59877048-59877070 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1117873838 14:60229477-60229499 TTAATTCTTCTTTAAATATTTGG + Intergenic
1117902352 14:60548504-60548526 TTAATTCTTATTTACAGGTTTGG + Intergenic
1117907221 14:60602764-60602786 TTCTTTCTTTTTCACATGTTCGG + Intergenic
1117928352 14:60809935-60809957 TTAATTCTTCTTTAAATGTTTGG + Intronic
1118080523 14:62353855-62353877 TTAATTCTTCTTTAAAGGTTTGG + Intergenic
1118217539 14:63823485-63823507 TTAATTCTTCTTCAAAAATTTGG - Intergenic
1118263796 14:64273869-64273891 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1118385723 14:65254204-65254226 TTCATTCTTCTCTGCATGTCAGG + Intergenic
1118413773 14:65510505-65510527 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1118538679 14:66798392-66798414 TTAATTCTTCTTAAAATGTTTGG + Intronic
1118741182 14:68740528-68740550 TTCCTACTTCTTTCCCAGTTTGG - Intergenic
1118754856 14:68833704-68833726 TTAATTCTTGTTTAAATGTTTGG + Intergenic
1119334790 14:73823890-73823912 TTCATTGATCTTTGTAAGTTGGG + Intergenic
1119699033 14:76738711-76738733 TTAGTTCTTCTTTGAAAGTTTGG + Intergenic
1119965200 14:78907225-78907247 TACATTCTTCTTAACATGTGTGG + Intronic
1120181509 14:81347485-81347507 TTAATTCTTCTTTATAAGTTTGG - Intronic
1120340398 14:83213376-83213398 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1120346102 14:83292296-83292318 TTAGTTCTTCTTTATATGTTTGG + Intergenic
1120394341 14:83949449-83949471 TTAGTTCTTCTTTATAAGTTTGG + Intergenic
1120431028 14:84415697-84415719 TTAGTTCTGCTTTAAAAGTTTGG + Intergenic
1120439381 14:84516591-84516613 TTAGTTCTTCTTTAAATGTTGGG + Intergenic
1120640315 14:87002980-87003002 TTCATTCTTCTTTAAAATTCAGG + Intergenic
1120678854 14:87454756-87454778 TTAATTCTTCTTTAAATGATGGG - Intergenic
1121064984 14:90954325-90954347 GTAATTCTTCTTTAAATGTTTGG + Intronic
1121248226 14:92479784-92479806 TTAATTCTTCTTTAAACATTTGG + Intronic
1122185735 14:99993561-99993583 TTAATTCTTATTTAAATGTTTGG + Intronic
1122352746 14:101105579-101105601 TTCATTGTTCTTTACATATTTGG - Intergenic
1122367985 14:101207336-101207358 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1122435926 14:101698389-101698411 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1202839105 14_GL000009v2_random:104170-104192 TTAATTCTTCTTGAAATGTTTGG - Intergenic
1202908479 14_GL000194v1_random:94323-94345 TTAATTCTTCTTGAAATGTTCGG - Intergenic
1202884774 14_KI270722v1_random:95001-95023 TTAATTCTTCTTGAAATGTTTGG + Intergenic
1123426800 15:20178519-20178541 TTGATTCTTCTTTAAATATTTGG + Intergenic
1123536032 15:21185046-21185068 TTGATTCTTCTTTAAATATTTGG + Intergenic
1123606143 15:22030634-22030656 TGCATTCTTTTTAAAAAGTTGGG + Intergenic
1123737921 15:23203018-23203040 TTCTTACATCTTTAAAAGTTTGG + Intergenic
1123981044 15:25603534-25603556 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1124037379 15:26067726-26067748 TTAATTCTTCTTTAAATGTTAGG + Intergenic
1124123852 15:26917639-26917661 TTAATTCTTCCTTAAATGTTTGG + Intronic
1124142717 15:27091540-27091562 TTGATTCTTCTTTAAATATTTGG + Intronic
1124182888 15:27494421-27494443 TTAATTCTTCTTTAAATGTTTGG + Intronic
1124222097 15:27859585-27859607 TTAATTTTTCTTTAAATGTTTGG - Intronic
1124242468 15:28040899-28040921 TTAATTTTTCTTTAAACGTTTGG - Intronic
1124265211 15:28226901-28226923 TTAATTCTTCTTTAAAGGTTTGG + Intronic
1124289130 15:28431687-28431709 TTCTTACATCTTTAAAAGTTTGG + Intergenic
1124294092 15:28485623-28485645 TTCTTACATCTTTAAAAGTTTGG - Intergenic
1124418724 15:29497343-29497365 TTAATTCTTCTTTAAATGCTTGG + Intronic
1124451321 15:29794038-29794060 ATAATTCTTCTTTAAATGTTTGG + Intronic
1124598015 15:31107133-31107155 TTCATTCTTCTTTACAAGTTTGG + Intronic
1124725386 15:32152022-32152044 TTTATTTTTCTTTACCAGTAGGG + Intronic
1124810490 15:32932579-32932601 TTAATTATTCTTTAAATGTTTGG + Intronic
1125043226 15:35216072-35216094 TGCATTATTCTTTAGAATTTTGG - Intergenic
1125090762 15:35789348-35789370 TTAGTTCTTCTTTGTAAGTTTGG + Intergenic
1125418913 15:39483499-39483521 TTAATTCTTCTTTAAATATTTGG - Intergenic
1125432804 15:39613518-39613540 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1125565281 15:40672927-40672949 TTAATTCTTATTTAAATGTTTGG + Intergenic
1126195907 15:45931314-45931336 TTATTTCTTCTTTAAATGTTTGG + Intergenic
1126287569 15:47031034-47031056 TTCTTTCTGGGTTACAAGTTTGG + Intergenic
1126305775 15:47255019-47255041 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1126488476 15:49209910-49209932 TTAGTTCTTCTTTAAAGGTTTGG + Intronic
1126515757 15:49535485-49535507 TTAATTCTTCTTTATATGTTTGG - Intronic
1126549594 15:49912583-49912605 GTAATTCTTCTTTACATGTTTGG - Intronic
1126612992 15:50548497-50548519 TTACTTCTTCTTTACTAGTGAGG + Intergenic
1126653766 15:50954321-50954343 TTAATTCTGCTTTAAAAATTTGG + Intronic
1126737375 15:51744722-51744744 ATCATTCTTCCTTAAATGTTTGG + Intronic
1126745405 15:51821333-51821355 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1126861488 15:52887629-52887651 TTAATTCTTCTTTAAATATTTGG - Intergenic
1126944067 15:53798629-53798651 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1126991538 15:54383109-54383131 TTCATTCTTCTTTATATGTTTGG - Intronic
1127027726 15:54825785-54825807 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1127140782 15:55974330-55974352 TTAATTCTTCTTTAAATATTTGG - Intronic
1127173909 15:56333083-56333105 TTACTTCTTCTTTAAATGTTTGG - Intronic
1127197653 15:56606952-56606974 CTAATTCTTCTTTAAATGTTTGG + Intergenic
1127564665 15:60175527-60175549 CTCATTTTTTCTTACAAGTTTGG - Intergenic
1127763084 15:62159829-62159851 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1127912442 15:63428526-63428548 TTCATCCATATTGACAAGTTTGG - Intergenic
1128545464 15:68563926-68563948 TTGATTCTTCTTTAAATGTTTGG - Intergenic
1128917938 15:71583005-71583027 TTAATCCTTCTTTAAAGGTTTGG + Intronic
1128954279 15:71923440-71923462 CTCATTCTTCTTCAAATGTTTGG + Intronic
1128954901 15:71930012-71930034 TTCATTTTTATTTAAATGTTTGG + Intronic
1129588668 15:76894948-76894970 TTAATTCTTCGTTAAATGTTTGG - Intronic
1130718390 15:86360616-86360638 TTAATTCTTCTTTGAATGTTTGG + Intronic
1131135853 15:89934632-89934654 TGCATTCTTATTTAGAATTTTGG + Intergenic
1131140626 15:89974239-89974261 TTCATTCTTGTTGCCAAGTCTGG + Intergenic
1131609660 15:93947702-93947724 TTCATTCTGTTCTACAAGTAGGG + Intergenic
1131711796 15:95063562-95063584 TTCCTTCTTCTTTATATCTTTGG - Intergenic
1131754589 15:95545949-95545971 TTTATTCTGCTTTATATGTTGGG - Intergenic
1132026760 15:98410365-98410387 TTTATTATTCTTTTCAAGGTTGG - Intergenic
1132159739 15:99528877-99528899 TTAATTCTTCTTTAAATATTTGG - Intergenic
1132296805 15:100742268-100742290 TTCATTCTTTTTAAAGAGTTTGG + Intergenic
1132323859 15:100949443-100949465 TTAACTCTTCTTTAAATGTTTGG - Intronic
1132324409 15:100956063-100956085 TTCACTCTTCTTTAAACGTTTGG + Intronic
1135076127 16:19395314-19395336 TTAATTCTTCTATATAATTTTGG + Intergenic
1135177577 16:20244386-20244408 TTCATTCTTGTTTATAACCTTGG + Intergenic
1135301892 16:21336265-21336287 TTTATTCTTCTTTAAATATTTGG + Intergenic
1136603862 16:31317990-31318012 TTAATTCTTATTTAAATGTTTGG + Intronic
1136670973 16:31857058-31857080 TTAGTTCTTCTTTATAAGTTTGG - Intergenic
1136703399 16:32164339-32164361 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1136764300 16:32763260-32763282 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1136803798 16:33107126-33107148 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1136857442 16:33670979-33671001 TTGATTCTTCTTTAAATATTTGG - Intergenic
1137358503 16:47790958-47790980 ATAATTCTTCTTTAGATGTTTGG + Intergenic
1137362885 16:47836024-47836046 TTACTTCTTCTTTTCCAGTTTGG - Intergenic
1137451635 16:48580493-48580515 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1137689885 16:50416809-50416831 TTAATTCTTCTTTAAATATTTGG + Intergenic
1137818073 16:51418441-51418463 TTTATTCTTCCATTCAAGTTGGG - Intergenic
1137957736 16:52849769-52849791 TTATTTCTTCTTCAAAAGTTTGG + Intergenic
1137967028 16:52945427-52945449 TTAATTCTTTTTTAAATGTTTGG - Intergenic
1138308331 16:56000123-56000145 TTAATTATTCTTTAAAGGTTTGG + Intergenic
1138533499 16:57647545-57647567 TTTATTCTTCTTTACTAGTGAGG + Intronic
1138725363 16:59132099-59132121 TTTATTCTTCTTTAAATATTTGG + Intergenic
1138746950 16:59374684-59374706 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1138840921 16:60504952-60504974 TTCATTTATCTTCACATGTTTGG + Intergenic
1139119866 16:64003185-64003207 TTGATTCTTCTTTAAATGTTTGG - Intergenic
1139849626 16:69942895-69942917 TTTATTTTTCTTTAAAAATTTGG + Intergenic
1140157764 16:72451107-72451129 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1140614283 16:76641626-76641648 TTGATTCTTCTTTAAACATTTGG + Intergenic
1140775439 16:78244905-78244927 TTCAATCTTTTTTTCAACTTTGG - Intronic
1141221693 16:82075779-82075801 TTAGTTCTTCTTTAAAAGTTTGG - Intronic
1141325580 16:83055661-83055683 TATTTTCTTCTTTAAAAGTTTGG - Intronic
1141485548 16:84337181-84337203 TTAGTTCTTCTTTAAAAGTTTGG - Intergenic
1142338221 16:89504005-89504027 TTTATTCTTCTTTAAAAGATGGG - Intronic
1203066657 16_KI270728v1_random:1025384-1025406 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1203119017 16_KI270728v1_random:1519470-1519492 TTGATTCTTCTTTAAATATTTGG - Intergenic
1142909660 17:3077696-3077718 TTAATTCTTCTTTAGATATTTGG + Intergenic
1142924836 17:3226107-3226129 TTAATTCTTCTTTAGATATTTGG - Intergenic
1143255045 17:5550273-5550295 TTAATTCTTCTTTAAATATTTGG + Intronic
1143815606 17:9511173-9511195 TGCATTTTTCTTTAAAGGTTTGG - Intronic
1144268930 17:13599800-13599822 TTCAATCCTCTTTACAAATAAGG - Intronic
1144416417 17:15051782-15051804 TTGATTCATCTTTGCAAGATGGG + Intergenic
1144434396 17:15227023-15227045 TTAATTCTTCTTTAAATATTTGG + Intergenic
1144534485 17:16074536-16074558 TTCACTCTCCTTTACACGTCTGG - Intronic
1144603450 17:16640779-16640801 TTAATTCTTCTTGAAATGTTTGG - Intronic
1145015643 17:19395942-19395964 TTAATTCTTTTGTAAAAGTTTGG + Intergenic
1145232366 17:21182964-21182986 TTAATTCTCCTTTAAATGTTTGG + Intronic
1145276078 17:21431610-21431632 TTAATCCTTCTTTAAATGTTTGG + Intergenic
1145313924 17:21717524-21717546 TTAATCCTTCTTTAAATGTTTGG + Intergenic
1145712366 17:26989501-26989523 TTAATCCTTCTTTAAATGTTTGG + Intergenic
1145784216 17:27583580-27583602 TTCATTCTCCTGTTCAGGTTGGG - Intronic
1146413142 17:32606266-32606288 TTATTTCTTCTTTAAATGTTTGG - Intronic
1147021297 17:37535912-37535934 TACACTCTGCTTTACAACTTAGG + Intronic
1147485697 17:40811147-40811169 TTCATTTTTTTTTAAAAGTCAGG + Intergenic
1148241365 17:46001443-46001465 TTCATTTTTTTTTTTAAGTTAGG - Intronic
1148671986 17:49417794-49417816 TTATTTCTTCTTTATAAGTTTGG + Intronic
1148710191 17:49674282-49674304 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1149027404 17:52044132-52044154 TTAATTCGTCTTTAAATGTTTGG + Intronic
1149189646 17:54044551-54044573 TTAATTCTGCATTACAAGTCAGG - Intergenic
1149215863 17:54353400-54353422 TTAATTCTTCTTTAAACATTTGG + Intergenic
1149235487 17:54585442-54585464 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1149495201 17:57113090-57113112 TTCATTCTTCTTTGTAATTTAGG - Intronic
1149633516 17:58147105-58147127 TTCATACTCCTTTAAATGTTTGG - Intergenic
1149770781 17:59319319-59319341 TTTTTTTTTTTTTACAAGTTGGG - Intergenic
1149949020 17:60964615-60964637 TTAATTCTTCTTTAAATGTTTGG + Intronic
1150012807 17:61521907-61521929 TTAATTTTTCTTTATAGGTTTGG + Intergenic
1150022607 17:61633698-61633720 TTCGTTCTTCTTTAAATGTTAGG + Intergenic
1150022869 17:61637834-61637856 TTCGTTCTTCTATAAATGTTTGG - Intergenic
1150028462 17:61704357-61704379 TTATTTCTTCTTTAAATGTTTGG + Intronic
1150028469 17:61704551-61704573 TTATTTCTTCTTTAAATGTTTGG + Intronic
1150059154 17:62049189-62049211 TTCATTCTTCTTTTCCGATTTGG - Intronic
1150188988 17:63217650-63217672 ATCACTCTTCTTTAAATGTTTGG - Intronic
1150512281 17:65767935-65767957 TTAATTCTTTTTTGAAAGTTTGG - Intronic
1150545168 17:66149410-66149432 TTAATTCTTCTTTAAATGTTTGG + Intronic
1150606920 17:66699871-66699893 TTAATTCTTATTTAAATGTTTGG - Intronic
1150697183 17:67415974-67415996 TTCATTCTTCTTTGTTCGTTAGG + Intronic
1151220428 17:72607655-72607677 TTAATTCCTCTTTAAATGTTTGG - Intergenic
1151531447 17:74708335-74708357 TTATTTCTTCTTTACGTGTTTGG - Intronic
1152955235 18:34231-34253 TTAATTCTGCTTTAAACGTTGGG - Intergenic
1153036353 18:766274-766296 TGTATTCCTCTTTACAAGTGGGG - Intronic
1153056036 18:947341-947363 TTAGTTTTTCTTTATAAGTTTGG + Intergenic
1153074993 18:1152178-1152200 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1153080163 18:1213764-1213786 TTAATTCTTCTTTAAATATTTGG + Intergenic
1153388562 18:4528424-4528446 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1153702067 18:7704555-7704577 TTCTTTCTTCTTTATTAGTCTGG + Intronic
1153754662 18:8268491-8268513 TTAATTCTTCTTTAAATGTTTGG - Intronic
1154119918 18:11643953-11643975 TTCATTATTGTTCTCAAGTTGGG - Intergenic
1154230824 18:12554554-12554576 TTAGTTCTTCTTTAAATGTTAGG - Intronic
1154308704 18:13250792-13250814 TGAATTCTTCTTTAAAGGTTTGG - Intronic
1154938155 18:21082248-21082270 TTAATTCTTCTTTAAACGTTTGG - Intronic
1154989491 18:21587336-21587358 TTAATTCTTCTTTAAATGTTTGG + Intronic
1155121387 18:22823406-22823428 ATCATTCTTTTTTAGAGGTTGGG - Intronic
1155372908 18:25121932-25121954 TTCCTGCTTCTTTACGTGTTTGG - Intronic
1155443731 18:25888698-25888720 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1155760872 18:29565054-29565076 TTAATTCTTCTTTAAACATTTGG - Intergenic
1155810517 18:30227402-30227424 TTAGTTCTTCCTTATAAGTTTGG - Intergenic
1156005254 18:32432855-32432877 TTATTTCTTCTTTAAATGTTTGG - Intronic
1156243534 18:35276224-35276246 TTAATTCTTCTTTAAATGTTTGG + Intronic
1156329131 18:36102596-36102618 ATCATTTTTCTTTACATATTTGG + Intergenic
1156441741 18:37196853-37196875 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1156646450 18:39167653-39167675 TTCATGCTACTCTACAAATTTGG - Intergenic
1156680234 18:39579606-39579628 TTCATTCTTCTTCACAGATGAGG + Intergenic
1156712504 18:39963835-39963857 TTCTCTCCTCTTTAGAAGTTAGG + Intergenic
1156827768 18:41452600-41452622 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1156847558 18:41685145-41685167 TTAATTCTACTTTAAATGTTTGG - Intergenic
1156984917 18:43338818-43338840 TTAATGCTTCTTTAAATGTTTGG + Intergenic
1157038209 18:44003351-44003373 TTAATTCTTTTTTAAATGTTTGG - Intergenic
1157124460 18:44942881-44942903 TTCATTCTTATTTGCTATTTAGG - Intronic
1157376430 18:47171449-47171471 TTAAGTCTTCTTTAAATGTTTGG + Intronic
1157398471 18:47364988-47365010 TTAGTTCTTCTTTATAAGTTTGG + Intergenic
1157832107 18:50865926-50865948 TACAATCTTATTTACAATTTTGG + Intergenic
1157886704 18:51374701-51374723 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1157917696 18:51683830-51683852 TTAGTTCTTCTTTAAAGGTTTGG - Intergenic
1158409581 18:57193558-57193580 TTCATTAGTCTTTACTAGTAGGG + Intergenic
1158423482 18:57317053-57317075 TTAATTCTCCTTTAAATGTTAGG + Intergenic
1158899995 18:61953625-61953647 CTCATTCTTCTTCACAACCTGGG - Intergenic
1159180108 18:64892307-64892329 TTAATTTTTCTTTTCAAATTAGG - Intergenic
1159314812 18:66758491-66758513 TTTATTCTTCTTAACAAGATTGG + Intergenic
1159328533 18:66956197-66956219 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1159416679 18:68158782-68158804 TTAATTCTACTTTAAAAGTTTGG + Intergenic
1159616556 18:70586883-70586905 TTAATTCATCTTTAAATGTTTGG - Intergenic
1160138168 18:76292682-76292704 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1160283219 18:77512827-77512849 TTAATACTTATTTAAAAGTTAGG - Intergenic
1160562683 18:79769457-79769479 TTCAGTATTAATTACAAGTTTGG - Intergenic
1162242786 19:9369996-9370018 TTCATTCTACTTAACATTTTGGG + Intronic
1162610911 19:11751126-11751148 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1163696551 19:18766904-18766926 TTAATTCCTCTTTAAAAGTTTGG + Intronic
1164482886 19:28628536-28628558 TTAATTCTTCCTTAAATGTTTGG - Intergenic
1165345308 19:35244255-35244277 TGAATTCTTCTTTAAATGTTTGG - Intergenic
1165615432 19:37195718-37195740 CTAATTCTTCTTTGTAAGTTTGG - Intronic
1165647105 19:37450226-37450248 TTAATTCATCTTTAAATGTTTGG + Intronic
1165989285 19:39798099-39798121 TTAATTCTTCTTCAAATGTTTGG + Intergenic
1166031234 19:40131412-40131434 TTAATTCTTCTTTAACTGTTAGG - Intergenic
1166610345 19:44187193-44187215 TTAATTCTTCTTTAAATATTTGG + Intergenic
1166751768 19:45167373-45167395 TTCATCCTTATTTAGAAGTTTGG - Intronic
1168482189 19:56730222-56730244 TTCATTCTTCTTGCCCAGTCTGG - Intergenic
1168653735 19:58111669-58111691 TTAATTCTTCTTTAATTGTTTGG - Intronic
1202633932 1_KI270706v1_random:26380-26402 TTAATTCTTCTTGAAATGTTTGG + Intergenic
1202646874 1_KI270706v1_random:150411-150433 TTAATTCTTCTTTAAATGTTAGG - Intergenic
1202651950 1_KI270707v1_random:13696-13718 TTAATTCTTCTTGAAATGTTTGG - Intergenic
1202660182 1_KI270708v1_random:62033-62055 TTAATTCTTCTTGAAATGTTTGG + Intergenic
925106042 2:1292923-1292945 TTAATTCTTCTTTAAATGTTTGG + Intronic
925325316 2:3015643-3015665 TTAATTCTTCTTTATACATTTGG - Intergenic
925556460 2:5136095-5136117 TTTATTCTGCTTTACAAGTTTGG - Intergenic
925697798 2:6599925-6599947 TTAATTTTTCTTTGAAAGTTTGG - Intergenic
926479039 2:13365175-13365197 TTTATTCCTCTTTAAATGTTTGG - Intergenic
926494535 2:13568585-13568607 TTAATTCTTCTTTAAAAGTCGGG - Intergenic
926768170 2:16342493-16342515 TTATTTCTTCTTTGAAAGTTTGG - Intergenic
926900398 2:17745272-17745294 TTAATTCTTCTTTAAATGTTTGG + Intronic
927237808 2:20891770-20891792 TTAATTATTCTTTAAATGTTTGG + Intergenic
927331490 2:21869512-21869534 GTCATTTTTCTTTCCCAGTTTGG - Intergenic
927366123 2:22298739-22298761 TTTTTTTTTCTTTACTAGTTGGG - Intergenic
928067367 2:28179051-28179073 TTATTTCTCCTTTATAAGTTTGG - Intronic
928448724 2:31358330-31358352 TTAATTCTTCTTTAAATGTTTGG - Intronic
928473616 2:31600626-31600648 TTAGTTGTTCTTTAAAAGTTTGG - Intergenic
928476934 2:31637049-31637071 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
928494887 2:31821554-31821576 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
928609614 2:32978786-32978808 TTAGTTCTTCTTTAAATGTTTGG + Intronic
928679466 2:33685297-33685319 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
928802707 2:35113618-35113640 ATCAGTCTTCTTTAAATGTTTGG - Intergenic
928932804 2:36642213-36642235 TTAGTTCTTCTTTAAATGTTTGG - Intronic
929026463 2:37608636-37608658 TTAATTCTTCTTTAAATGTTTGG - Intergenic
929045908 2:37789386-37789408 TTAATTCTTCTTTAAATGTTTGG + Intergenic
929371619 2:41231285-41231307 TTAGTTCTTCTTTATATGTTTGG + Intergenic
929650208 2:43671993-43672015 TTCATTCTTCTATACATTTTTGG + Intronic
929663251 2:43811430-43811452 TTTATCTTTCTTCACAAGTTAGG + Intergenic
929812626 2:45204304-45204326 TTAGTTCCTCTTTATAAGTTTGG - Intergenic
929812687 2:45205090-45205112 TTCTGTCTTCTTGACCAGTTTGG + Intergenic
930141883 2:47959866-47959888 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
930266106 2:49200917-49200939 TTCACTCTTCTTGATAATTTGGG - Intergenic
930294731 2:49540828-49540850 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
930351916 2:50267482-50267504 TTCATTTTTGTTTTCAACTTTGG - Intronic
930413629 2:51060748-51060770 TTAATTCTTCTTTAAATGTTTGG - Intergenic
930429454 2:51255155-51255177 TTAGTTCTTCTTTATAAGTTTGG - Intergenic
930442216 2:51423676-51423698 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
930454731 2:51592642-51592664 TACATTCTAGTCTACAAGTTTGG - Intergenic
930492928 2:52099324-52099346 TTAATTCTTCTTTAAATATTTGG + Intergenic
930524698 2:52513277-52513299 TTAATTCTTCTTTAAATGTTTGG - Intergenic
930666084 2:54100136-54100158 TTTATTATTTTTTACAATTTTGG - Intronic
930668650 2:54124586-54124608 TTCATACTTCTTGACAAACTGGG - Intronic
931134398 2:59380318-59380340 TCAGTTCTTCTTTATAAGTTTGG - Intergenic
931344961 2:61437915-61437937 TTCATTCTTCTGTAAATATTTGG - Intronic
931457221 2:62420661-62420683 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
931505845 2:62924764-62924786 TTAATTCTTCTTTAAGGGTTGGG - Intronic
932069388 2:68602267-68602289 TCTATTCTTCTTTAAATGTTTGG - Intronic
932085855 2:68759651-68759673 TTAGTTCTTCTTTAGACGTTTGG - Intronic
932342124 2:70970676-70970698 TTAATTCTTCTTTAAATGTTTGG + Intronic
932530762 2:72529539-72529561 TTAATTCTTCTATAAATGTTTGG + Intronic
932539318 2:72635621-72635643 TTAATTCTTCTTAAAATGTTTGG - Intronic
932637521 2:73404842-73404864 TTAATTCTTCTTTAAATGTATGG + Intronic
932786695 2:74611254-74611276 TTAGTTCTTCTTTAAATGTTTGG + Intronic
932889849 2:75583949-75583971 TTAATTCTTCTTTAAATGTTTGG - Intergenic
932905280 2:75742539-75742561 TTAATTCTTCTTTAAAGGTTTGG - Intergenic
932907810 2:75772901-75772923 TCCATTCTTATTTCTAAGTTTGG + Intergenic
932974620 2:76583951-76583973 TTAATTCTTCTTTAAATATTTGG + Intergenic
933025730 2:77256330-77256352 TTAATTCTTCTTCAAATGTTTGG - Intronic
933027649 2:77281443-77281465 CTCATTGTTCTTCAGAAGTTTGG - Intronic
933204685 2:79492644-79492666 TTAATACTTCTTTATATGTTTGG - Intronic
933214193 2:79608324-79608346 TCATTTCTTCTTTACATGTTTGG - Intronic
933332842 2:80916722-80916744 TTCATTCTTCTTTAAATATTTGG + Intergenic
933348579 2:81123476-81123498 TTAATTCTTCTTCAAATGTTTGG + Intergenic
933376238 2:81482917-81482939 TTTATTCTTCCTTAAATGTTAGG + Intergenic
933489872 2:82971983-82972005 TTTCTTCTTCTTTAAATGTTTGG - Intergenic
933537394 2:83593078-83593100 TACCTTCTTCTTTCCAATTTAGG - Intergenic
933573740 2:84043373-84043395 TTCTTTCTTCTTCACAGATTTGG - Intergenic
933617834 2:84501605-84501627 TTAGTTCTTCTTTAAAAGTTTGG + Intergenic
933785226 2:85834777-85834799 ATCATTCTTCTTTAAATGTTTGG - Intergenic
933852349 2:86379303-86379325 TTAATTCTTCTTTGCAAGTTTGG + Intergenic
934135191 2:88989137-88989159 GTCATTCTTCTTGACAAATTAGG + Intergenic
934139985 2:89036934-89036956 GTCATTCTTCTTGGCAAATTAGG + Intergenic
934229255 2:90163617-90163639 GTCATTCTTCTTGGCAAATTAGG - Intergenic
934893949 2:98096198-98096220 TTAGTTCTTCTTTAAATGTTTGG + Intronic
935004346 2:99056640-99056662 TTGATTCTTCTTTAAAGGTTTGG - Intronic
935018429 2:99206540-99206562 TTAGTTCTTCTTTAAATGTTTGG + Intronic
935125718 2:100220878-100220900 TTCATTTTTCTTCAAATGTTCGG + Intergenic
935143179 2:100373864-100373886 TTAATTCTTCTTTAAATGTTTGG - Intergenic
935174361 2:100636221-100636243 TCAATTCTTCTTTAAATGTTTGG + Intergenic
935286683 2:101570613-101570635 TTAATTCTTTTTTAAATGTTTGG + Intergenic
935393167 2:102575797-102575819 TTAGTTCTTCTTTAAAAGTTTGG + Intergenic
935480245 2:103578909-103578931 TTAATTATTCTTTAAAAGTTTGG + Intergenic
935482557 2:103611507-103611529 TTCATTTTTCTTTATGAGTGAGG - Intergenic
935526589 2:104177300-104177322 TTAATTCTTCCTTAAATGTTTGG + Intergenic
935688115 2:105703909-105703931 TTCGTTTTTCTTTCAAAGTTTGG - Intergenic
935751520 2:106239139-106239161 TTAATTCTTCTTTAAATTTTTGG - Intergenic
935813288 2:106821582-106821604 TTAGTTCTTCTTTAAATGTTTGG - Intronic
935843161 2:107136014-107136036 TTTATTCTTCTTTAAATGGTGGG + Intergenic
935911985 2:107907055-107907077 TTAATTCTTCTTTAAATTTTTGG - Intergenic
935928083 2:108092251-108092273 TTACTTCTTCTTTAAATGTTGGG + Intergenic
935938392 2:108211953-108211975 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
936000448 2:108823203-108823225 TTAATTCTTCTTCAAATGTTTGG - Intronic
936167384 2:110134403-110134425 TTAATTCTTCTTTAAAGGTTTGG - Intronic
936255906 2:110911287-110911309 TTAATTCTTATTTAAATGTTTGG - Intronic
936431485 2:112467623-112467645 TTTGTTCTTCTTTAAATGTTTGG - Intergenic
936487265 2:112936870-112936892 TTCATTCTTCTTAACAATCAGGG + Intergenic
936892292 2:117386050-117386072 TTAGTTCTTCTTTGAAAGTTTGG + Intergenic
936990518 2:118359818-118359840 TTAAGTCTTCTTTAAATGTTTGG + Intergenic
937405424 2:121623607-121623629 TTGATTCTTCTTTAAATATTTGG + Intronic
937448589 2:121980518-121980540 TTATTTCTTCTTTAAATGTTTGG + Intergenic
937545208 2:123008617-123008639 TTAATTTTTCTTTATAAGTTTGG - Intergenic
937730038 2:125218691-125218713 TTAATTCTCCTTTAAAGGTTTGG + Intergenic
937796046 2:126021310-126021332 TTAATTCTCCTTTAAATGTTTGG - Intergenic
937805700 2:126141422-126141444 TTATTTCTTCTTTAAATGTTTGG + Intergenic
937830374 2:126414505-126414527 TTAGTTCTTCTTTAAAAGTTTGG - Intergenic
937863051 2:126727853-126727875 TTAATTCTTCTTTGAATGTTTGG - Intergenic
938095865 2:128462918-128462940 TTAATTTTTCTTTAAAAGTTTGG - Intergenic
938548368 2:132355706-132355728 TTAATTCTTCTTTAAATGTTAGG + Intergenic
938698606 2:133856771-133856793 TTCTTTCCTCTTTTCCAGTTAGG - Intergenic
938822313 2:134971501-134971523 TTAGTTCTTCTTTATGAGTTTGG + Intronic
939072847 2:137564583-137564605 TACATACTACTTTACAAGCTAGG - Intronic
939371429 2:141306223-141306245 CTCATTCTTCTTTATATGTCTGG + Intronic
939472548 2:142642484-142642506 TTAATTCTTCTTGACAAGATTGG - Intergenic
939482355 2:142765256-142765278 TTTATTCTTCCTTGAAAGTTTGG - Intergenic
939650197 2:144751190-144751212 TTATTTCTTCTTTACATGTATGG - Intergenic
939658457 2:144856410-144856432 TTTATTCTGCTTTACTAGATTGG + Intergenic
939678180 2:145097919-145097941 CTGATTCTTCTTTATATGTTAGG + Intergenic
939678442 2:145100969-145100991 CTGATTCTTCTTTATATGTTAGG - Intergenic
939724998 2:145708047-145708069 TTAATTCTTCTTTAAATGTTTGG + Intergenic
939743807 2:145944605-145944627 TTAATTATTCTTTAAATGTTTGG + Intergenic
939771885 2:146331334-146331356 TTAATTATTCTTTACATATTGGG + Intergenic
939913411 2:148010752-148010774 TTAGTTCTTCTTTAAATGTTTGG - Intronic
940186425 2:150989609-150989631 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
940365334 2:152842614-152842636 TTCATTCTTTTTTGAATGTTTGG + Intergenic
940383184 2:153039966-153039988 TTAATTCTTCTTTAAATGTGTGG + Intergenic
940387791 2:153093755-153093777 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
940397501 2:153207933-153207955 TTCATTCTTCTTTAGAACTTTGG + Intergenic
940570379 2:155425216-155425238 TTAATTCTTCTTTAAAAGTTTGG + Intergenic
940630100 2:156227707-156227729 TTAATTCTTCTTTAAACATTTGG - Intergenic
941092051 2:161188588-161188610 TTAATTCTGCTTTAAATGTTTGG - Intronic
941228001 2:162872870-162872892 TTAACTCTTCTTTAAATGTTTGG - Intergenic
941314795 2:163979081-163979103 TTGATTCTTATTTAGAAGTTTGG + Intergenic
941467804 2:165850810-165850832 TTAATTCTTCTGTGTAAGTTTGG + Intergenic
941496655 2:166213561-166213583 TTGTTTCTTCTTTAAATGTTTGG - Intronic
941500402 2:166267636-166267658 TTAGTTCTTCTTTAAATGTTTGG + Intronic
941535061 2:166711993-166712015 TTCGTTCTTCTTGGCAAGATTGG + Intergenic
941540373 2:166775021-166775043 TTAATTCTTCTTTAAATATTTGG + Intergenic
941780197 2:169435696-169435718 TTAGTTCTTTTTTAAAAGTTTGG - Intergenic
941842647 2:170103564-170103586 TTATTTCTTCTTTAAAGGTTAGG + Intergenic
942350406 2:175046623-175046645 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
942375921 2:175337608-175337630 TTAATCCTTCTTTGAAAGTTTGG + Intergenic
942429346 2:175893585-175893607 TTCTTTCTTCTTTATTAGTCTGG - Intergenic
942813996 2:180030091-180030113 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
942833406 2:180263894-180263916 TTCATGCTCCTATACCAGTTAGG + Intergenic
942834116 2:180272194-180272216 TTAGTTCTTCTTTAAATGTTGGG + Intergenic
942863152 2:180640217-180640239 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
942899622 2:181098856-181098878 TTAATTCTTCTTTAAATGTTTGG - Intergenic
943123767 2:183771028-183771050 TTCATTTTTCTTTAAATGTTTGG - Intergenic
943236722 2:185331160-185331182 CTAGTTCTTCTTTAAAAGTTTGG + Intergenic
943331526 2:186565475-186565497 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
943349738 2:186783205-186783227 TTAATTCTTCTTTAAAAGTTTGG - Intergenic
943397675 2:187360708-187360730 TTCATTCATCTTTACCTGATGGG - Exonic
943475983 2:188355589-188355611 TTATTTCTTCTTTACAAGTTTGG - Intronic
944043649 2:195383923-195383945 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
944073402 2:195698890-195698912 TTAGTTCTTCTTTAAATGTTAGG + Intronic
944198793 2:197083647-197083669 TTCCTTCAACTATACAAGTTAGG + Intronic
944245542 2:197526616-197526638 TTAATTTTTCTTTAAATGTTTGG + Intronic
944354432 2:198769126-198769148 TCCATTCTTCTTCACAGGGTGGG + Intergenic
944593634 2:201241614-201241636 TTAATTCTTCTTGAGATGTTTGG - Intronic
944751277 2:202713106-202713128 TTAGTTCTTCTTTAAATGTTTGG + Intronic
945119913 2:206446643-206446665 TTTACTATTTTTTACAAGTTAGG + Intronic
945313615 2:208345105-208345127 TTCGGTATTCTTTACAACTTAGG - Exonic
945389773 2:209250251-209250273 TTAATTCTTCTTTAAATATTTGG - Intergenic
945764782 2:213961958-213961980 TTAATTCTTCTTTGAATGTTTGG + Intronic
945970859 2:216229954-216229976 TTAGTTCTTCTTTGAAAGTTTGG + Intergenic
946428186 2:219610909-219610931 TTCTTTCTTCTTTGCAAAATGGG + Intronic
946508707 2:220330763-220330785 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
946525409 2:220513829-220513851 TTTTTTGTTCTTTACAATTTTGG - Intergenic
946815379 2:223572036-223572058 TTCATTTTTCTTTAAATGTTTGG - Intergenic
946975547 2:225145542-225145564 TTAGTACTTCTTTAAAAGTTTGG - Intergenic
947008834 2:225542843-225542865 TTAGTTCTTCTTTAAATGTTTGG + Intronic
947130661 2:226920936-226920958 TTCATTCCTTTTTAAATGTTTGG + Intronic
947336142 2:229086066-229086088 TTCCATGTTCATTACAAGTTTGG - Intronic
947356810 2:229304772-229304794 TTAATTCTTCCTTAAATGTTTGG - Intergenic
947686734 2:232093466-232093488 TTAATTCTTCTTTAAATGTTTGG + Intronic
948444588 2:238022500-238022522 GTCGTTGTTCTATACAAGTTTGG + Intronic
948557920 2:238828358-238828380 TTATTTCTTCTTTAAATGTTTGG - Intergenic
1168871580 20:1133694-1133716 TTAATTCTTCTTTGAATGTTTGG + Intronic
1168899541 20:1350765-1350787 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1169096473 20:2903680-2903702 TTCTTTCTTTTTTTTAAGTTGGG - Intronic
1169310013 20:4528668-4528690 TTAATTCTTCTTTAAAGATTTGG - Intergenic
1169587349 20:7100397-7100419 TTAATTCTTCTTTAAGTGTTTGG - Intergenic
1169599541 20:7241869-7241891 TTCATTTTTCTTTAGGATTTGGG - Intergenic
1169607661 20:7340498-7340520 TTATTTCTTCTTTGAAAGTTTGG - Intergenic
1169624211 20:7544727-7544749 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1169628994 20:7604543-7604565 TTAATTCTTCTTTAAGTGTTTGG - Intergenic
1169833030 20:9846329-9846351 TTGATTCTTATTTTCAAATTTGG - Intergenic
1169989023 20:11479073-11479095 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1170240455 20:14160299-14160321 TTAGTTCTTCTTTGGAAGTTTGG + Intronic
1170389649 20:15858276-15858298 TTCATTTTTTTTTAAATGTTAGG - Intronic
1170401984 20:15996422-15996444 TTAATTCTTCTTTAAATGTTTGG + Intronic
1170402094 20:15998256-15998278 TTAATTCTTCTTTAAATGTTTGG + Intronic
1170410520 20:16085344-16085366 TTAATTCTTCTTTAAAAGTTTGG - Intergenic
1170465197 20:16616501-16616523 TACTTTCTTGTTTACAAGTTTGG + Intergenic
1170661144 20:18341589-18341611 TTAATTTTTCTTTAAATGTTTGG - Intergenic
1171132847 20:22670260-22670282 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1171877238 20:30588482-30588504 TTAATTCTTCTTTAAATGTTAGG + Intergenic
1172170573 20:32929262-32929284 TTCATTCTTCCTTAAATGTTTGG + Intronic
1172203457 20:33144374-33144396 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1172858754 20:38030318-38030340 TTAATTCTTCATTAAATGTTTGG - Intronic
1173099277 20:40069555-40069577 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1173409810 20:42800143-42800165 ATCATTCTTCTTTTACAGTTGGG + Intronic
1173720070 20:45250267-45250289 TTAACTCTTCTTTAAAAGTTTGG - Intergenic
1174286582 20:49478384-49478406 TTGATTCTTGTTTAGAAGATGGG - Intronic
1174894998 20:54439133-54439155 GTCATTCTTTTCTATAAGTTTGG - Intergenic
1174981830 20:55404648-55404670 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1175203816 20:57295933-57295955 TTCATTCTTTTTGCCCAGTTTGG + Intergenic
1176600198 21:8785959-8785981 TTAATTCTTCTTGAAATGTTTGG + Intergenic
1176604993 21:8822363-8822385 TTAATTCTTCTTTAAATGTTAGG + Intergenic
1176646148 21:9352225-9352247 TTAATTCTTCTTGAAATGTTTGG + Intergenic
1176899652 21:14424361-14424383 TTAATTCTTCTTTAAATGTCTGG - Intergenic
1176918154 21:14651092-14651114 TTAATTCTTCTTTAAAGGTTTGG - Intronic
1177058215 21:16335843-16335865 TTCATACTGCTTTACAGGGTTGG + Intergenic
1177083032 21:16665534-16665556 TTAGTTTTTCTTTAAAAGTTTGG - Intergenic
1177090500 21:16761335-16761357 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1177487766 21:21781303-21781325 TTAGTTCTTCTTTAAAAGTTTGG + Intergenic
1177716939 21:24851304-24851326 TTCATCGTTCTTGACAATTTTGG + Intergenic
1177824334 21:26065567-26065589 TTCATTCCCCTTTACAAATGAGG + Intronic
1178735872 21:35150094-35150116 TTCTTTCTTCCTGACCAGTTTGG - Intronic
1179118202 21:38515485-38515507 TTAGTTCTTCTTTCTAAGTTTGG - Intronic
1180327666 22:11445623-11445645 TTAATTCTTCTTGAAATGTTTGG + Intergenic
1180347284 22:11713968-11713990 TTAATTCTTCTTTAAATGTTAGG + Intergenic
1180355036 22:11832055-11832077 TTAATTCTTCTTTAAATGTTAGG + Intergenic
1180366774 22:11946897-11946919 TTAATTCTTCTTGAAATGTTTGG - Intergenic
1180379313 22:12124434-12124456 TTAATTCTTCTTGAAATGTTTGG + Intergenic
1180383214 22:12160276-12160298 TTAATTCTTCTTTAAATGTTAGG - Intergenic
1180418173 22:12788571-12788593 TTAATTCTTCTTGAAATGTTTGG - Intergenic
1180567516 22:16686613-16686635 TTAATTCTTCTTTAAATCTTTGG - Intergenic
1180607602 22:17071486-17071508 TTATTTCTTCTTTAAATGTTTGG + Intergenic
1180761645 22:18214448-18214470 TTAGTTCTTCTTTAAACGTTTGG + Intergenic
1180774022 22:18410162-18410184 TTAGTTCTTCTTTAAACGTTTGG - Intergenic
1180805372 22:18709702-18709724 TTAGTTCTTCTTTAAACGTTTGG + Intergenic
1180860609 22:19078901-19078923 TTAATTCTTCTTTAAACGTTTGG + Intronic
1180974095 22:19836446-19836468 TTATTTCTTCTTTAAATGTTTGG - Intronic
1181070132 22:20329175-20329197 TTAGTTCTTCTTTAAACGTTTGG - Intergenic
1181193126 22:21157113-21157135 TTAGTTCTTCTTTAAACGTTTGG - Intergenic
1181216320 22:21335488-21335510 TTAGTTCTTCTTTAAACGTTTGG + Intergenic
1181327204 22:22058935-22058957 TTCATTCTTCAGTACAGGGTGGG + Intergenic
1181394637 22:22611971-22611993 TTAATTCTTCTTTAAACATTTGG - Intergenic
1181717765 22:24746019-24746041 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1181791910 22:25274676-25274698 TTAATTCTTCTTTAAATATTTGG + Intergenic
1181827549 22:25530486-25530508 TTCATTCTTCTTTAAATATTTGG + Intergenic
1182406737 22:30140361-30140383 TTAATTCTTCTTTAAATGTTTGG + Intronic
1184064844 22:42112508-42112530 TTCTTTCTCCTTTTCCAGTTTGG + Intergenic
1184448055 22:44564355-44564377 TTATTTCTTCTTTATATGTTTGG - Intergenic
1184811660 22:46838473-46838495 TTCATTCTTCTTTAAGTATTTGG - Intronic
1184862788 22:47184326-47184348 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1184882469 22:47318249-47318271 TTCTTTCTTCATTAAAAGTTTGG + Intergenic
1185283389 22:49986763-49986785 TTAATTCTACTTTAAATGTTTGG + Intergenic
1185364290 22:50429675-50429697 TTAACTCTTCTTTAAATGTTTGG + Intronic
949428403 3:3944527-3944549 TTAATTCTTCCTTTCCAGTTTGG + Intronic
949595641 3:5543492-5543514 TTAATTCTTCTTTAAATGTTTGG + Intergenic
949605954 3:5653790-5653812 TTCATTCTGATTTCCAAGGTGGG - Intergenic
949828921 3:8192973-8192995 TTATTTCTTCTTTAAATGTTTGG + Intergenic
950622836 3:14219747-14219769 TTAATTCTTCTTTAAACATTTGG + Intergenic
950625093 3:14239729-14239751 TTAATTCTTCTTTGAACGTTTGG + Intergenic
950732725 3:14975786-14975808 TTAATTCTTCTTTAAATGCTTGG + Intronic
950823551 3:15790210-15790232 TTAGTTCTTCTTTAAATGTTTGG - Intronic
950960684 3:17103163-17103185 TTAATTCTTCTTTAAATGTTTGG - Intergenic
950992418 3:17453679-17453701 TTAGTTCTTCTTTAAATGTTTGG - Intronic
951022114 3:17792352-17792374 TTCATTTCTCTTTTCAAATTTGG + Intronic
951213034 3:19996497-19996519 TTAATTCTTTTTTATAAGTTTGG - Intronic
951271150 3:20626071-20626093 TTAGTTCTTTTTTATAAGTTAGG - Intergenic
951282420 3:20768883-20768905 TTAGTTCTTCTTTATAAGTTTGG + Intergenic
951318044 3:21210512-21210534 TTAATTCTTATTTAAATGTTTGG + Intergenic
951608540 3:24464737-24464759 TTTATTCTCCTCTACAGGTTTGG + Intronic
951733845 3:25840836-25840858 TTAATTCTTCTTTGAATGTTTGG - Intergenic
951818300 3:26780642-26780664 TTATTTCTTCTTTAAATGTTTGG + Intergenic
951899081 3:27639348-27639370 TTCATTCTATTTCACAATTTAGG - Intergenic
951922090 3:27866498-27866520 TTAATTCTTCTTAAAATGTTTGG + Intergenic
952143609 3:30506564-30506586 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
952222280 3:31336038-31336060 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
952326934 3:32328895-32328917 TTAATTCTTCTTTAAACATTTGG - Intronic
952415576 3:33087675-33087697 TTAATTCTTCTTTAAATGTTTGG - Intronic
952579675 3:34818126-34818148 TTAATTCTTCTTTAAATGCTTGG - Intergenic
952592840 3:34978266-34978288 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
952995333 3:38875374-38875396 TTAATTCTTCCTTGGAAGTTTGG + Intronic
953048709 3:39320597-39320619 TTAATTCTTCTTTAAACATTTGG + Intergenic
953088494 3:39698540-39698562 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
953229136 3:41048482-41048504 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
953273645 3:41472685-41472707 TTAGTTTTTCTTTAAAAGTTTGG - Intronic
953280590 3:41551684-41551706 TTAATTCTTCTTTGAAAGTTTGG - Intronic
953416958 3:42727819-42727841 CTCTTACTTCTTTGCAAGTTTGG - Intronic
953501630 3:43441572-43441594 GTAATTCTTCTTTAAATGTTTGG - Intronic
953542073 3:43829647-43829669 TTAATTCTTCTTTAAATGTTTGG + Intergenic
953801683 3:46029124-46029146 TTCTTTCTTCTATTCAAGATTGG + Intergenic
953803000 3:46042736-46042758 TTAATTCTTCTTTAAATGTTTGG - Intergenic
953820274 3:46202384-46202406 ATCTCTCTTCTTTTCAAGTTGGG - Exonic
953836288 3:46348339-46348361 TTAATTTTTCTTTAAATGTTTGG + Intergenic
953893174 3:46771326-46771348 TTAATTCTTCTTTAAATGCTTGG - Intronic
954487553 3:50868001-50868023 TTAGTTCTTCTTTAAATGTTAGG + Intronic
954507130 3:51087038-51087060 TTAGTTCTTCCTTATAAGTTTGG - Intronic
954527221 3:51282746-51282768 TTAATTCTTATTTAAAAATTTGG - Intronic
954551813 3:51488167-51488189 TTAATTCTTCTTTAAATGTTTGG - Intronic
954963478 3:54587891-54587913 TTAATTCTTCTTTAAATGTTTGG - Intronic
955048099 3:55378998-55379020 TTCATTATTATTTATTAGTTTGG - Intergenic
955249619 3:57266272-57266294 TTAGTTCTTCTTTAAATGTTTGG + Intronic
955467545 3:59252681-59252703 TTCAGTCTTATCTACAATTTGGG + Intergenic
955593992 3:60568671-60568693 TTCATTTTGCTTTAGTAGTTAGG - Intronic
955618593 3:60836350-60836372 TTAATTATTCTTTAAATGTTTGG + Intronic
955622703 3:60882291-60882313 TTAGTTCTTCTTTAAATGTTTGG - Intronic
955960561 3:64336739-64336761 GTCATACTTCTTTTTAAGTTGGG - Intronic
956237270 3:67087624-67087646 TTAGTTCTTTTTTACATGTTTGG - Intergenic
956391829 3:68781675-68781697 TTAATTCTTCTTTAAATGTTAGG - Intronic
956421228 3:69087848-69087870 TTCATACTTCAGTAAAAGTTTGG + Intronic
956772131 3:72535561-72535583 TTAATTCATTTTTAAAAGTTGGG - Intergenic
956852404 3:73241698-73241720 TTAATTCTTCTTTAAACCTTTGG + Intergenic
956912836 3:73837943-73837965 TTAGTTCTTCTTTAAAAGCTTGG - Intergenic
957094041 3:75761201-75761223 TTAATTCTTCTTGAAATGTTTGG - Intronic
957146988 3:76436670-76436692 TTCTTTTTTCTTTTCAAGTTTGG - Intronic
957755951 3:84487741-84487763 TTAATTCTTCTTTAAATGTTTGG + Intergenic
957778350 3:84785984-84786006 TTCATTATTCATCACAACTTGGG + Intergenic
957828065 3:85476246-85476268 TTCATACATCTTTATAAATTGGG + Intronic
957995579 3:87685384-87685406 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
958010499 3:87872854-87872876 TCAATTTTTCTTTAAAAGTTTGG - Intergenic
958078629 3:88716302-88716324 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
958100971 3:89009874-89009896 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
958180749 3:90057451-90057473 TTCATTATTCCTTAGAAGCTAGG + Intergenic
958194352 3:90223587-90223609 TTCATTCTTTTTCACAAGCATGG + Intergenic
958417720 3:93894638-93894660 TTCATTCTTTTTCACAAGCATGG + Intronic
958484546 3:94687275-94687297 TTAATTCCTCTTTATAAGTTTGG - Intergenic
958617849 3:96518650-96518672 TTAATTCTTCTTTAAATGTTTGG - Intergenic
958637998 3:96770150-96770172 TTAATTCTTCTTTAAATGTTTGG - Intergenic
958744906 3:98121561-98121583 TTCATTCTTATTTAAATTTTTGG - Intergenic
958793417 3:98680559-98680581 TTCACTTTTGTTTAAAAGTTAGG + Intergenic
958976691 3:100675685-100675707 TTAGTTCTTCTTTAAATGTTTGG + Intronic
959118189 3:102202323-102202345 TTAATTCTTCTTTAAATGTTTGG + Intronic
959124626 3:102275721-102275743 TTAGTTCTTCTTTAAATGTTTGG + Intronic
959259318 3:104054525-104054547 TTCATTCTTCTTGAAATGTTTGG - Intergenic
959285643 3:104405492-104405514 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
959679948 3:109083575-109083597 TTAGTTCTTCTTTAAATGTTTGG - Intronic
959823245 3:110762129-110762151 ATCATTCTTCTTTATAACTTAGG + Intergenic
959847179 3:111046974-111046996 TTCATAATTCTTCACAAGTGTGG + Intergenic
959868240 3:111296245-111296267 TTCGTTCTTCCTTAGATGTTTGG + Intronic
960013975 3:112864784-112864806 TTCGTTATTCCTTATAAGTTTGG + Intergenic
960085496 3:113586237-113586259 TTCATTATTCTTAATAATTTTGG - Intronic
960094924 3:113680176-113680198 TTAGTTCTTCTTTAGATGTTTGG + Intronic
960123512 3:113971753-113971775 TTAGTTCTTCTTTAAAAGTTTGG + Intronic
960237039 3:115295526-115295548 TTTATTCTTATTTACTATTTAGG + Intergenic
960270756 3:115671854-115671876 TACACTCTTCTTTTCAAGTAAGG - Intronic
960415706 3:117382813-117382835 TTTGTTCTTCTTTAAAAGTTTGG - Intergenic
960478119 3:118156126-118156148 TTAATTCCTCTTTAAAAGTTTGG - Intergenic
960491098 3:118317424-118317446 TTAGTTCTTCTTTCCATGTTTGG - Intergenic
960607328 3:119520649-119520671 TTAATTCTTCTTTAACTGTTTGG - Intronic
960841168 3:121960873-121960895 TTCATTCTTCTTTAAATGTTTGG - Intergenic
960870271 3:122241588-122241610 TTCATTCTTCTTTAAATGTTTGG - Intronic
961233827 3:125345900-125345922 TTAATTCTTCATTAAATGTTTGG - Intronic
961317018 3:126045679-126045701 TTAATTTTTCTTTAAATGTTTGG - Intronic
961416473 3:126761730-126761752 TTAATTCTTCTTTAAATGTTTGG + Intronic
961610898 3:128137603-128137625 TTAGTTCTTCTTTAAATGTTTGG - Intronic
962182176 3:133218960-133218982 TTAGTTCTTCTTTAAATGTTTGG + Intronic
962483654 3:135820403-135820425 TTAGTTCTTCTTGAAAAGTTCGG - Intergenic
962558956 3:136585833-136585855 TTCAGTTTTCTTTAGTAGTTTGG + Intronic
962598612 3:136972384-136972406 TTAATTCTTCTTTGTATGTTTGG + Intronic
962638518 3:137357725-137357747 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
962644633 3:137424375-137424397 TTGGTTCTTCTTTATATGTTTGG - Intergenic
962750461 3:138431227-138431249 TTCAGTCTTCTTTTTAATTTAGG + Intergenic
962758854 3:138489783-138489805 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
962925450 3:139989034-139989056 TTCAATCTGCTTTACAATTTGGG + Intronic
963165343 3:142195906-142195928 TTAATTCTTCTTTAAACTTTTGG + Intronic
963167782 3:142223421-142223443 TTCATTTTTCTTTTCAGGCTGGG + Intronic
963170437 3:142245021-142245043 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
963279043 3:143363337-143363359 ATCATTCCTTTTTATAAGTTTGG + Intronic
963457353 3:145561205-145561227 TTCATTCTTCTTTAAACGCTTGG + Intergenic
963514808 3:146294728-146294750 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
963571678 3:147005242-147005264 TTAGGTCTTCTTTACACGTTTGG + Intergenic
963573073 3:147022023-147022045 TTAATTCTCCTTTAAATGTTTGG - Intergenic
963692612 3:148523560-148523582 TTAATTCTTCTTTAAATGTTTGG - Intergenic
963719805 3:148849402-148849424 TTCATTGTCCTTTAGAATTTTGG - Intronic
963758754 3:149263429-149263451 TTAATTCTTCTTTGTAAGTTCGG - Intergenic
963813648 3:149805505-149805527 TTTATTCTTCTTTAAATGTCTGG + Intronic
964140456 3:153392831-153392853 TTATTTCTTCTTTAAATGTTTGG + Intergenic
964250300 3:154708260-154708282 TTAATTCTGCTTTAAATGTTAGG - Intergenic
964456403 3:156872016-156872038 TTAGTTCTTCTTTGAAAGTTAGG + Intronic
964502523 3:157364322-157364344 TTCTTTCTTCTTTAGAAACTTGG + Exonic
964543208 3:157802955-157802977 TTTATTCTTCATTTCAACTTTGG + Intergenic
964648489 3:158985397-158985419 TTCTTTCTTCGTTAGAAATTAGG - Intronic
964753354 3:160072621-160072643 TTAATCTTTCTTTAGAAGTTTGG + Intergenic
964901694 3:161667428-161667450 TTAGTTCTTCTTTGAAAGTTTGG + Intergenic
964997066 3:162895034-162895056 TTGGTTATTCTTTACAAGTTTGG - Intergenic
965173974 3:165306454-165306476 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
965236593 3:166132484-166132506 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
965318390 3:167220148-167220170 TTCATTCTTATTTAAATGTTTGG - Intergenic
965828621 3:172756177-172756199 TTCATTCTTCATTCTAGGTTAGG + Intronic
965860930 3:173149217-173149239 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
966054234 3:175663084-175663106 TTGGTTCTTCTTTAAATGTTTGG + Intronic
966106630 3:176343560-176343582 TTAGTTCTTCTTTATCAGTTTGG + Intergenic
966136357 3:176703532-176703554 TTCATACTCCTTTCTAAGTTTGG - Intergenic
966620785 3:181961805-181961827 TTTATTTTTGTTTACAAATTTGG + Intergenic
966745574 3:183273082-183273104 TTCCTTCTTTTTTAAAAGGTTGG - Exonic
966998025 3:185303395-185303417 TTAATTCTTCTTTAAATGTGTGG + Intronic
967006231 3:185385481-185385503 TTAGTTCTTCTTTATAAGATTGG - Intronic
967039749 3:185680367-185680389 ATAATTCTTCTTTAAATGTTTGG - Intronic
967297332 3:187978208-187978230 GTCATCCTTTTTTACATGTTTGG + Intergenic
967696627 3:192539727-192539749 TTAGTTCTTCTTTAAATGTTTGG + Intronic
967779713 3:193423276-193423298 TTAGTTCTTCTTTAAATGTTTGG - Intronic
967848829 3:194066309-194066331 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
967944576 3:194793089-194793111 TTAGTTCTTCTTTGTAAGTTTGG + Intergenic
968358477 3:198127912-198127934 TTAATTCTGCTTTAAACGTTGGG + Intergenic
1202740736 3_GL000221v1_random:52831-52853 TTAATTCTTCTTGAAATGTTTGG - Intergenic
968428866 4:542576-542598 TTCATTATTATTTATAAGTAAGG + Intergenic
969145279 4:5118133-5118155 CTAATTCTTCTTTAAATGTTTGG + Intronic
969742628 4:9043125-9043147 TTTGTTTTTCTTTACAAATTGGG + Intergenic
970070391 4:12152404-12152426 TTATTTCTTCTTTAAAAGTTTGG + Intergenic
970209350 4:13691973-13691995 TTAATTCTTCTTTGTAAGTTTGG + Intergenic
970349394 4:15186205-15186227 TTGAGTATTGTTTACAAGTTTGG + Intergenic
970667157 4:18350513-18350535 TTAATTCTTCTTCAAATGTTTGG + Intergenic
970814121 4:20133668-20133690 TTAATTCTTCTTTAAATATTGGG - Intergenic
971491913 4:27221966-27221988 TTAGTTCTTCTTTAAAAGTTTGG + Intergenic
971558696 4:28046523-28046545 TTGTTTCTTCTTTAAAAGTTTGG + Intergenic
971723607 4:30279714-30279736 TTCATGCTTCTTTGTCAGTTTGG + Intergenic
971754761 4:30692985-30693007 TTAATTGTTCTTTAAATGTTTGG + Intergenic
971936450 4:33155119-33155141 TTAATTCTTCTATAAATGTTTGG - Intergenic
972270466 4:37505862-37505884 TTAGTTCTTCTTTAAATGTTTGG + Intronic
972443782 4:39123279-39123301 TTAATTCTTCTTTATATGTTTGG - Intronic
972690978 4:41397398-41397420 TTAATACATCTTTACCAGTTAGG - Intronic
972928723 4:44044553-44044575 TTAATTCTTCTTTAAATGTTTGG - Intergenic
972967341 4:44527019-44527041 TTAGTTCTTCTTTACATGTTTGG + Intergenic
972996803 4:44889808-44889830 TTAGTTCTTCTTTAAATGTTCGG + Intergenic
973043742 4:45508788-45508810 TTAATTTTTCTTTATATGTTTGG + Intergenic
973196308 4:47446280-47446302 TTAATTCTTCTTTAAATGTTTGG - Intergenic
973327077 4:48873474-48873496 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
973363614 4:49188716-49188738 TTAATTCTTCTTGAAATGTTTGG + Intergenic
973373129 4:49268575-49268597 TTAATTCTTCTTTAAATGTTAGG - Intergenic
973387873 4:49526524-49526546 TTAATTCTTCTTTAAATGTTAGG + Intergenic
973397474 4:49608150-49608172 TTAATTCTTCTTGAAATGTTTGG - Intergenic
973579512 4:52328000-52328022 TTAGTTCTTCTTTAAATGTTAGG + Intergenic
973724381 4:53759506-53759528 TTAGTTCTTCTTTAAATGTTTGG - Intronic
973845323 4:54906315-54906337 CTAATTCTTCTTTAAATGTTTGG - Intergenic
974097665 4:57382626-57382648 TGCATTCTTCATTAAAAGTGGGG - Intergenic
974161493 4:58147092-58147114 TGAATTTTTCTTTACAAGTTTGG - Intergenic
974267254 4:59601674-59601696 TTAGTTCTTCATTACATGTTTGG - Intergenic
974302821 4:60091512-60091534 TTATTTCTTCTTTTCCAGTTTGG - Intergenic
974333524 4:60510197-60510219 GTCATTCTTTTTTAAATGTTTGG - Intergenic
974822678 4:67087474-67087496 TTCATTCTGTATTTCAAGTTTGG - Intergenic
975223761 4:71845222-71845244 TTAATTCTTCTTTAAATGTTTGG + Intergenic
975282022 4:72571692-72571714 TTCATTTTGCTTTAATAGTTGGG - Intergenic
975304194 4:72829787-72829809 TTAATTCTTCTTTAAATGTCTGG - Intergenic
975347613 4:73311403-73311425 TTAATTCTTCTTAACAACTCTGG + Intergenic
975463256 4:74679483-74679505 TTAATTCTTCTTTAAATGTTGGG + Intergenic
976029728 4:80737364-80737386 TTATTTCTTCTTTAAAAGTATGG + Intronic
976044932 4:80934484-80934506 TTAATTTTTCTTTAAATGTTTGG + Intronic
976054012 4:81041800-81041822 TTCCTTCATCTTTAAAAGTCTGG + Intronic
976082482 4:81371188-81371210 TTAATTCTTCTTTAAATGTGTGG + Intergenic
976323465 4:83743988-83744010 TTAATTCTTCTTTAAATGTTTGG - Intergenic
976371766 4:84297970-84297992 TTAGTTCTTCTTTGTAAGTTTGG - Intergenic
976650857 4:87433075-87433097 TTGATTCTTCTTTAAATGTTTGG + Intronic
976866054 4:89728433-89728455 TTAATTCCTCTTTAAATGTTTGG + Intronic
976909679 4:90286212-90286234 TTTGTTCTTCTTTAAATGTTTGG + Intronic
977185867 4:93935263-93935285 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
977307761 4:95346344-95346366 TTAGTTCTTCTTTAAATGTTTGG - Intronic
977325889 4:95574152-95574174 TTTGTTCTTCTTTGAAAGTTTGG + Intergenic
977381064 4:96274272-96274294 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
977751210 4:100611895-100611917 TTAATTCTTCTTTAGATGTTTGG + Intronic
977872586 4:102110299-102110321 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
977902057 4:102433790-102433812 TTAATTATTCTTTAAATGTTTGG - Intergenic
978108572 4:104933708-104933730 TCCTTTCTTCTTTACTAGTCTGG - Intergenic
978297941 4:107230472-107230494 TTAGTTCTTCTTTAAATGTTTGG - Intronic
978406740 4:108387473-108387495 TTCATTCTTCTTTAAACACTTGG - Intergenic
978519954 4:109605096-109605118 TTAGTTCTTCTTTAAATGTTTGG + Intronic
979003963 4:115264814-115264836 TTGATTCTTCTTTAAAAATTTGG + Intergenic
979004788 4:115279687-115279709 TTACTTCTTCTTTTCCAGTTTGG - Intergenic
979015817 4:115432542-115432564 TTCATAGTTCTTGACAATTTTGG + Intergenic
979212982 4:118128764-118128786 TTAGTTCTTCTTTAAATGTTTGG + Intronic
979282935 4:118887648-118887670 TTTAATCTTATTTAAAAGTTTGG + Intronic
979405128 4:120300631-120300653 TTAATTATTCTTTAAATGTTTGG - Intergenic
979437174 4:120706982-120707004 TTAATTCTTCTTTAAATGTTTGG - Intronic
979470076 4:121085213-121085235 TTAATTCTTCTTTAAATGTTTGG - Intergenic
979496074 4:121384139-121384161 TTAATTCTTCTTTAAATGTTTGG + Intergenic
979496076 4:121384173-121384195 TTAATTCTTCTTTAAATGTTTGG + Intergenic
979746967 4:124228088-124228110 ATTAATCTTCTTTAAAAGTTTGG - Intergenic
980096841 4:128500649-128500671 TTAGTTCTTATTTAAAAGTTTGG + Intergenic
980247276 4:130264086-130264108 CTGATTCTTCTTTTAAAGTTTGG + Intergenic
980309434 4:131106556-131106578 TCCATTTTTCTTTAAAGGTTTGG - Intergenic
980339251 4:131521363-131521385 TTAATTCTTCTTCAAAAGTTTGG + Intergenic
980449512 4:132951420-132951442 TTAATTGTTCTTTAAAAGCTTGG - Intergenic
980514690 4:133840040-133840062 TCAATTCTTTTTTAAAAGTTTGG + Intergenic
980850579 4:138376032-138376054 TTAATTCTTCTTTAAATGTTTGG - Intergenic
981168283 4:141589077-141589099 CTCATGCTTCTTTAAAAATTTGG - Intergenic
981343139 4:143645906-143645928 TTAATTATTATTTACATGTTTGG + Intronic
981416260 4:144497593-144497615 TTCTTTCTCCTTTGCAAGTCGGG + Intergenic
981444112 4:144815262-144815284 TTAGTTCTTCTTTAAAAGTTTGG - Intergenic
981660857 4:147164871-147164893 TTCATCTTTATTTAGAAGTTTGG + Intergenic
981714004 4:147734620-147734642 TTAATTCTTCTTCACTGGTTAGG + Intronic
981811719 4:148783001-148783023 TTCATCCTTCATTCAAAGTTTGG - Intergenic
981813284 4:148800001-148800023 TTCTTTCTTCTTTCCAATCTTGG + Intergenic
981894280 4:149778907-149778929 TTCATTCTTCTTTAATAATGTGG - Intergenic
981939601 4:150268341-150268363 TTAATACTTCTTTAAATGTTTGG - Intronic
981951086 4:150408452-150408474 TTATTTCTTCTTTAAATGTTTGG - Intronic
981953568 4:150442624-150442646 TTCATTCTTCCCTAAAAGTAGGG + Intronic
982063852 4:151633374-151633396 TTAATTCTTCTTTACATGTTTGG - Intronic
982283495 4:153710720-153710742 TTGATTCTTGTTTTCTAGTTTGG - Intronic
982290136 4:153772424-153772446 TTAATTCTTCCTTAAATGTTTGG + Intergenic
982532252 4:156559441-156559463 TTAATTCTTCTTTAAATGTTTGG + Intergenic
982630985 4:157828756-157828778 TGAATTCCTCTTTACCAGTTTGG - Intergenic
982725273 4:158899738-158899760 TTCTTTCTTCTTTATTAGTCTGG + Intronic
982984348 4:162186763-162186785 TTCTTTCTACTTTAAGAGTTTGG + Intergenic
983369162 4:166837147-166837169 TTCATTCTTCTTTAAAGATTGGG + Intronic
983421533 4:167524719-167524741 TTAATTCTTCTTTAGTGGTTTGG + Intergenic
983599826 4:169514451-169514473 TTAATTCTTCTTTGAATGTTTGG + Intronic
983676365 4:170298724-170298746 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
983782471 4:171687812-171687834 TTCATTCTTCTTGACCAGGCTGG - Intergenic
983849724 4:172565682-172565704 TTAATTCTTCTTTTAATGTTTGG + Intronic
983876770 4:172886121-172886143 TTAGTTCTTCCTTAAAAGTTTGG + Intronic
983958517 4:173724829-173724851 TTTTTTCTTCTTTACTAGTCTGG + Intergenic
984222737 4:176997380-176997402 TTAATTCTTCTTTAAATATTTGG - Intergenic
984344691 4:178507548-178507570 TTAATTTTTCTTTAAATGTTTGG - Intergenic
984425300 4:179576946-179576968 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
984519201 4:180780780-180780802 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
984627856 4:182028047-182028069 TTACTTCTTCTTTAAATGTTTGG + Intergenic
984940256 4:184925070-184925092 ATCATTCTTCTTTTCTACTTTGG + Intergenic
985374506 4:189320958-189320980 TTAATTCTTCTTTAAATGTCTGG + Intergenic
985440064 4:189976390-189976412 TTAATTCTGCTTTAAACGTTGGG - Intergenic
1202760932 4_GL000008v2_random:109918-109940 TTAATTCTTCTTGAAATGTTTGG + Intergenic
985515405 5:341738-341760 TCCATTCTTCTGTTCAATTTGGG + Intronic
985690219 5:1305066-1305088 TTCATTCTTCTTTAAATGATTGG + Intergenic
985919057 5:2953511-2953533 TTAGTTCTTCTTTAAAAGTTTGG + Intergenic
986544282 5:8878843-8878865 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
986629793 5:9760259-9760281 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
986677941 5:10204345-10204367 TTAATTCTTCTTTAAACATTTGG - Intergenic
986872495 5:12066309-12066331 TTCCTTCTTCTTTATAAACTTGG + Intergenic
986904233 5:12473957-12473979 TTAATTCTTCTTTAAATGTTTGG - Intergenic
987569763 5:19641252-19641274 TTAATCCTTCTTTAAATGTTTGG - Intronic
987612135 5:20219389-20219411 TTAGTTCTTCTTTACATATTTGG - Intronic
987910286 5:24134775-24134797 TTAATTCTTCTTTAAATGATTGG + Intronic
987998983 5:25325824-25325846 TTGATTCTTCTCTACAATGTGGG + Intergenic
988236608 5:28553605-28553627 TTAGTTCTTCTTTATATGTTTGG + Intergenic
988313168 5:29588148-29588170 GTCATTATTCTTTTCAAATTTGG - Intergenic
988361806 5:30246012-30246034 TTAATTTTTCTTTACTATTTTGG + Intergenic
988607980 5:32697568-32697590 TTAGTTCTTCTTTAAATGTTTGG + Intronic
988753397 5:34216204-34216226 TACATTCTTCTTTAAAAATTAGG + Intergenic
988820881 5:34883819-34883841 TTAATTCTTCTTTAAATGTTTGG - Intronic
988938975 5:36121363-36121385 TTGATTCTCCTTTGCATGTTTGG - Intronic
989081456 5:37626695-37626717 TTAATTCTTCTTTAAAGGTTTGG + Intronic
989130401 5:38101344-38101366 TTCTTAATTCTTTACAAATTGGG + Intergenic
989139231 5:38186426-38186448 TTAATTCTTCTTTGAATGTTTGG - Intergenic
989440692 5:41469439-41469461 TTAGTTCTTCTTTAAATGTTTGG + Intronic
989504494 5:42211400-42211422 TTAATTCTTCTTTAAATATTTGG + Intergenic
989663716 5:43826498-43826520 TTAATTCTTCTTTATAAGTGTGG + Intergenic
989672948 5:43940508-43940530 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
989971424 5:50529454-50529476 GTAATTCTTCCTTTCAAGTTTGG + Intergenic
990162004 5:52951460-52951482 TTCATTATGCTTTGCAATTTGGG - Intronic
990223659 5:53624777-53624799 ATTATACATCTTTACAAGTTTGG + Intronic
990846936 5:60152330-60152352 TTAATTCTTCTTTAAATGTTTGG + Intronic
991310299 5:65232761-65232783 TTAATTCTTCTTTAAATGTTTGG - Intronic
991549137 5:67817529-67817551 TTGGTTTTTCTTTAGAAGTTTGG - Intergenic
991584171 5:68185987-68186009 TTTCTTATTCTTTACATGTTGGG + Intergenic
991681416 5:69143578-69143600 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
991741180 5:69677050-69677072 TACATTCTTCTTTAAAAATTAGG + Intergenic
991756438 5:69877392-69877414 TACATTCTTCTTTAAAAATTAGG - Intergenic
991792754 5:70256787-70256809 TACATTCTTCTTTAAAAATTAGG + Intergenic
991820640 5:70553123-70553145 TACATTCTTCTTTAAAAATTAGG + Intergenic
991835840 5:70753305-70753327 TACATTCTTCTTTAAAAATTAGG - Intergenic
991885204 5:71257095-71257117 TACATTCTTCTTTAAAAATTAGG + Intergenic
991922964 5:71675532-71675554 TTCACGCTTCTTTAAATGTTTGG + Intergenic
992248015 5:74847773-74847795 TTCATTCTCTTTTTCAAGTAAGG + Intronic
992251424 5:74879649-74879671 TTAATTCCTCTTTAAAGGTTTGG + Intergenic
992296108 5:75328283-75328305 TTCATTCTTCTTTTCAAGAAGGG - Intergenic
992344099 5:75858679-75858701 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
992406684 5:76464985-76465007 TTAATTCTTCTTTAAACATTTGG - Intronic
992474996 5:77093160-77093182 TTAATTTTTCTTTAAATGTTTGG + Intergenic
992516232 5:77495681-77495703 TTAATTCTTCTTTAAATGTTTGG - Intronic
992579121 5:78152256-78152278 TTAGTTCTTCTTTAAATGTTTGG + Intronic
992587545 5:78256583-78256605 TTAATTCTTCTTTAAATGTTTGG - Intronic
992739575 5:79759736-79759758 TTCATTCCTGATTACAAATTGGG - Intronic
992824418 5:80534171-80534193 TTAGTTCTTCTTTAAATGTTTGG - Intronic
992945612 5:81806531-81806553 TTAATTCTTCTTTAAAGGTTTGG - Intergenic
992984028 5:82209079-82209101 TTATTTCTTCTTTAAATGTTTGG + Intronic
993113851 5:83694829-83694851 TTATTTCTTCTTTAAATGTTTGG - Intronic
993118467 5:83745893-83745915 TTAATTCTTCTTCACATGTTTGG + Intergenic
993170942 5:84418249-84418271 TTAATTCTTCTTTAAATGTTTGG + Intergenic
993268882 5:85767343-85767365 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
993474111 5:88343730-88343752 TTAATTCTTCTTTAAATGTTTGG + Intergenic
993545572 5:89208346-89208368 TTCATTCATTTTTTCAAGCTTGG - Intergenic
993644504 5:90445752-90445774 TTAATTCTTCTTTAAATGTTTGG - Intergenic
993869207 5:93231506-93231528 TTAATTCTTCTTTAGAAGTTTGG - Intergenic
993918363 5:93769687-93769709 TTCATTCTTTTTTAAAATTATGG + Intronic
994457566 5:100031450-100031472 TTAATTCTTCTTCAAATGTTTGG - Intergenic
994500110 5:100564937-100564959 TTAATTCTTCTTTAAATGTCTGG - Intronic
994530280 5:100960463-100960485 TTATTTCTTCTTTAGATGTTTGG - Intergenic
994654327 5:102571174-102571196 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
994854115 5:105094913-105094935 TTAATTTTTCTTTAAATGTTTGG - Intergenic
995258863 5:110077923-110077945 TTAATTCTTCTTTAAATGTTTGG + Intergenic
995268808 5:110196871-110196893 TTAATTCTTCTTTAAAAGTTTGG - Intergenic
995278266 5:110303402-110303424 TTAATTCTTCTTTAAATGTTTGG + Intronic
995523521 5:113032376-113032398 TTCATTCTTGTTTCCCAGGTTGG - Intronic
995826995 5:116311660-116311682 TTGGTTCTTCTTTAAATGTTTGG + Intronic
995840091 5:116435891-116435913 TTTATTCTTCTTTAAAAGGTGGG + Intergenic
996136483 5:119848485-119848507 TTCATTCTTCATTAAATGTTTGG - Intergenic
996143657 5:119946721-119946743 TTAGTTCTTCTTTACAAGTTTGG - Intergenic
996223102 5:120956711-120956733 TTAATTCTTCTTTATAAGCTTGG + Intergenic
996445377 5:123543075-123543097 TTGATGCTGCTTTACATGTTTGG + Intronic
996451870 5:123634869-123634891 TTTGTTCTTCTTTAAATGTTTGG - Intergenic
996597128 5:125217961-125217983 TTACTTCTTCTTTTCTAGTTTGG - Intergenic
996659558 5:125985048-125985070 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
996722373 5:126642526-126642548 TAAATTCTTCTTTAAATGTTTGG + Intergenic
996828773 5:127716465-127716487 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
996890850 5:128417904-128417926 TTAGTTCTTCTTTATAATTTTGG + Intronic
996906144 5:128602689-128602711 TTAAGTCTTCTTTAAATGTTTGG + Intronic
996910570 5:128652852-128652874 TTTTTTCTTCTTTACTAGTCTGG + Intronic
997085349 5:130790738-130790760 TTAATTCTTCTTTTCCAATTTGG - Intergenic
997155965 5:131558067-131558089 TTATTTCTTCTTTAAATGTTTGG + Intronic
997860966 5:137415512-137415534 TTCATTCTTCTTCACAATGGAGG - Intronic
998281477 5:140812089-140812111 TTGATTCTTCTTTAAAAGTTTGG + Intronic
998290881 5:140913163-140913185 TTAGTTCTTCTTTAAATGTTTGG + Intronic
998309737 5:141116666-141116688 TTAATTCTTCTTTAAACATTTGG - Intronic
998356282 5:141539346-141539368 TTAATTCTTCATTAAATGTTGGG + Intronic
998650228 5:144111078-144111100 GACATTCTTCTTTTCAACTTGGG - Intergenic
998723459 5:144980413-144980435 TTAATTATTCTTTAAAAATTTGG - Intergenic
998913531 5:146989165-146989187 TTTGTTCTTCTTTAAATGTTTGG - Intronic
998929219 5:147162131-147162153 TTCTTTAATCTTCACAAGTTAGG - Intergenic
999006770 5:147989339-147989361 TTAATTCTTCTTCAAATGTTTGG + Intergenic
999025275 5:148222656-148222678 TTAATTCTTCTTTAAATGTTTGG + Intergenic
999028906 5:148268060-148268082 TTCCTTCTTTCTTCCAAGTTGGG - Intergenic
999073870 5:148776750-148776772 TTTAGTCTTATTTAGAAGTTTGG - Intergenic
999235422 5:150088346-150088368 TTAATTCTTCTTTAAATGTTTGG - Intronic
999345410 5:150814588-150814610 TTCATTCTTCTGCAAATGTTAGG - Intergenic
999354542 5:150913031-150913053 TTATTTCTTCCTTACATGTTTGG - Intergenic
1000032301 5:157413799-157413821 TTAAATCTTCTTTGTAAGTTTGG - Intronic
1000034451 5:157433959-157433981 TTAATTATTCTTTAAATGTTTGG - Intronic
1000392323 5:160736825-160736847 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1000417803 5:161001917-161001939 TCAGTTCTTCTTTAAAAGTTTGG + Intergenic
1000466847 5:161589613-161589635 TTCATTCTTCTTCACACAGTTGG + Intronic
1000516218 5:162238701-162238723 TTCAGCCTTCTTGACAAATTTGG - Intergenic
1000674819 5:164107638-164107660 TTTCTTTTTCTTTACAAGTCAGG + Intergenic
1000827301 5:166060917-166060939 TTCAGTGTTCTTTAGAAATTTGG - Intergenic
1001351502 5:170971630-170971652 GTCATTCTTCTTTAAAATATGGG - Intronic
1001356577 5:171031536-171031558 TTCATTCTCCCTTTCCAGTTAGG + Intronic
1001364022 5:171119443-171119465 TTCATTCTTCCTTAAAGATTTGG + Intronic
1001687971 5:173609666-173609688 TTGATTCTTTTGTACAAGGTTGG - Intronic
1001792944 5:174476153-174476175 TTAATTCTTCTTTAAATATTTGG - Intergenic
1001800167 5:174536253-174536275 CTAATTCTTCTTTAAATGTTTGG - Intergenic
1001846380 5:174925263-174925285 TACATTCTTTTTGACACGTTAGG - Intergenic
1002003277 5:176211175-176211197 TTAATTCCTCTTTACATGTTTGG + Intergenic
1002223175 5:177699769-177699791 TTAATTCCTCTTTACATGTTTGG - Intergenic
1002397911 5:178972364-178972386 GTCATTTTTCTTTCCAATTTGGG + Intergenic
1002646739 5:180660663-180660685 TTAATTCTTCTGTAAATGTTTGG + Intergenic
1002680460 5:180959100-180959122 TTAATTCTTCTTTTAAAGTTTGG + Intergenic
1002936565 6:1678525-1678547 TTCCTTGCTCCTTACAAGTTGGG + Intronic
1002938239 6:1692899-1692921 TTCCTGCTTCTTTGCAAGCTTGG + Intronic
1003834329 6:10052642-10052664 TTAATTTTTCTTTAAATGTTTGG - Intronic
1003983643 6:11413738-11413760 GGCATTCTTCTTTAAATGTTTGG + Intergenic
1004213370 6:13676369-13676391 TTATTTCTTCCTTACATGTTTGG - Intronic
1004764222 6:18706999-18707021 TTAGTTCTTCTTTAAAAGTTTGG + Intergenic
1005036991 6:21565034-21565056 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1005193974 6:23260692-23260714 TTAATTCTTTTTTACATGTCTGG + Intergenic
1005438908 6:25843979-25844001 TTTATTCTTTTGTGCAAGTTGGG + Intronic
1005551566 6:26923025-26923047 TACATTCTTCTTTAAAAATTAGG + Intergenic
1005619643 6:27608039-27608061 CTAATCTTTCTTTACAAGTTAGG + Intergenic
1005698456 6:28374562-28374584 CTAATTCTTCTTCACATGTTTGG + Intergenic
1005907960 6:30281753-30281775 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1006261388 6:32875044-32875066 TTAATTCTTCTTTAAATCTTTGG - Intergenic
1006462185 6:34167388-34167410 TTCATTCTTCTTTAAGTCTTTGG + Intergenic
1006477349 6:34265324-34265346 TTAATTCTCCTTTAGATGTTTGG - Intergenic
1006553718 6:34847383-34847405 TTAGTTCTTCTTTAAATGTTCGG + Intronic
1006822361 6:36907484-36907506 TCCACCCTTCTTTACAAGTTGGG - Intronic
1007145949 6:39631840-39631862 TTAATTCTTCTTTAAATATTTGG + Intronic
1007361780 6:41362536-41362558 TTAATTCCTTTTTAAAAGTTTGG - Intergenic
1007624806 6:43239161-43239183 TTCATTGTTGTTTACAATTCTGG - Intergenic
1007695617 6:43732178-43732200 TCAATTTTTCTTTACATGTTAGG - Intergenic
1007921317 6:45612098-45612120 TTCACTCTTGTTTACTTGTTAGG + Intronic
1007951389 6:45875665-45875687 TTAATTCTGCTTTACAAATGAGG + Intergenic
1008067682 6:47067409-47067431 TTAATTGTTCTTTAAATGTTTGG - Intergenic
1008108761 6:47469563-47469585 TTCGTTCTTCTTTAAATATTTGG - Intergenic
1008223062 6:48877629-48877651 TTAATTCTTCTATATAATTTTGG - Intergenic
1008275721 6:49541935-49541957 TTCATTGTTCTTTAGAATTGTGG - Intergenic
1008457033 6:51722962-51722984 TTCATTTTTGTTTTCAAATTAGG + Intronic
1008702383 6:54116656-54116678 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1008847848 6:55989816-55989838 TTCGTTCTTCTTCAAATGTTTGG + Intergenic
1008863068 6:56174723-56174745 TTAATTCTTCTTTAAATGTCTGG - Intronic
1009058682 6:58371442-58371464 TTGCTTCCTCTTTAAAAGTTTGG - Intergenic
1009232155 6:61075678-61075700 TTGCTTCCTCTTTAAAAGTTTGG + Intergenic
1009282154 6:61766055-61766077 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1009318418 6:62253988-62254010 TTCAGTCTTTGTTAAAAGTTAGG - Intronic
1009329381 6:62397429-62397451 TTAGTTCTTCTTTATATGTTTGG + Intergenic
1009541488 6:64965524-64965546 TTCATTCTTCATTATAAATGAGG + Intronic
1009575661 6:65455814-65455836 TTAATTCTTCTTTAAATTTTTGG - Intronic
1009774780 6:68192772-68192794 TTAATCCTACTTTACAAATTAGG - Intergenic
1009783805 6:68304542-68304564 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1009897161 6:69766052-69766074 ATAATTCTTCTTTTCCAGTTTGG + Intronic
1010061831 6:71631796-71631818 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1010231077 6:73535941-73535963 GTCTTTCTTCTTTTCTAGTTTGG + Intergenic
1010306611 6:74331256-74331278 TTAGTTCTTCTTTACATATTTGG + Intergenic
1010318904 6:74484155-74484177 TACTTTCTTCCTTAAAAGTTTGG + Intergenic
1010365453 6:75045835-75045857 TTAATTCTTCCTTAAATGTTTGG - Intergenic
1010539853 6:77079192-77079214 TTAATTCTCCTTTAAATGTTTGG - Intergenic
1010566743 6:77424684-77424706 TTAAATCTTATTTCCAAGTTTGG + Intergenic
1010638780 6:78295621-78295643 TTATTTCTTCTTTACATGTTTGG - Intergenic
1010692667 6:78929089-78929111 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1010837168 6:80603136-80603158 TTAATTCTTTTTTAAATGTTCGG + Intergenic
1010888243 6:81270667-81270689 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1010957724 6:82109387-82109409 TTAGTTCTCCTTTATAAGTTTGG - Intergenic
1011033523 6:82948427-82948449 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1011404515 6:87004171-87004193 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1011447367 6:87455921-87455943 TTCATCCTTCTTTAAATGTTTGG - Intronic
1011586982 6:88936832-88936854 TTAGTTCTTCCTTAAAAGTTTGG + Intronic
1011682463 6:89796515-89796537 TTAATTCTTCTTTTAATGTTTGG - Intronic
1011901709 6:92306531-92306553 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1011908718 6:92408117-92408139 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1011946952 6:92916995-92917017 TTAATTATTCTTTAGAAGTAGGG - Intergenic
1012003839 6:93687564-93687586 TTAGTTCCTCTTTACATGTTTGG - Intergenic
1012005924 6:93712952-93712974 TTACTTCTTCTTTTCAGGTTTGG + Intergenic
1012077908 6:94716753-94716775 TTAATTCTTTTTTAAATGTTTGG - Intergenic
1012197660 6:96364104-96364126 TTAGTTATTCTTTAAAAGTTTGG - Intergenic
1012256957 6:97044581-97044603 TTCTTTCTTCTTTAAATGTTTGG + Intronic
1012383393 6:98647906-98647928 TGCATTCTTCTTCTCAAGTATGG + Intergenic
1012485545 6:99717942-99717964 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1012512463 6:100019260-100019282 TTAGTTCTTCTTTAAATGTTGGG - Intergenic
1012619563 6:101324642-101324664 TTCTTTCTTCCTTTCCAGTTTGG + Intergenic
1012653506 6:101786894-101786916 TTAATTATTTTTTAAAAGTTAGG + Intronic
1012717498 6:102695098-102695120 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1012821120 6:104085598-104085620 TTCATTCCTCTTTAAATGATTGG + Intergenic
1012845984 6:104389324-104389346 TTAATTCTTCTTTGAATGTTTGG - Intergenic
1012892608 6:104913710-104913732 TTCGTTCTTCTTTAAATGTTTGG - Intergenic
1013319935 6:108977886-108977908 TTTATTCTTCTTTATTAGTCTGG + Intergenic
1013609256 6:111778798-111778820 TACTTTCTTTTTAACAAGTTGGG + Intronic
1013702607 6:112791542-112791564 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1013885102 6:114954306-114954328 TTCGTTTTTCTTTAGAAGGTTGG + Intergenic
1014044970 6:116875289-116875311 TTTATTCTTCTTTAAACGTTTGG + Intergenic
1014118762 6:117698584-117698606 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1014228057 6:118871015-118871037 TTAATTCTTCTTTATATGTTTGG - Intronic
1014353213 6:120370130-120370152 TTAATTCTTCTTTAAAACTTTGG - Intergenic
1014481261 6:121939939-121939961 TTAATTTTTCTTTAAATGTTTGG + Intergenic
1014537760 6:122636095-122636117 ATCATTCTATTTTACAAATTAGG + Intronic
1014542047 6:122688530-122688552 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1014692802 6:124582523-124582545 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1014716939 6:124877204-124877226 TTCATTCTTCTTTAAATGTTTGG + Intergenic
1014928795 6:127308056-127308078 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1014932729 6:127353169-127353191 TTAATTCTTCTTTAAGTGTTTGG - Intergenic
1014950693 6:127551478-127551500 TTTGTTCTTCTTTAAAAGTTTGG - Intronic
1014966039 6:127752739-127752761 TTCATTTTTCTTTAAATGTTTGG - Intronic
1015018370 6:128441937-128441959 TTGATTGTTATTTACATGTTGGG - Intronic
1015171157 6:130254834-130254856 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1015800339 6:137054375-137054397 GTCATTCCTCTTTAAATGTTTGG - Intergenic
1015808492 6:137137298-137137320 TTCATTCTTCTTTGAGAGTTTGG - Intergenic
1015889037 6:137950899-137950921 GTCCTTCTTCTTGACAAGGTGGG - Intergenic
1015959782 6:138635586-138635608 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1016116607 6:140293365-140293387 TTAATTCTTGTTTATATGTTTGG - Intergenic
1016161611 6:140887771-140887793 TTGTTTCTTCATTACATGTTTGG + Intergenic
1016230108 6:141793077-141793099 TTAACTCTTCTTTAAATGTTTGG - Intergenic
1016251844 6:142052539-142052561 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1016257736 6:142128932-142128954 TTCATTCTTCTTTGAATGTTTGG + Intergenic
1016351187 6:143170165-143170187 TTAGTTCTTCTTTGTAAGTTTGG + Intronic
1016972985 6:149782409-149782431 CACATTTTTCTTTACAGGTTTGG - Intronic
1017242956 6:152191359-152191381 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1017271488 6:152512699-152512721 AACATTTTTCTTCACAAGTTAGG - Intronic
1017397858 6:154024118-154024140 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1017739035 6:157389005-157389027 TTTATTTTTCTTTACAAATATGG + Intronic
1017829272 6:158110945-158110967 TTCATTCTTCTCTCCATTTTAGG + Exonic
1017998089 6:159551668-159551690 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1018074055 6:160194721-160194743 TTAATTCTTCTTTAAAGATTGGG - Intronic
1018316991 6:162566697-162566719 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1018895082 6:168009651-168009673 TTAATTATTCTTTAAAGGTTTGG + Intronic
1019855391 7:3601294-3601316 TTGATTCTTCTTTAAATGTTTGG + Intronic
1020574396 7:9907252-9907274 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1020580661 7:9995835-9995857 TTCATTTTTTTTTTCAATTTTGG - Intergenic
1020733918 7:11921563-11921585 TTCATTCTTCTTTAAATATTTGG - Intergenic
1020824148 7:13005968-13005990 TTAATTCTTCTTTAAGTGTTTGG + Intergenic
1020906639 7:14071532-14071554 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1020940933 7:14536214-14536236 TTAATTCTTTTTTAAATGTTTGG - Intronic
1020948582 7:14647396-14647418 TTCGTTTGTCTTTAAAAGTTTGG - Intronic
1021145344 7:17081374-17081396 TTAAATTTTCTTTAAAAGTTTGG + Intergenic
1021309522 7:19076181-19076203 TTAGTTCTTCTTTATAAGTTTGG - Intronic
1021529279 7:21625112-21625134 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1021557534 7:21936243-21936265 TTTGTTCTTCTTTAAATGTTTGG - Intronic
1021749045 7:23776706-23776728 TTGATTCTTCTTTATTAGTCTGG + Intronic
1021750840 7:23797865-23797887 TTGATTCTTCTTTATTAGTCTGG - Intronic
1021764694 7:23936065-23936087 TTAATTCTTCTTTAAAGATTTGG + Intergenic
1021843045 7:24737562-24737584 TTCATTCTTTTTTAAATGTTTGG - Intronic
1022054916 7:26720490-26720512 TTCATTTTTTTTTATAACTTCGG + Intronic
1022080631 7:27017264-27017286 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1022870062 7:34468290-34468312 TTATTTCTTCTTTATAAGTTTGG + Intergenic
1022883461 7:34616428-34616450 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1022986077 7:35655157-35655179 TTAATTCTTCTTTATAAGATTGG - Intronic
1023208623 7:37778306-37778328 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1023272988 7:38486499-38486521 TTAATTCTTTTTTAAATGTTTGG - Intronic
1023853816 7:44168029-44168051 TTAATTCTTCTTTAAATGGTTGG - Intronic
1023878136 7:44302314-44302336 TGATTTCTTCTTTACATGTTTGG - Intronic
1023880390 7:44316592-44316614 TTAATTCTTCTTTAAATGTTTGG + Intronic
1023896153 7:44434528-44434550 TTCATGCTTCTTTACTAGCAGGG + Intronic
1024032663 7:45477147-45477169 TTATTTCTTCTTTAAATGTTTGG - Intergenic
1024110352 7:46139762-46139784 TTAATTCTTCTTTAAAACTTTGG + Intergenic
1024178585 7:46864752-46864774 TTGGTTCTTCTTTACATTTTTGG - Intergenic
1024227848 7:47341318-47341340 TTAATTCTTCTTTACATGTTTGG + Intronic
1024411127 7:49043102-49043124 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1024450541 7:49536991-49537013 TTCATTCTTCTGTAAGGGTTTGG - Intergenic
1024484156 7:49897235-49897257 TTAATTCTTCTTTCAATGTTTGG - Intronic
1024909657 7:54431237-54431259 TTATTTCTTCTTTACACATTTGG - Intergenic
1024917498 7:54518160-54518182 TTAATTCATCTTTACATATTTGG + Intergenic
1026358325 7:69579549-69579571 CTCATTCCCCTTTACAGGTTGGG - Intergenic
1026485373 7:70815055-70815077 TTAATTCTTCGTTAAATGTTTGG - Intergenic
1026860265 7:73782177-73782199 TTAATTCTTCTTTAAACGTTTGG + Intergenic
1026887304 7:73959387-73959409 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1027511281 7:79083745-79083767 TTAATTCTTCTTTAAAAGCTTGG + Intronic
1027569252 7:79843030-79843052 ATAATTCTTCCTTGCAAGTTAGG - Intergenic
1027628451 7:80573131-80573153 TTAGTTCTTCTTTACAAGTTTGG + Intronic
1028097770 7:86783607-86783629 AACATTCTTCTTTACAAATAAGG + Intronic
1028186573 7:87793260-87793282 TTACTTCTTCTTTAAATGTTTGG - Intronic
1028522822 7:91751156-91751178 TTTGTTATTCTTTAAAAGTTTGG - Intronic
1028560644 7:92171587-92171609 TTAATTCTTTTTTAAATGTTTGG - Intronic
1028626589 7:92884412-92884434 TTAGTTCTTCTTTGAAAGTTTGG - Intergenic
1028811700 7:95095110-95095132 TTCATACTTCTGGACCAGTTAGG - Intronic
1029796789 7:102904072-102904094 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1029901259 7:104042389-104042411 TTAATTCTTTTTTAAATGTTTGG + Intergenic
1029921254 7:104266787-104266809 TTCAAAGTTCTTTACATGTTGGG + Intergenic
1029925722 7:104314398-104314420 TTAATTCTTCTTTAAATATTTGG - Intergenic
1030479061 7:110079281-110079303 TTAATTCTTCCTTTCCAGTTTGG + Intergenic
1030604797 7:111628778-111628800 TTAGTTCTTCTTTATAAGTTTGG + Intergenic
1030626329 7:111849613-111849635 TCCATTCATCTTCACAAGTAAGG + Intronic
1030697572 7:112603009-112603031 ATAATTCTTCTTTAAATGTTTGG + Intergenic
1030748259 7:113195789-113195811 TTACTTCTTCTTTAAATGTTTGG + Intergenic
1030752840 7:113252086-113252108 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1030799582 7:113833285-113833307 TTCATTTTTGAATACAAGTTTGG - Intergenic
1030990667 7:116295838-116295860 TTATTTCTTCTTTAAATGTTTGG - Intronic
1031064243 7:117087477-117087499 TACATACATCTTTAAAAGTTTGG + Intronic
1031098815 7:117452870-117452892 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1031465712 7:122108236-122108258 TTAAATCTTCTTTAAATGTTTGG - Intronic
1031489918 7:122373812-122373834 TTAATTCTTCTTTAAATGTTTGG - Intronic
1031782927 7:125992568-125992590 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1031906059 7:127460739-127460761 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1032138334 7:129302930-129302952 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1032314786 7:130826248-130826270 TTAATTTTTCTTTAAATGTTTGG + Intergenic
1032773629 7:135086925-135086947 TTTGTTCTTCTTTAAATGTTTGG + Intronic
1032901506 7:136314844-136314866 TAAATTTTTCTTTACATGTTTGG + Intergenic
1032939514 7:136772510-136772532 TTAGTTCTTCTTTAAACGTTTGG - Intergenic
1032961052 7:137034784-137034806 TTCCTTCTTTTTTAAATGTTTGG - Intergenic
1033004764 7:137549441-137549463 TTAATTCATCTTTAAAAATTAGG - Intronic
1033081216 7:138299687-138299709 TTAATTTTTCTTTCAAAGTTTGG + Intergenic
1033110425 7:138569304-138569326 TTCATTCATGTTTACATTTTTGG - Intronic
1033488824 7:141820502-141820524 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1033930362 7:146511854-146511876 TTGGTTCTTCTTTAAAAATTTGG + Intronic
1034246951 7:149652292-149652314 TTAATTCTTCTTTAAATGTTAGG - Intergenic
1035348290 7:158223238-158223260 TTAATTCCTCTTTAAATGTTTGG - Intronic
1035487658 7:159239571-159239593 TTATGTCTTCTTTACATGTTTGG - Intergenic
1035656516 8:1311343-1311365 TTAATTCATCTTTACCTGTTTGG - Intergenic
1035840067 8:2801842-2801864 TTCTCTTTTCTTTACAATTTTGG + Intergenic
1035992933 8:4511922-4511944 TTCATTCTTCCTAACAAGATAGG + Intronic
1036190830 8:6669359-6669381 TTTATTTTTCTTTACAGCTTTGG - Intergenic
1036744681 8:11397674-11397696 TTCATTTTTGTTTACAAATCAGG + Intronic
1036913570 8:12782423-12782445 CTCATTCTTCTTTAAATGTTTGG + Intergenic
1036920674 8:12851560-12851582 TTCATTCTTCTTTATAACAGAGG - Intergenic
1036969358 8:13337358-13337380 TTCATCCTTAATTACAAATTAGG - Intronic
1037000418 8:13710767-13710789 TTAGTTCTTCTTTAAATGTTGGG + Intergenic
1037079241 8:14762975-14762997 TTAATTCTGCTTTATAAGTCAGG - Intronic
1037119823 8:15269400-15269422 TTAATTCCTCTTTAAATGTTTGG - Intergenic
1037133272 8:15432186-15432208 TTCATTCTTCTATAACTGTTTGG + Intronic
1037255793 8:16951646-16951668 TTACTTCTTCTTTAAATGTTTGG - Intergenic
1037353807 8:17995992-17996014 TTGATTCTTCCTTTCCAGTTTGG + Intronic
1037375935 8:18228194-18228216 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1037453110 8:19036870-19036892 TTCATCCTTCTTCACATCTTTGG - Intronic
1037601493 8:20399607-20399629 TTAATTCTTCTTTAAATGCTTGG - Intergenic
1037939010 8:22936519-22936541 TTCATTCTTCTTTAAATGTTTGG - Intronic
1038905327 8:31895750-31895772 TTCTTCCTTCTTTTCAATTTTGG + Intronic
1038928734 8:32169678-32169700 TTCATTCTTAGTTCCAACTTTGG - Intronic
1039160994 8:34619753-34619775 TTAATTCTTCTTTAAATGCTTGG + Intergenic
1039281583 8:35990927-35990949 TTGATTCTTCTTTAAATATTCGG + Intergenic
1039368806 8:36963288-36963310 TTAATTCTTCCTTAAATGTTTGG + Intergenic
1039448507 8:37651599-37651621 CTCTTTCTTGTTTTCAAGTTGGG - Intergenic
1039629547 8:39094500-39094522 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1039646970 8:39296857-39296879 TGAATTTTTCTTTAAAAGTTTGG + Intergenic
1040442908 8:47463437-47463459 TTAATTCTTCTTTAAATGTTTGG - Intronic
1040536000 8:48310532-48310554 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1040583680 8:48719332-48719354 TTCATTCTTCTTAGTATGTTGGG - Intronic
1040895092 8:52358775-52358797 TTAATTCTTCTTTAAATGTTTGG - Intronic
1040944649 8:52871387-52871409 TTAATTCTTCTTTAGATTTTTGG + Intergenic
1041027447 8:53701551-53701573 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1041090363 8:54296284-54296306 TGCTTTATTCTTTACAAGTTGGG - Intergenic
1041294690 8:56343116-56343138 TTAGTCCTTCTTTATAAGTTTGG - Intergenic
1041305896 8:56459520-56459542 TTAATTCTTCTTTAAAGGTTTGG + Intergenic
1041336523 8:56790725-56790747 TTTGTTTTTCTTTACATGTTTGG - Intergenic
1041404031 8:57477268-57477290 TCAATTCTTCTTTAAATGTTTGG + Intergenic
1041484767 8:58363018-58363040 TTTATTTTTCTTTAAATGTTTGG - Intergenic
1041521208 8:58758034-58758056 TTCACTCTTGTTTAGAAATTAGG - Intergenic
1041563813 8:59252013-59252035 TTAGGTCTTCTTTGCAAGTTTGG + Intergenic
1041959015 8:63590454-63590476 TTCATTCTTCTTTAAATATTTGG + Intergenic
1042323313 8:67501815-67501837 TTAATTCTTCTTTAAACATTTGG + Intronic
1042377375 8:68068267-68068289 TTAATTCTTCTTTAAATATTTGG + Intronic
1042410015 8:68454341-68454363 TTAATTCTTCTTTAAATGCTGGG + Intronic
1043233183 8:77828929-77828951 TTCATTATTCTTTATAAGTTTGG + Intergenic
1043317754 8:78942308-78942330 TTCATCTTTATTTAAAAGTTGGG + Intergenic
1043422805 8:80116558-80116580 TTCATTCTTCTTTAAATATTTGG - Intronic
1043567662 8:81566230-81566252 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1043600567 8:81932406-81932428 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1043750117 8:83924329-83924351 TTATTTCTTCTTTAAATGTTTGG + Intergenic
1043945599 8:86248353-86248375 TTAATTCTTCTTTAAATGTTTGG + Intronic
1043998367 8:86847299-86847321 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1044218466 8:89641490-89641512 TTAGTTCTTCTTTAAAAGTTTGG - Intergenic
1044308952 8:90670579-90670601 TTCCTTCTTCTCTCTAAGTTCGG - Intronic
1044620122 8:94182191-94182213 TTAATTCTTCTTTACATGTTAGG - Intronic
1044765183 8:95564508-95564530 TTAGTTCTTCTTTAAATGTTCGG - Intergenic
1045415693 8:101964771-101964793 ATCATTCTTCTTTCAAAATTAGG - Intronic
1045590355 8:103587269-103587291 TCCACTCTTCTTTAAATGTTTGG - Intronic
1045728044 8:105199148-105199170 ATAATTCTTCCTTACATGTTGGG + Intronic
1045731769 8:105250137-105250159 TTTATTCTTCATTAAAAGTTTGG + Intronic
1045991110 8:108309563-108309585 TTAATTCTTATTTAAATGTTTGG - Intronic
1046113850 8:109761354-109761376 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1046318677 8:112541665-112541687 TTAATTCTTATTTAAACGTTTGG - Intronic
1046665167 8:116994110-116994132 TTATTTCTTCTTTAAAATTTTGG - Intronic
1046884541 8:119350691-119350713 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1047089989 8:121563329-121563351 TTAATTCTTCTTTGAATGTTTGG - Intergenic
1047151116 8:122264271-122264293 TTCATGTTTCTTTAGAAGTTTGG - Intergenic
1047352090 8:124084834-124084856 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1047388805 8:124433017-124433039 TTATTTCTTCTTTAAATGTTTGG - Intergenic
1047564541 8:126028271-126028293 GTAATTTTTCTTTACATGTTTGG - Intergenic
1047565899 8:126043202-126043224 TTCATCCTTGATTATAAGTTTGG - Intergenic
1047817997 8:128485972-128485994 TTCTTTCCTCTTTTCAACTTAGG - Intergenic
1047837870 8:128714331-128714353 TCCATTGTTTTTTACATGTTCGG - Intergenic
1047936260 8:129782772-129782794 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1048102771 8:131372592-131372614 TTAATTCTTCTTTCAATGTTTGG - Intergenic
1048187753 8:132259070-132259092 TTGATTCTTCTTTTAATGTTTGG - Intronic
1048400370 8:134061433-134061455 TGGATTCTTCTTTAAATGTTTGG - Intergenic
1048464036 8:134648701-134648723 TTAATTCTTCTTTAAACATTTGG - Intronic
1049695063 8:143979497-143979519 CTCATTCTTCATTACTAGTTTGG - Intronic
1049877054 8:145030992-145031014 TCCATTCTTCTATATAATTTTGG - Intergenic
1050356435 9:4787835-4787857 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1050409112 9:5343132-5343154 TTAATTCTTCTTTGAAAGTTTGG - Intergenic
1050841920 9:10160411-10160433 TTCATTCTTCTTGAAAGGTTGGG - Intronic
1050862846 9:10458117-10458139 TTAATTTTTATTTAAAAGTTTGG - Intronic
1050908159 9:11030791-11030813 TTCATTCTTTTCTAAATGTTTGG + Intergenic
1051047550 9:12893108-12893130 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1051111333 9:13640621-13640643 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1051131869 9:13871153-13871175 TTAGTTCTTCTTTAAAAGTTTGG + Intergenic
1051197660 9:14580726-14580748 GGTATTCTTCTTTGCAAGTTTGG - Intergenic
1051245400 9:15105610-15105632 TGAATTCTTCTTTAAATGTTTGG - Intergenic
1051324791 9:15953752-15953774 TTAATTCTTCTTTAAATGTTTGG + Intronic
1051443125 9:17108826-17108848 TTAATTTTTCTTTACATGGTTGG + Intergenic
1051558898 9:18417787-18417809 TTATTTCTTCTTTAAATGTTTGG - Intergenic
1051795043 9:20858169-20858191 TTAGTTCTTCTTTAAATGTTTGG + Intronic
1052267654 9:26592490-26592512 TTAATTCTTCCTTAAATGTTTGG + Intergenic
1052360914 9:27555968-27555990 ATCATTTTTTTTTTCAAGTTGGG + Intronic
1052523418 9:29580865-29580887 TTAATTCTTCTTTAAATGTATGG - Intergenic
1052547708 9:29901675-29901697 TTCATTCTTCCTTAAATGTTTGG - Intergenic
1052573565 9:30262506-30262528 TTAATTCTTTTTTAAATGTTTGG + Intergenic
1052636382 9:31111287-31111309 CTCATACTTCTTTTCAAATTAGG + Intergenic
1052686230 9:31760507-31760529 TTAATTTTTCTTTACAAGTTTGG + Intergenic
1052698617 9:31910802-31910824 TTCATTCTTCTTTTCAAGCGTGG + Intergenic
1053028471 9:34752599-34752621 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1053397979 9:37791814-37791836 TTGATTCTTATTTAAATGTTTGG - Intronic
1053520930 9:38778813-38778835 TTAATTTTTCTTTAAATGTTTGG - Intergenic
1053582613 9:39422456-39422478 TTAATTCTTCTTTAAATATTTGG + Intergenic
1053620691 9:39811372-39811394 TTAATTCTTCTTTAAACATTTGG + Intergenic
1053752525 9:41270998-41271020 TTAATTCTTCTTTAAATGTTAGG - Intergenic
1053846794 9:42247299-42247321 TTAATTCTTCTTTAAATATTTGG + Intergenic
1053893811 9:42723708-42723730 TTAATTCTTCTTTAAACATTTGG - Intergenic
1054104191 9:60981197-60981219 TTAATTCTTCTTTAAATATTTGG + Intergenic
1054193086 9:62002806-62002828 TTAATTTTTCTTTAAATGTTTGG - Intergenic
1054258052 9:62835330-62835352 TTAATTCTTCTTTAAATGTTAGG - Intergenic
1054351759 9:64023459-64023481 TTAATTCTTCTTTAAATGTTAGG + Intergenic
1054582153 9:66925653-66925675 TTAATTCTTCTTTAAATATTTGG - Intronic
1054645322 9:67585885-67585907 TTAATTTTTCTTTAAATGTTTGG + Intergenic
1054802831 9:69368724-69368746 TTAGTTCTTCTTTATAAGTTTGG + Intronic
1054838210 9:69702946-69702968 TTAATTCTTCTTTAAACATTTGG + Intergenic
1054930702 9:70632084-70632106 TGCTTTCTTCTTTACAATTATGG - Intronic
1055232406 9:74081636-74081658 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1055288701 9:74759298-74759320 TTCTTTCTTTTTCAAAAGTTTGG - Intronic
1055682251 9:78728040-78728062 TTAGTTCTCCTTTAAAAGTTTGG - Intergenic
1055820844 9:80261396-80261418 TTAATTCTTCTTTTAATGTTTGG - Intergenic
1055820883 9:80262050-80262072 TGTATTCTTCCTTTCAAGTTTGG - Intergenic
1056059289 9:82866971-82866993 TTATTTCTTCTTTAAAGGTTTGG - Intergenic
1056130251 9:83578242-83578264 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1056287367 9:85104071-85104093 TTAATTCATCTTTAAATGTTAGG + Intergenic
1056421334 9:86430067-86430089 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1056559857 9:87720680-87720702 TTAATTCCCCTTTACAAGTGAGG + Intergenic
1056614872 9:88155818-88155840 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1057103630 9:92388967-92388989 TTCATTTTTCATTACAATTAAGG - Intronic
1057129887 9:92647328-92647350 TTGATTCTTCTTGAAATGTTTGG - Intronic
1057289394 9:93792241-93792263 TTAATTTTTCTTTAAATGTTTGG + Intergenic
1057296086 9:93842225-93842247 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1057326862 9:94073094-94073116 CCCATTCTTCTTTAAATGTTCGG + Intronic
1057374284 9:94504646-94504668 TTCATTCTTTGTTAAACGTTTGG - Intergenic
1057639619 9:96805376-96805398 TTAATTCTTCTTTGAATGTTTGG - Intergenic
1057685007 9:97223959-97223981 TTAATTCTTCTTTAAATGTTAGG - Intergenic
1057707766 9:97409452-97409474 TTCATTTTTCTTTACATATAGGG + Intergenic
1057709273 9:97423101-97423123 TTGATTCTTCTATAAATGTTTGG + Intronic
1057932543 9:99207583-99207605 TTAGTTCTTCTTTATAAGTTTGG + Intergenic
1058133506 9:101280351-101280373 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1058235862 9:102488704-102488726 TTAATTCTTCCTTAAATGTTAGG - Intergenic
1058248795 9:102665595-102665617 ATAATTCTTCTTTACATGTTTGG + Intergenic
1058316707 9:103576950-103576972 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1058352689 9:104044686-104044708 TTAGTTCTTCTTTAAAAGTTTGG - Intergenic
1058361068 9:104146661-104146683 TTAATTCTTCTTTAAATATTTGG + Intergenic
1058397985 9:104578066-104578088 TTCTTTCTTCTTTAGAAGGTGGG - Intergenic
1058474253 9:105315077-105315099 TTCTTTCATCTTTAAACGTTAGG - Intronic
1058632433 9:107003034-107003056 CTCATGTTTCTTCACAAGTTTGG + Intronic
1058925845 9:109663077-109663099 TCCTTTCTTCTTTATTAGTTTGG + Intronic
1059370592 9:113829450-113829472 TTAATTCTTCTTTGAATGTTTGG - Intergenic
1059613531 9:115924565-115924587 ATCATTCTGCTTTACAGATTGGG + Intergenic
1059706862 9:116832978-116833000 TTTATTCTTCTTTAAACATTTGG + Intronic
1059809774 9:117843252-117843274 CTGATTCTATTTTACAAGTTGGG + Intergenic
1059815555 9:117909148-117909170 TGAATTCCTCTTTACAAATTTGG + Intergenic
1060000278 9:119952501-119952523 TTGATTCTTCTATACAAGGAAGG + Intergenic
1060097434 9:120804514-120804536 TTAATTCTTCTTTAAGTGTTTGG + Intergenic
1060459978 9:123842684-123842706 TTCATTCTTCTTTAAATGTTTGG - Intronic
1060901764 9:127263974-127263996 TTCATCCTTCCTTAAAAGGTAGG - Intronic
1061596499 9:131633427-131633449 TTCACTCTTCTTTACAAGCAGGG + Intronic
1061638613 9:131932680-131932702 TTAATTCTTCTTTAAATGTTTGG - Intronic
1062307353 9:135915853-135915875 TTAGTTCTTCTTTACACGTTTGG - Intergenic
1062719563 9:138030661-138030683 TTAATTCTCCTTTAAATGTTTGG + Intronic
1062728071 9:138089038-138089060 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1202800726 9_KI270719v1_random:173048-173070 TTAATTCTTTTTTAAATGTTAGG + Intergenic
1203696841 Un_GL000214v1:106580-106602 TTAATTCTTCTTTAAATGTTAGG - Intergenic
1203483308 Un_GL000224v1:27680-27702 TTAATTCTTCTTGAAATGTTTGG + Intergenic
1203709377 Un_KI270742v1:82769-82791 TTAATTCTTCTTGAAATGTTTGG - Intergenic
1203541703 Un_KI270743v1:94801-94823 TTAATTCTTCTTGAAATGTTTGG + Intergenic
1203552372 Un_KI270743v1:174449-174471 TTAATTCTTCTTTAAATGTTAGG + Intergenic
1185971303 X:4667840-4667862 TTCTTTCTTTTTTGCAAGTCAGG - Intergenic
1186677586 X:11835268-11835290 TACATATTTCTTTATAAGTTTGG + Intergenic
1186691951 X:11986967-11986989 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1186911309 X:14170026-14170048 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1187190147 X:17026736-17026758 TTCATACTTTTTTAAAAGTGAGG + Intronic
1187313012 X:18164359-18164381 TACATACATCTTTATAAGTTAGG - Exonic
1187579175 X:20590564-20590586 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1187639232 X:21269695-21269717 TTCATTGTTCTGTTTAAGTTTGG - Intergenic
1187654658 X:21457501-21457523 TTCATTATTCTTTTGTAGTTAGG + Intronic
1187694746 X:21908049-21908071 TTAATTCTTATTTACAGGTCAGG - Intergenic
1187839155 X:23468310-23468332 TTAATTCTTTTTTAAATGTTTGG - Intergenic
1188048949 X:25460799-25460821 ATAATTCTTCTTTAAATGTTTGG + Intergenic
1188081168 X:25842587-25842609 TTCATTATTCTTTAAATGTTTGG - Intergenic
1188228389 X:27630432-27630454 TTCATTCTTCTTGAAATGTTTGG - Intronic
1188261328 X:28028101-28028123 TTAATTCTTCTTTAAATCTTTGG + Intergenic
1188348756 X:29101415-29101437 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1188386028 X:29559403-29559425 TTAATTCTTCTTTAAAAGTTTGG + Intronic
1188408550 X:29842546-29842568 TTTAATCCTCTTTACAAGATGGG - Intronic
1188500215 X:30817586-30817608 TTAATTCGTCTTTAAATGTTTGG - Intergenic
1188742471 X:33802041-33802063 TTCGTTCTTTTTTATGAGTTTGG + Intergenic
1188770588 X:34148504-34148526 TTGGTCTTTCTTTACAAGTTTGG - Intergenic
1188832102 X:34911600-34911622 TTAATTCTGCTTTAAAAGTTTGG + Intergenic
1188853901 X:35168130-35168152 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1188866728 X:35322177-35322199 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1188944053 X:36275769-36275791 TTAATTCCTCTTTAAATGTTTGG + Intronic
1188998787 X:36919726-36919748 TTCCTTCTCCTTTAAATGTTTGG + Intergenic
1189199435 X:39179667-39179689 TTATTTCTTCTTTAAATGTTTGG + Intergenic
1189201934 X:39203901-39203923 TTCATTTTGCTATACAAGCTTGG - Intergenic
1189360488 X:40346543-40346565 TTAATTGTTCTTTAAATGTTTGG + Intergenic
1189596851 X:42576077-42576099 TTAATTTTTCTTTAAATGTTTGG + Intergenic
1189641317 X:43074899-43074921 TTGATTCTTATTTATATGTTTGG + Intergenic
1189690153 X:43608652-43608674 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1189699618 X:43704058-43704080 TTAATTCTTCTTTAAACTTTTGG - Intronic
1189715176 X:43857766-43857788 TTCATTTTTCATTCTAAGTTAGG + Intronic
1189870364 X:45375544-45375566 TTTATTTTTCTTTAAATGTTTGG - Intergenic
1189880297 X:45484435-45484457 TTAATTCTTTTTTAAATGTTTGG + Intergenic
1190079393 X:47343905-47343927 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1190151207 X:47950836-47950858 TTAATTCTTCTTTGAATGTTTGG - Intronic
1190371324 X:49744393-49744415 TTAATTCTTCTTTGAAAGTTTGG - Intergenic
1190518104 X:51245996-51246018 TTAATTCTTCTTTAGATGCTTGG - Intergenic
1190571211 X:51783861-51783883 TTAATTATTCTTTAAACGTTTGG + Intergenic
1190801466 X:53793257-53793279 TTAATTATTCTTTAAATGTTTGG + Intergenic
1190811242 X:53886131-53886153 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1190899418 X:54655227-54655249 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1190926799 X:54916692-54916714 TTCATTCCTCTTTAAATGTTTGG + Intergenic
1190994047 X:55587180-55587202 TTGATTCTTCTTTAAATATTTGG - Intergenic
1191118770 X:56880491-56880513 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1191153900 X:57250922-57250944 TTAATTCTTCTTTAGATGTTTGG - Intergenic
1191266169 X:58396493-58396515 TTCTTTCTTCTTTGCATCTTGGG - Intergenic
1191642321 X:63440227-63440249 TTAATTCTTCTTTGTAGGTTTGG - Intergenic
1191708742 X:64123794-64123816 TTACTTCTTCTTTTCAAATTTGG - Intergenic
1191709013 X:64128437-64128459 TTCCTTCTTCTTTAAGTGTTTGG - Intergenic
1191721649 X:64234626-64234648 TGAATTCTTCTTTACATTTTTGG + Intergenic
1191728119 X:64302608-64302630 TTACTTCTTCATTACAGGTTAGG + Intronic
1191744537 X:64471753-64471775 TTAATTCTTCTTTAAATATTTGG + Intergenic
1191758052 X:64615919-64615941 TTAATTCTTCTTGAAATGTTTGG + Intergenic
1191855600 X:65623498-65623520 TTAATTCTTCTTTAAATATTTGG + Intronic
1191909742 X:66136383-66136405 TTATTTCTTCTTTAAATGTTTGG + Intergenic
1191911332 X:66153531-66153553 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1191964147 X:66738437-66738459 TTCATTCTTCTTTAAAAGTTTGG + Intergenic
1192079825 X:68036792-68036814 TTAGCTCTTCTTTATAAGTTGGG - Intergenic
1192101811 X:68272258-68272280 TTCATACTTCTTTACCAGTAAGG - Intronic
1192135442 X:68594674-68594696 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1192378014 X:70584462-70584484 TTTATTCTTCTTTAAATGTTTGG - Intronic
1192399394 X:70819006-70819028 TTAATTCTTCTTTGAATGTTTGG - Intronic
1192506575 X:71689004-71689026 TTAATTCTTCTTTGAATGTTTGG + Intergenic
1192520122 X:71792542-71792564 TTAATTCTTCTTTGAATGTTTGG - Intergenic
1192559825 X:72120269-72120291 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1192635960 X:72818015-72818037 TTTGTTCTTCTTTAAATGTTTGG + Intronic
1192645754 X:72902790-72902812 TTTGTTCTTCTTTAAATGTTTGG - Intronic
1192686482 X:73311419-73311441 TTGATTCTTCTTTAAATGTTTGG - Intergenic
1192717049 X:73654608-73654630 TTAGTTCTTCTTTAAAAGTTTGG + Intronic
1192724785 X:73737764-73737786 TTAGTTCTTCTTTGAAAGTTTGG + Intergenic
1192812911 X:74563377-74563399 TTAGTTATTCTTTACATGTTTGG - Intergenic
1192819656 X:74631186-74631208 ATCATTTTTATTTACAAGTAAGG - Intergenic
1192842276 X:74868894-74868916 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1192853149 X:74979480-74979502 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1192989945 X:76440008-76440030 TTAGTTCTTCTTTAGAGGTTTGG + Intergenic
1193017181 X:76748911-76748933 TTACTTTTTCTTTAAAAGTTTGG - Intergenic
1193071731 X:77313478-77313500 TTAATTCTCCTTCATAAGTTTGG - Intergenic
1193093240 X:77517585-77517607 TTAGTTCTTCTTTAAACGTTTGG - Intronic
1193147050 X:78087891-78087913 TTAATTCTCCTTTAAATGTTTGG + Intronic
1193196824 X:78642110-78642132 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1193211697 X:78813934-78813956 TTAATTCTTCTTTGTAAGTTTGG - Intergenic
1193262267 X:79422204-79422226 TTAATTTTTCTTTACATTTTTGG + Intergenic
1193267663 X:79492398-79492420 TTCATTCTTCTTGCAACGTTTGG - Intergenic
1193412933 X:81186189-81186211 TTAATTCTTCTTTATATGTTTGG + Intronic
1193491189 X:82150506-82150528 TTCATTCTTCTTTATAAATTTGG - Intergenic
1193495266 X:82203439-82203461 TTACTTCCTCTTTATAAGTTTGG + Intergenic
1193561733 X:83026202-83026224 ATCATTCTTCTTTGAATGTTTGG - Intergenic
1193562484 X:83036196-83036218 GTCATTCTTCATTGTAAGTTTGG - Intergenic
1193610469 X:83625702-83625724 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1193642741 X:84031683-84031705 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1193650680 X:84127382-84127404 TTAATTCTTCTTTAAATGTTTGG - Intronic
1193665725 X:84313888-84313910 TTGATTCTTCTTTAAATGTTTGG - Intergenic
1193730693 X:85099319-85099341 TTAATTCTTCTGTAAATGTTTGG - Intronic
1193756359 X:85413806-85413828 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1193887405 X:86999586-86999608 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1193933606 X:87587202-87587224 TTAATTCTTCTTTAAATATTTGG - Intronic
1194034144 X:88850640-88850662 TTAATTCTTCTTTAAATATTTGG - Intergenic
1194083294 X:89494975-89494997 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1194151016 X:90325133-90325155 TTATTTCTTCTTTAAATGTTTGG - Intergenic
1194157409 X:90408492-90408514 TTCATTCTTTCTTAAATGTTTGG + Intergenic
1194177900 X:90674090-90674112 TTGATTCTTCTGTAAATGTTTGG - Intergenic
1194228331 X:91290198-91290220 TTAGTTCTTTTTTAAAAGTTTGG - Intergenic
1194401090 X:93438562-93438584 TTCATTATTCTATCAAAGTTTGG - Intergenic
1194439085 X:93907191-93907213 TTGGTTCTTCTTTAAAAGTTTGG + Intergenic
1194529823 X:95032372-95032394 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1194551375 X:95304799-95304821 TTCATTATTCTTTACATGTTTGG - Intergenic
1194569770 X:95541154-95541176 TTAATTCTTCTTTAAACGTTTGG - Intergenic
1194689171 X:96961162-96961184 TTAGTTCTTTTTTACAAGTTTGG + Intronic
1194692525 X:97005371-97005393 TGAATTCTTCTTTAAATGTTTGG + Intronic
1194774675 X:97947566-97947588 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1194786376 X:98089261-98089283 TTCATTCTTCTTTAAACACTTGG + Intergenic
1194799669 X:98256552-98256574 TTCATTCTTCTTTAAATGTTTGG - Intergenic
1194872516 X:99150458-99150480 TTATTTCTTCCTTACATGTTTGG - Intergenic
1194877253 X:99204508-99204530 TTGGTTCTTCTTTAAATGTTTGG + Intergenic
1194921072 X:99765277-99765299 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1194929684 X:99871123-99871145 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1194989586 X:100532339-100532361 TTAATTCTTCCTTAAATGTTTGG + Intergenic
1194991091 X:100548137-100548159 TTCACTCTTCTTTAAATGTTTGG - Intergenic
1195015219 X:100772206-100772228 TTTGTTCTTCTTTAAAACTTTGG + Intergenic
1195116132 X:101700023-101700045 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1195165127 X:102212266-102212288 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1195173026 X:102287158-102287180 GTAATTCTTCTTTAAATGTTTGG - Intergenic
1195185840 X:102399937-102399959 GTAATTCTTCTTTAAATGTTTGG + Intronic
1195193731 X:102474825-102474847 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1195199820 X:102537515-102537537 TTGGTTCTTCTTTAAATGTTTGG - Intergenic
1195309716 X:103619964-103619986 TTAATTTTTATTTACATGTTTGG - Intronic
1195312654 X:103647496-103647518 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1195601616 X:106755321-106755343 TTAGTTCTTCTTTAAACGTTTGG - Intronic
1195800837 X:108707962-108707984 TTAATTCTTCTTTAAACATTTGG + Intergenic
1195851129 X:109282636-109282658 TTCTCTCTTTTTTACAAGTTTGG + Intergenic
1195855327 X:109325757-109325779 TTCTTTGTCCTTGACAAGTTGGG - Intergenic
1195897029 X:109756332-109756354 TTATTTCTTCTTTAAATGTTTGG - Intergenic
1195955495 X:110325067-110325089 TTTATTCTTCTTTAAATGTGTGG + Intronic
1196082487 X:111648664-111648686 TTCATTTTTCTCTACAGATTCGG + Intergenic
1196157283 X:112444599-112444621 TTACTTCTTCTTTAAATGTTTGG + Intergenic
1196182609 X:112709398-112709420 TTAATTCTTCTTTAAAAATTTGG + Intergenic
1196232164 X:113236745-113236767 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1196461074 X:115931763-115931785 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1196475641 X:116081461-116081483 TTAGTTCTTCTTTAAAAGTTTGG - Intergenic
1196564972 X:117194432-117194454 TTAGTTCTTCATTAAAAGTTTGG - Intergenic
1196626407 X:117882004-117882026 TTATTTCTTCTTTAAATGTTTGG - Intergenic
1196628061 X:117900874-117900896 TTCATTCTCCTGTAGAATTTAGG - Intronic
1196922451 X:120598716-120598738 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1196979410 X:121195311-121195333 TTTATTTTTGTTTCCAAGTTTGG - Intergenic
1196980276 X:121205370-121205392 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1197026933 X:121762882-121762904 TTAATTCTTCTTTAAATATTTGG - Intergenic
1197076053 X:122354041-122354063 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1197081912 X:122428481-122428503 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1197105412 X:122707986-122708008 TTCCTTCTGCTTTACATTTTTGG - Intergenic
1197109109 X:122751439-122751461 TTAATTCTTCTTTAAATGTTTGG + Intergenic
1197121892 X:122903554-122903576 TTAACTCTTCTTTAAATGTTTGG - Intergenic
1197143791 X:123147920-123147942 TTAGTGCTTCTTTAAAAGTTTGG - Intergenic
1197307967 X:124867052-124867074 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1197341277 X:125268803-125268825 TTAGTTCTTTTTTACATGTTTGG + Intergenic
1197442200 X:126506146-126506168 TTAATTCCTCTTTAAATGTTTGG + Intergenic
1197465557 X:126800240-126800262 TTAGTTCTTCTTTATATGTTTGG - Intergenic
1197470264 X:126859215-126859237 TTAATTCTTCCTTAAATGTTTGG - Intergenic
1197508846 X:127345316-127345338 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1197545095 X:127814821-127814843 TTAGTTCTTCTTTAAATGTTCGG - Intergenic
1197547814 X:127848500-127848522 TTAATTATTCTTTAGATGTTTGG - Intergenic
1197554836 X:127940282-127940304 TTAGTTATTCTTTAAAAGTTTGG + Intergenic
1197564458 X:128064689-128064711 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1197661221 X:129175097-129175119 TTAATTTTTCTTTAAATGTTTGG + Intergenic
1197672190 X:129290153-129290175 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1197677971 X:129351253-129351275 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1197695574 X:129546535-129546557 TTCATTCTTCCATACAAATATGG - Intronic
1197842243 X:130761246-130761268 GTAATTCTTCTTTATAAGTTTGG + Intronic
1197857369 X:130930078-130930100 TTCATTTTTCTTTAAATGTTTGG - Intergenic
1197876239 X:131110792-131110814 TTCATTCTTCTTTAAATGTTTGG + Intergenic
1197986942 X:132276758-132276780 TTCGTTCTTCTTTAAATATTTGG + Intergenic
1198065878 X:133096238-133096260 TTCATTTGCCTTTAAAAGTTTGG - Intronic
1198315192 X:135458777-135458799 TCCATTCTCCTTTCCAACTTGGG + Intergenic
1198430516 X:136561652-136561674 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1198626012 X:138575294-138575316 TTGATTCTTCTTTAAATGTTTGG + Intergenic
1198652764 X:138881488-138881510 TTAATTCTTCTTTAAATGTTTGG + Intronic
1198696904 X:139351084-139351106 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1198702261 X:139410090-139410112 TTGGTTCTTCTTTAAATGTTTGG + Intergenic
1198795964 X:140394993-140395015 TTAATTCTTCTTTAAATGTTTGG - Intergenic
1198940406 X:141948856-141948878 TTAGTTCTACTTTACATGTTTGG + Intergenic
1199048653 X:143208399-143208421 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1199148505 X:144399847-144399869 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1199162638 X:144631996-144632018 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1199261956 X:145785105-145785127 TTAATTCTTCTTTAAGTGTTTGG - Intergenic
1199291844 X:146113720-146113742 TTAGTTCTTCTTTATAAGTTTGG + Intergenic
1199363074 X:146944900-146944922 TTCATTCTTCTTTTAATGTTTGG - Intergenic
1199379292 X:147148881-147148903 TGCATTCTTCTAAAGAAGTTAGG - Intergenic
1199451730 X:147985232-147985254 TTAATTCTTCTTTAAATATTTGG + Intronic
1199909092 X:152266048-152266070 TTAGTTCTTCTTTAAATGTTTGG - Intronic
1200010574 X:153117530-153117552 TTAATTCTTCTTTAAAGGTGTGG + Intergenic
1200029026 X:153282392-153282414 TTAATTCTTCTTTAAAGGTGTGG - Intergenic
1200203409 X:154297946-154297968 TTAATTTTTCTTTAAATGTTTGG + Intronic
1200345727 X:155445840-155445862 TTAGTTCTTCTTTATATGTTTGG - Intergenic
1200379820 X:155823788-155823810 TTAGTTCTTCTTTAAATGTTTGG - Intergenic
1200380072 X:155827614-155827636 TTAATTCTTCTTTAAAGATTTGG - Intergenic
1200382029 X:155847903-155847925 CTAATTTTTCTTTACATGTTTGG - Intergenic
1200435944 Y:3150849-3150871 TTAGTTCTTCTTTAAATGTTTGG + Intergenic
1200497384 Y:3901886-3901908 TTATTTCTTCTTTAAATGTTTGG - Intergenic
1200503741 Y:3985485-3985507 TTCATTCTTTCTTAAATGTTTGG + Intergenic
1200524567 Y:4256247-4256269 TTGATTCTTCTTTAAATGTTTGG - Intergenic
1201153653 Y:11110012-11110034 TTAATTATTCTTTAAATGTTAGG + Intergenic
1201164334 Y:11194284-11194306 TTAATTCTTCTTGAAATGTTTGG - Intergenic
1201501445 Y:14647403-14647425 TTAATTCTGCTTTCTAAGTTAGG + Intronic
1202057165 Y:20847125-20847147 TTCTTTCTTCATTACAACCTTGG + Intergenic
1202093992 Y:21225422-21225444 TTAGTTTTTCTTTAAAAGTTTGG + Intergenic
1202391572 Y:24375674-24375696 TTAACTCTTCTTTAAATGTTTGG - Intergenic
1202479213 Y:25294443-25294465 TTAACTCTTCTTTAAATGTTTGG + Intergenic
1202576015 Y:26326129-26326151 TTAATTCTTCTTTAAGTGTTTGG - Intergenic