ID: 1124598368

View in Genome Browser
Species Human (GRCh38)
Location 15:31110514-31110536
Sequence CTCTTTGTCTGGAAGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 334}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124598368 Original CRISPR CTCTTTGTCTGGAAGGCAGA GGG Intronic
900346447 1:2212720-2212742 CTCGTTGCCTGGAGGACAGAGGG + Intronic
900425815 1:2578102-2578124 CTTTATGTCTGGAAGTCAGGGGG + Intergenic
901886717 1:12228831-12228853 CACTCTGTCTGGAGTGCAGAGGG + Intergenic
902154096 1:14469658-14469680 CTCATGGGCAGGAAGGCAGATGG + Intergenic
902370748 1:16005419-16005441 CTGTGTTCCTGGAAGGCAGATGG + Intronic
902934991 1:19758672-19758694 CTCCTCGTCTAGAAGGCAGTAGG + Intronic
903012794 1:20343093-20343115 GTCTCTGTCTCGAAGGCAGAGGG - Exonic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903879456 1:26499251-26499273 CTCTTTGTCTGGAAGAGAACTGG + Intergenic
904197544 1:28796959-28796981 CTCTGGGTCTGGTAGGCAAATGG + Intergenic
904337112 1:29805171-29805193 CTCTGTGTCTGGCAGCCTGATGG + Intergenic
904420175 1:30386140-30386162 CTCTTGGCCTGCAAGGCAGGTGG + Intergenic
905311241 1:37050524-37050546 CTCATTGCCTTGAGGGCAGAGGG - Intergenic
905769866 1:40630600-40630622 CTCCTTGTGGGGAAGGGAGAAGG + Intronic
905933460 1:41806149-41806171 GTGTTTGTCTGGAGAGCAGAGGG - Intronic
906259992 1:44379626-44379648 CCATTTGGCTGGAAGGCAGCTGG + Intergenic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
906944314 1:50282818-50282840 CTATTTGGCTGGAAGGCTTAGGG + Intergenic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
907868732 1:58423761-58423783 CTCTTTTGCTGCAAGGCACAGGG + Intronic
908460460 1:64343999-64344021 GCCTTTGGCTGGAGGGCAGATGG - Intergenic
909783804 1:79584530-79584552 CTCTTAGTCTGTAAGAGAGAGGG - Intergenic
910874856 1:91868903-91868925 CTGTTTATCTGGACGGCAGTGGG - Intronic
911420806 1:97638134-97638156 GTTTTCATCTGGAAGGCAGAAGG + Intronic
914761469 1:150602186-150602208 TACTTGGTCTGGGAGGCAGAGGG + Intronic
914889953 1:151612992-151613014 TACTTGGTCTGGAGGGCAGAAGG - Intronic
918007164 1:180552581-180552603 CTCTTTCTCTAGAGGGAAGATGG - Intergenic
918193371 1:182198134-182198156 CTCCTTGTCCTGAGGGCAGAGGG + Intergenic
919035767 1:192307492-192307514 CTCTTTGCAAGGTAGGCAGAAGG - Intergenic
919462746 1:197897989-197898011 ATCTATGTCTAGCAGGCAGATGG + Intergenic
920670092 1:207997417-207997439 CCCTTTTTCTTGAAGACAGATGG + Intergenic
921360124 1:214323835-214323857 CTCTCTGTTAGGGAGGCAGAGGG - Intronic
923097499 1:230787282-230787304 CTCCTCGTCTGTAAGGCAGAAGG + Intronic
923521148 1:234735789-234735811 GCCTTGGTATGGAAGGCAGAAGG - Intergenic
1062916375 10:1243747-1243769 CGCTTTGCCTGGAAGGAAGGAGG - Intronic
1063026722 10:2186156-2186178 CTGTTTTTCTGGAAGTCTGATGG + Intergenic
1063382455 10:5594348-5594370 TTCCCTGTCTGCAAGGCAGAGGG - Intergenic
1064801985 10:19086778-19086800 CTCTTAGTCTGTAAGAGAGAGGG - Intronic
1064811658 10:19206873-19206895 GTCTTTGGCTGTAGGGCAGAAGG - Intronic
1065903830 10:30230817-30230839 CTCTTTGTCTTGAAGAAATAGGG - Intergenic
1066270310 10:33816077-33816099 ACCTTTTTCTGCAAGGCAGATGG - Intergenic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1067706844 10:48612363-48612385 CTCTATATCTGGCAGGCAGTTGG + Intronic
1069054887 10:63834516-63834538 GTCTTTGTTCAGAAGGCAGAAGG - Intergenic
1069091216 10:64200965-64200987 CCCTTTGTCTGAGAGCCAGAAGG - Intergenic
1069449792 10:68507385-68507407 CTCTTTATCTGGAAGGATGAAGG + Intronic
1069559832 10:69421709-69421731 CTCTTAGTCTGTAAACCAGAGGG + Intergenic
1069722451 10:70558331-70558353 CTCCCTTTCTGGAAGGCAAAGGG + Intronic
1070436772 10:76401547-76401569 ATCTATGTCAGGGAGGCAGAAGG - Intronic
1070606371 10:77901313-77901335 TTCTTGGTCTGTAAGTCAGAAGG - Intronic
1070631436 10:78087771-78087793 CTCCTTCTCTGAAAGACAGAAGG - Intergenic
1070664260 10:78332363-78332385 CTCTGTTACTTGAAGGCAGACGG + Intergenic
1071915022 10:90284929-90284951 CTTTCTGTCAGGAAGGCTGAAGG - Intergenic
1072328897 10:94326218-94326240 CTCATTGTCATAAAGGCAGATGG - Intronic
1076899657 10:133331786-133331808 CATTTTATATGGAAGGCAGAGGG + Intronic
1077066563 11:643679-643701 CTCTTGGTCAGGAGGGCAGGGGG + Intergenic
1078583246 11:12556908-12556930 CTCCTTGGCTGGGAGGCAGCAGG - Intergenic
1078670959 11:13364633-13364655 TTGTATGTCTGGAAGGCAGTGGG + Intronic
1079566293 11:21887413-21887435 CTCTTTGTTTTGAAACCAGAAGG + Intergenic
1079613909 11:22467315-22467337 CCCTTTGTCTGCAAAGCAAAAGG + Intergenic
1080070314 11:28076168-28076190 GTCTGTGTTTGGAAGGGAGAGGG + Intronic
1080344632 11:31310788-31310810 CTCTGTTTCTGGAAAGCTGAAGG - Intronic
1081237963 11:40668877-40668899 TTCTTTGTCTTTAAGGAAGAAGG + Intronic
1081548631 11:44091850-44091872 CTCTTTTTCTGGTTTGCAGAGGG - Intergenic
1081622603 11:44627855-44627877 CTCTGTGTCTGGCAGGTAGGGGG + Intergenic
1083968580 11:66058299-66058321 CTCTTCCTCTGTAAGGAAGAAGG - Exonic
1084162006 11:67355179-67355201 CACTTAGTCCGCAAGGCAGATGG - Intronic
1084743340 11:71152940-71152962 TTGTTTGTCTGAAATGCAGATGG - Intronic
1085086959 11:73674866-73674888 CTACTAGTCTGGAAGGCACAAGG + Intergenic
1086894105 11:92292486-92292508 CTAATTTTCTGGAAGACAGAAGG - Intergenic
1087370045 11:97272479-97272501 CTTTTTGTCTGGAAGCCCTAAGG - Intergenic
1087908868 11:103729795-103729817 CTCTTTTTCTGGCTTGCAGATGG + Intergenic
1088169170 11:106976239-106976261 CTTTTTTTTTGGATGGCAGAAGG - Intronic
1088173705 11:107025717-107025739 CTCTTTGTTTGGAAAGAACAGGG + Intergenic
1088977689 11:114830351-114830373 CACTTTGTCTGGAGGGGAGGAGG + Intergenic
1089481850 11:118812184-118812206 CTCTTTGTGTGGCAGCAAGAGGG + Intergenic
1089836424 11:121374448-121374470 CTTTGTGTCAGGTAGGCAGAGGG + Intergenic
1090444901 11:126755807-126755829 CTCTCTGCCTGAATGGCAGATGG - Intronic
1092278438 12:7080904-7080926 ATCGTTGTCAGGGAGGCAGATGG + Exonic
1092552270 12:9515661-9515683 CTCTGTGTCTGCAATGAAGAAGG - Intergenic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1099259055 12:80353484-80353506 CTCTTTCTCTGGAATGCACTGGG - Exonic
1100660064 12:96687066-96687088 CTGTTGGTCTTGAAGACAGAAGG - Intronic
1101182118 12:102230509-102230531 CTTTTTGTCAGGAAACCAGATGG + Intergenic
1102856726 12:116300511-116300533 CACTTGGTCTAGGAGGCAGATGG + Intergenic
1103065279 12:117892367-117892389 CTCTTTGTTTGAGAGGCATAAGG - Intronic
1103539975 12:121659245-121659267 CTGTTGGTCAGGAAGGCTGAGGG + Exonic
1103922600 12:124406800-124406822 CTGCTTGTCTGGCAGGCTGAGGG - Intronic
1104344138 12:127980651-127980673 CTCATGGTCTGTAAGACAGAGGG - Intergenic
1104464702 12:128980740-128980762 AGCTTTGTGTGGAAGGCAGACGG + Intronic
1104662267 12:130619941-130619963 CTCTGTGCCAGGAAGACAGAGGG + Intronic
1104664232 12:130635975-130635997 CTCGGAGGCTGGAAGGCAGAGGG - Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104862432 12:131930578-131930600 TTCCTTTTCTGGAAGGTAGAGGG + Intronic
1106032381 13:26014904-26014926 CTCTGTGTCTGGCATACAGAAGG - Intronic
1106182492 13:27381192-27381214 GGCTTTGTCTGGATGGCTGAAGG + Intergenic
1106372092 13:29144821-29144843 CTCTTTGTCTTGAGTGCAGGTGG - Intronic
1108394685 13:49980855-49980877 CCCATTGTGTGGAAGGAAGATGG - Intergenic
1109722596 13:66294736-66294758 GTCTTTTTCTGTAAGGCTGATGG + Intergenic
1112794373 13:103039448-103039470 CCCTTTGTCTTTAAGGCAGCAGG + Intergenic
1112891798 13:104243737-104243759 CTTTTTCTCTGTATGGCAGAGGG + Intergenic
1113882309 13:113634136-113634158 CTCTGTGTCCGGCTGGCAGACGG + Intronic
1114637435 14:24195738-24195760 CTCCTTGCCTGGAACGCAGAGGG + Intronic
1115555288 14:34540394-34540416 CTCATGGTGTGGAAGGCATAAGG - Intergenic
1117758622 14:59002682-59002704 TACCTTGTCTGGAAGGAAGAAGG + Intergenic
1118126790 14:62914162-62914184 CTATTTTTGTGGAAGGCATATGG - Intronic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119676977 14:76563056-76563078 CTCTTTGTCCAGAATCCAGAAGG - Intergenic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1121295221 14:92815411-92815433 CTTTTAGTTTGTAAGGCAGAGGG + Intronic
1121564385 14:94897772-94897794 CTCTCATTCTGCAAGGCAGAGGG + Intergenic
1121794962 14:96727230-96727252 CTCTCTGACTGGAATGCAGAAGG - Intergenic
1124598368 15:31110514-31110536 CTCTTTGTCTGGAAGGCAGAGGG + Intronic
1124729441 15:32183420-32183442 CTTTTTGTCTGGAACCAAGATGG + Intergenic
1126054173 15:44713905-44713927 CTCCTTGTCTGGGAGGCTGTGGG - Intronic
1126498694 15:49320904-49320926 GTCTTTGCCTGGAAGGAAGTGGG + Intronic
1127540813 15:59937091-59937113 ATGTCTGTCTGGGAGGCAGATGG + Intergenic
1128064716 15:64757299-64757321 CTCTTAGTCTTGGAGGTAGATGG - Intronic
1129543189 15:76368236-76368258 CTCTTTGCCTCAAAGGCAGATGG - Intronic
1131333413 15:91523740-91523762 CTGTTGGTCTGGGAAGCAGATGG + Intergenic
1131714797 15:95096698-95096720 CACTTTCTCTGCCAGGCAGAAGG - Intergenic
1131731514 15:95287030-95287052 CTTTCTGTCTGGTAGGCAGGGGG - Intergenic
1131809925 15:96162473-96162495 ATATTTCTCTGGAGGGCAGAGGG - Intergenic
1131895114 15:97019710-97019732 CCCTTAGTATGGAAGGAAGAAGG + Intergenic
1132060347 15:98687517-98687539 ATTTTTCTCTGGAAGGCACAGGG + Intronic
1132323439 15:100944631-100944653 TTTTGTGTTTGGAAGGCAGATGG + Intronic
1132683105 16:1151957-1151979 CTCTTTGTCTGGAGGGAGAAGGG + Intergenic
1134067829 16:11240657-11240679 CTCTGTGCCTGGCATGCAGAAGG + Intergenic
1135327956 16:21539387-21539409 GTCTCTGTCTGGAAGGAAGATGG + Intergenic
1136088692 16:27903305-27903327 CTCTCTGTGTGGCAGCCAGAGGG - Intronic
1137537379 16:49337645-49337667 CACTTTGGCGGGAAGTCAGAGGG - Intergenic
1139152445 16:64398947-64398969 CTCATGGTATGTAAGGCAGACGG + Intergenic
1140127133 16:72127050-72127072 TTCTGAGTCTGGAAGCCAGAGGG + Intronic
1141023995 16:80526662-80526684 CTCTTTGTCTCTAAGTAAGAAGG - Intergenic
1141767447 16:86067945-86067967 CTCCCTGTCTGGGAGGCAGTGGG - Intergenic
1142144635 16:88487754-88487776 CCCTTTTTCTGGCAGGCAGCAGG + Intronic
1143370710 17:6437251-6437273 CTCCATCCCTGGAAGGCAGAAGG + Intergenic
1143846717 17:9777720-9777742 CTCCTAGTATGGAAGGAAGAAGG + Intronic
1146206232 17:30907516-30907538 GTTTGTGTCTGGAAGGCAGTGGG + Intronic
1146521021 17:33525599-33525621 CTCCATGTCTGCAAGGCAGGAGG - Intronic
1146956914 17:36941263-36941285 CACTTTGTGCAGAAGGCAGAGGG - Intronic
1147562735 17:41518974-41518996 GTGTTTGTCAGGAAGGCAGAAGG - Exonic
1148106923 17:45123892-45123914 CTCTTTGTCTGGAAAGAGGAGGG - Intronic
1148947196 17:51273921-51273943 TTCTTTGTATGGCAGCCAGAGGG + Intronic
1149070109 17:52531012-52531034 CTCTGTGTCTTTGAGGCAGATGG + Intergenic
1151345430 17:73498486-73498508 CTCTGTGCCGGGCAGGCAGAAGG + Intronic
1152271596 17:79328177-79328199 CTGTGTGTCTGGAACGGAGATGG + Intronic
1153517962 18:5922015-5922037 GTCTTTATATGGAAGACAGATGG + Intergenic
1153615450 18:6929581-6929603 CTCTCCGAGTGGAAGGCAGAGGG - Intergenic
1153724827 18:7943773-7943795 CTATTTATGAGGAAGGCAGAAGG - Intronic
1153800662 18:8665560-8665582 CACCTTTTCTGCAAGGCAGATGG - Intergenic
1154177643 18:12095054-12095076 CTATTTGTTCTGAAGGCAGAGGG + Intronic
1155185075 18:23380381-23380403 CTCCTTGTCAGGCAGGCAGAGGG - Intronic
1156227496 18:35123637-35123659 CTCTCTTTCTGGGAGGCTGATGG + Intronic
1158155075 18:54416696-54416718 CCCAGTGTCTGGAATGCAGAAGG - Intergenic
1158532222 18:58273921-58273943 CTCTCTGTGTGGATGGGAGAGGG - Intronic
1158682954 18:59585117-59585139 CTTTTTGGCTGGAAGGAACATGG - Intronic
1160378568 18:78431649-78431671 CTCTAGGTCTGGAAAGCAGTGGG - Intergenic
1161323716 19:3653046-3653068 CTCTTTGGGAGGCAGGCAGATGG - Intronic
1161602570 19:5193482-5193504 CTCTTTGTCTGGGGGGCTGTGGG + Intronic
1162176932 19:8837570-8837592 TTCTCTGGCTGGAGGGCAGAAGG + Intronic
1162439203 19:10682352-10682374 CACTGTGGCTGGCAGGCAGAGGG + Intronic
1162522437 19:11189783-11189805 CTGTTTGTCCTGCAGGCAGAAGG + Intronic
1162825229 19:13247205-13247227 CTCCTTCTCTGTAAGGTAGAGGG - Intronic
1166476034 19:43125415-43125437 CTCTATGTCGGGAAGGGTGAGGG + Intronic
1167449905 19:49560927-49560949 CTCTTTGTTTGGAGGTAAGAGGG + Intronic
1167551709 19:50165765-50165787 CTCCCTGCCTGAAAGGCAGATGG - Intergenic
1168488838 19:56790170-56790192 CACTTTATTTGGAAGGCAGTGGG - Intronic
925483248 2:4300134-4300156 CTCTTCATCTGGAGGGCAGAAGG + Intergenic
925728113 2:6894218-6894240 CTCTTCCTTTGGAAGGCAGTGGG - Intronic
926420206 2:12688355-12688377 GTCTCTGTCTGGCAGGGAGATGG + Intergenic
926690402 2:15729262-15729284 GTCTGTGACTGGAAGGCAGAAGG + Intronic
927646076 2:24877775-24877797 CTCTCTGTCTGGTGGTCAGATGG - Intronic
927964223 2:27259122-27259144 CTCTGTGTATGGAAGGAAAAGGG - Intronic
929620762 2:43351635-43351657 CTCTTTATCTGGCAGGGAGAGGG + Intronic
929763612 2:44826212-44826234 AGATTTGTCTGGAGGGCAGAAGG - Intergenic
929779426 2:44948362-44948384 TTCATTGGCTGGAGGGCAGAAGG + Intergenic
930328428 2:49950707-49950729 ATCCTTATCTGGAATGCAGATGG + Intronic
931669323 2:64632546-64632568 CACTTTCTCTGGATGACAGAAGG - Exonic
933298484 2:80517031-80517053 CTGTTTGTCTGAAATGAAGAAGG + Intronic
933478956 2:82830001-82830023 CTCATTGACTGGCAGGCAGCTGG - Intergenic
937028621 2:118719777-118719799 TTGTCTGTCTTGAAGGCAGATGG - Intergenic
938570144 2:132555328-132555350 CTTTTGGTCAGGAATGCAGAAGG + Intronic
939907063 2:147930073-147930095 CTCTTTTTCTGGAATTCACAAGG - Exonic
940004453 2:148998381-148998403 CTCTTGGCCTGGGATGCAGAAGG + Exonic
942078084 2:172375248-172375270 CTCTTTTTCTGGAAGCCATCTGG - Intergenic
943996983 2:194781823-194781845 TTCTTTCTCAGGAAGGAAGAAGG + Intergenic
944942127 2:204640171-204640193 CTCTGTGTCTGGGAGGTTGAGGG + Intronic
945004669 2:205391679-205391701 TTCTTCTTCTGGAAAGCAGAGGG + Intronic
945326774 2:208491511-208491533 CTCTTAGTCTGTAAGAGAGAAGG - Intronic
945641116 2:212431157-212431179 CTCTCTGTTTGGATGGCAGGTGG + Intronic
946814578 2:223563701-223563723 GGCTGTCTCTGGAAGGCAGATGG - Intergenic
947130944 2:226924248-226924270 GTCTTTCTCTTCAAGGCAGAAGG + Intronic
947316209 2:228861995-228862017 CTCTTTCTCTGGAATTCAGCAGG - Intronic
947928007 2:233938257-233938279 GACTTTGTCCTGAAGGCAGAGGG - Intronic
948710448 2:239821866-239821888 GGCTCTGGCTGGAAGGCAGAGGG + Intergenic
948850311 2:240702408-240702430 CACTTTGTGTGGAGGTCAGAGGG - Intergenic
948990510 2:241551673-241551695 CCCTGTGCCTGGGAGGCAGATGG - Intergenic
1169532769 20:6503347-6503369 AACTTTGTCTGGAAGGCTCAAGG - Intergenic
1169927677 20:10799947-10799969 ATCTTGGTCTAGAAGGCAGGAGG - Intergenic
1170318840 20:15071439-15071461 CTCAGTGACTGGAAAGCAGAGGG + Intronic
1170918269 20:20649655-20649677 TTATTTGTCAGGTAGGCAGAAGG - Intronic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1172384608 20:34525122-34525144 TTGTTTTTCTGGAAGGCACAAGG - Intronic
1174013525 20:47469826-47469848 CTCAGTGTCTGGAAGGCATCAGG + Intergenic
1174090875 20:48046318-48046340 CTCTCTAGCTGTAAGGCAGATGG - Intergenic
1178039797 21:28627794-28627816 CTCTTTTTCTGCCTGGCAGATGG + Intergenic
1178116864 21:29426843-29426865 CTCTTTGTCTGGAGGGGAGAAGG - Intronic
1178120954 21:29469630-29469652 CTCATTGCCTGGAAGGAAGCAGG - Intronic
1178491912 21:33057866-33057888 CTCTTGTTCTGGAAGCCATATGG - Intergenic
1178884736 21:36476242-36476264 CACTTTTTCTAGATGGCAGAAGG - Intronic
1179633796 21:42694736-42694758 CTATTTTTCTGGAAGGTAGCAGG - Intronic
1179831700 21:44001054-44001076 CACTCTGCCTCGAAGGCAGATGG - Intergenic
1179899813 21:44384435-44384457 CCCTTCCACTGGAAGGCAGAAGG + Intronic
1179941573 21:44642291-44642313 GTCTTTGTATTGAAGGCTGATGG - Intronic
1179959169 21:44758705-44758727 ATCATTGTCTGGAGGGCACATGG + Intergenic
1181315235 22:21966758-21966780 CTGTCTGTCTGGAATGCAGAAGG - Intronic
1181999533 22:26908999-26909021 CTCCCTGTCTGGGAAGCAGAAGG + Intergenic
1182649743 22:31841728-31841750 CGCTTTTTCTGTGAGGCAGATGG - Intronic
1185018453 22:48359216-48359238 CACCTTGTCTGGAACACAGAGGG + Intergenic
949584933 3:5428162-5428184 CTCTGTGTCTGCGGGGCAGAAGG - Intergenic
951350953 3:21606250-21606272 CCCATTGTCCTGAAGGCAGAAGG - Intronic
951834202 3:26963137-26963159 CACTTTTTCTGCATGGCAGATGG + Intergenic
952522623 3:34176726-34176748 CTGTTTGTCTGGGAGGTAAAAGG - Intergenic
952849994 3:37719940-37719962 TTATTTTTCTGGAGGGCAGAGGG + Intronic
953730152 3:45440422-45440444 CTCATTGTTTTGAAGGCAGGAGG + Intronic
955798466 3:62662060-62662082 CTATGTGTCTGGAACTCAGAAGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957241106 3:77662184-77662206 CTCTTTTTCTTTAAGCCAGATGG + Intergenic
958724400 3:97887148-97887170 CTCTGTTCCTGAAAGGCAGATGG + Intronic
958758071 3:98274207-98274229 GTCTTTCTCTGGAAGACTGAGGG + Intergenic
959831771 3:110871495-110871517 CTTTTTTTCTGGAAGGTAGAGGG + Intergenic
961026194 3:123560164-123560186 CTCCTTGTCTGGAGGGGAGCAGG + Intronic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
964849735 3:161082115-161082137 CTCAGTGTCTGAAAGGGAGAGGG - Intergenic
966738225 3:183207322-183207344 CTCTTTGCCTGGAAGAAAGAGGG + Intronic
966953419 3:184846657-184846679 CTCTGTGCCTGGAAGGCAAGCGG + Intronic
967133998 3:186497651-186497673 CTCTATGTCGGGGAGGGAGAGGG + Intergenic
967230423 3:187332636-187332658 CATTTTAACTGGAAGGCAGAGGG - Intergenic
969250111 4:5962114-5962136 CTGTTTCTCTGGAAGGTACACGG - Intronic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
971361217 4:25940257-25940279 CTCTTTGTCTCGTAGGACGATGG - Intergenic
971882074 4:32389640-32389662 CTCTTTCTTGGGGAGGCAGAGGG + Intergenic
973090807 4:46133862-46133884 TGCTTTGTATAGAAGGCAGATGG + Intergenic
974082851 4:57230774-57230796 CTCTTTATCTGTAAAGCAGAAGG + Intergenic
975258410 4:72267796-72267818 CTCTAGGTCTGGAAGGAATATGG + Intergenic
976152781 4:82108794-82108816 CTGTTGCTCTGGGAGGCAGATGG - Intergenic
978389263 4:108207217-108207239 CTCTTTGCCTGGATGTCTGAAGG - Intergenic
980642272 4:135596229-135596251 CTCTTGGTCTGGAGAGCACATGG + Intergenic
981466091 4:145074306-145074328 CTCTTTTTGAGGAGGGCAGAGGG + Intronic
982545816 4:156731770-156731792 CACTGTGGCTGGAAGGGAGAAGG - Intergenic
982628888 4:157805970-157805992 CTCATTGTCTAGAAGGCTAATGG + Intergenic
985050854 4:185989451-185989473 GTTTTGATCTGGAAGGCAGAAGG - Intergenic
985525513 5:399487-399509 CTCTGTGACTGGAGGGCAAATGG - Intronic
987116177 5:14728574-14728596 CCCTTTGTCTGGAACAAAGACGG - Intronic
988028771 5:25735167-25735189 CTCTCTGACTGCAAGTCAGAGGG + Intergenic
988731950 5:33981187-33981209 CTCTGTGTAAGGAAGGCAGAGGG - Intronic
990630329 5:57661812-57661834 CTCTGAGTCAGGAAGGCAAAGGG + Intergenic
991000841 5:61781305-61781327 CTCTTTCTTTGGCTGGCAGACGG - Intergenic
992492008 5:77254541-77254563 CCCTTTGTGAGAAAGGCAGAAGG - Intronic
992568400 5:78025598-78025620 TTTTCTGTCTGGAATGCAGATGG + Intronic
993274079 5:85834250-85834272 TTCTTTGCCTGGCAGGAAGAGGG + Intergenic
994379599 5:99055936-99055958 CTCTTGATCTGCATGGCAGAAGG + Intergenic
995051266 5:107707233-107707255 CACTTTCACTGGAAGGTAGAAGG + Intergenic
995274536 5:110263068-110263090 CTCTTTGCCAGGAATACAGAAGG + Intergenic
998083389 5:139294721-139294743 CCCTTTGTCTGGAAACCGGAAGG - Intronic
998913718 5:146992437-146992459 CTCTTTGTATGGAAGGAGTATGG + Intronic
999247964 5:150165490-150165512 CTCTGGGTCAGGAAGTCAGATGG - Intergenic
999945794 5:156593779-156593801 GTCTTTGGCTGGAAGGCACTGGG + Intronic
1001218706 5:169880309-169880331 CCATATGCCTGGAAGGCAGAAGG - Intronic
1002689525 5:181040711-181040733 CTCTTAGTCTCTAAGGAAGATGG - Intronic
1003690904 6:8352653-8352675 CCCATTGTATGAAAGGCAGAAGG - Intergenic
1004196191 6:13507412-13507434 ATGTTGCTCTGGAAGGCAGAAGG + Intergenic
1006187434 6:32189390-32189412 TTCTTAGTCTGGGAGCCAGAGGG + Intronic
1006243588 6:32708667-32708689 CTCTTAGTCTGTAAGAGAGAGGG + Intergenic
1006389745 6:33751395-33751417 AACTCTCTCTGGAAGGCAGATGG + Intergenic
1007650780 6:43419544-43419566 CTCCTAGTCTGGAAAGCTGATGG - Intergenic
1007974500 6:46086679-46086701 GTCTTTGTCTGGAATCCAGCTGG - Intergenic
1008646229 6:53517668-53517690 GTGTTTGTGTGGAAGGGAGAAGG + Intronic
1013996500 6:116314998-116315020 CTCTGGGGCTGGAAGACAGATGG - Intronic
1015982581 6:138853906-138853928 GTCTTGGTCTTGCAGGCAGATGG + Intronic
1017524705 6:155232378-155232400 TTCATTGTCTGGAAGGCATGGGG - Intronic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1018945157 6:168342777-168342799 CTCTTTGTCAGGAAGTCTGCAGG + Intergenic
1019671227 7:2280149-2280171 CTTCTTGTCTGTAAGGCAGCTGG - Intronic
1020660183 7:10972958-10972980 CACTTTTTCTGCAGGGCAGATGG + Intergenic
1021002319 7:15347461-15347483 CTCTATGTCTGAAAGCCACAGGG + Intronic
1021725296 7:23542723-23542745 CACCTTCTCTGGAAAGCAGATGG + Intergenic
1022034522 7:26521081-26521103 ATCTGTGTCTGGAAGACAGGAGG + Intergenic
1022201807 7:28124259-28124281 CTCTTTGTGTGGCTTGCAGATGG - Intronic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1023480388 7:40627668-40627690 CACCTTTTCTGCAAGGCAGATGG - Intronic
1023659355 7:42456799-42456821 CACTTTGTCTCGGAGGGAGATGG - Intergenic
1024812409 7:53227696-53227718 CTCTCTGTCTGGCTTGCAGATGG - Intergenic
1024906144 7:54382847-54382869 CTCTTTGTCTGAAATGGACATGG - Intergenic
1028937593 7:96483751-96483773 CTCTCTGTCTTCAAGGCACATGG - Intronic
1029287327 7:99474766-99474788 CTCTTTGCTTAAAAGGCAGAGGG + Intronic
1030538187 7:110795077-110795099 CTCTTTGTTTGGAAAGCACCTGG - Intronic
1031301393 7:120065944-120065966 CTCTTTGTCTGAAATGAACAAGG + Intergenic
1031448215 7:121881211-121881233 CTCTCTTTCTGGATTGCAGATGG - Intronic
1033492348 7:141855716-141855738 CTCTGTGTGGGGAAGGCATACGG - Intergenic
1035698611 8:1620944-1620966 TTGTTTGTCTGGAGAGCAGAGGG - Intronic
1036620171 8:10419739-10419761 CTCTTTGGGTGGAGGGCAGGCGG + Intronic
1037458537 8:19086087-19086109 CTCATTGGGTGGAAGGCAGAAGG - Intergenic
1037905049 8:22711316-22711338 CTCGTTAGCTGGAAGGCAGAGGG - Intergenic
1038578759 8:28728634-28728656 CACTTTTTTTGGAAGGCTGAGGG + Intronic
1038914558 8:32006303-32006325 TACTCTTTCTGGAAGGCAGAAGG - Intronic
1039210566 8:35208058-35208080 GACTTTGTCTGGAAGGTAAAAGG - Intergenic
1042053682 8:64739014-64739036 TTCTGTCTCTGGCAGGCAGAGGG + Intronic
1042813561 8:72852980-72853002 CTCTTTTTCTGGAGGGGAGAGGG + Intronic
1043495099 8:80791772-80791794 CTCATTTTCTGGAAGGAGGAAGG + Intronic
1045193599 8:99907654-99907676 CTCTCTCTCTAGAAGGCAGAGGG - Intergenic
1045634029 8:104161969-104161991 TTCTCTGACTGGAAGGCAGAAGG - Intronic
1045724839 8:105160077-105160099 CTCTGTGTCTGGAAGGTGGTAGG + Intronic
1045836750 8:106531182-106531204 GTCTTTTTCTGTAAGACAGAAGG - Intronic
1046336276 8:112792347-112792369 CTCTTTTTCTGGCTTGCAGATGG + Intronic
1046389211 8:113546235-113546257 GTCTTTGGCTGGAAGGCACTGGG + Intergenic
1046773242 8:118137364-118137386 AAGTTTTTCTGGAAGGCAGATGG - Intergenic
1047228649 8:122977393-122977415 CTCTGTATCTGAAAGGAAGAAGG + Intergenic
1048323945 8:133424424-133424446 CTCCATGGCTGGAAGGAAGAGGG - Intergenic
1049877223 8:145032524-145032546 CTCTTTGTTCTTAAGGCAGATGG - Intergenic
1049957210 9:704645-704667 GTCTCTGTTTGGAAGGCAAATGG - Intronic
1050285635 9:4099027-4099049 CACTTTGTCTTGAGGGCAGTGGG - Intronic
1051029036 9:12651887-12651909 CTCATGGAGTGGAAGGCAGAGGG - Intergenic
1051226377 9:14903665-14903687 CTATGTGTTTTGAAGGCAGAAGG + Intronic
1052215804 9:25964463-25964485 CTCTTGGTCTGGAGAGCACATGG - Intergenic
1053083103 9:35193939-35193961 CCCTTGGTCTGGAAAGCACATGG - Intronic
1053380817 9:37648872-37648894 CTCTGGGTTTGGAAGACAGAAGG + Intronic
1056487028 9:87069410-87069432 CACAGTGTCTGGAAGACAGAAGG + Intergenic
1059161762 9:112041482-112041504 CTCCATGTCTAGATGGCAGATGG - Exonic
1059451699 9:114375117-114375139 CTCATGGTCTGGAAGGGAAATGG + Intronic
1060399308 9:123338865-123338887 TTCTTTATCTGGAGGGCAGCTGG + Intergenic
1061579104 9:131525970-131525992 TTCTTTGTCTGTAAGGCACAAGG + Exonic
1061829444 9:133281592-133281614 CTCTTGGTCTGCACGGGAGAAGG + Intergenic
1061897388 9:133655547-133655569 CTCTTTGTCTGCACGGGAGGAGG + Intronic
1062073884 9:134573974-134573996 CTCTTTGCCTGGGAGTTAGAGGG + Intergenic
1062169267 9:135125686-135125708 CTCTGTGTCCAGAAGGCAAAAGG + Intergenic
1185887453 X:3795627-3795649 CTCTTTTCCTGGCTGGCAGATGG + Intergenic
1185943509 X:4347953-4347975 CTGGCTCTCTGGAAGGCAGATGG + Intergenic
1186131704 X:6473686-6473708 CCCTTTCTATGCAAGGCAGAGGG + Intergenic
1186929040 X:14367855-14367877 CTCTCTTCCTGGATGGCAGATGG - Intergenic
1187479927 X:19646018-19646040 CCCTTTCTCTGGGAGGCAGGTGG - Intronic
1188204440 X:27336831-27336853 CCCTATCTCTCGAAGGCAGAGGG + Intergenic
1189633093 X:42975737-42975759 CCCTTTGTCTGGAGAGCACAAGG - Intergenic
1190391102 X:49932557-49932579 CTCTTTTGCTGGAACGTAGAAGG - Intronic
1192046563 X:67681387-67681409 CTCTTTGTCTAGGAAGCATATGG - Intronic
1193861664 X:86675075-86675097 ATCTTTGGTTGGGAGGCAGAGGG - Intronic
1193886993 X:86994519-86994541 CTCTTTCTTTGGAAAGGAGAGGG + Intergenic
1193926788 X:87496776-87496798 GTCTTTTCCTGGATGGCAGAGGG - Intergenic
1194526450 X:94983420-94983442 GTCTTTGTCTTCAAGGCAGCAGG - Intergenic
1195054150 X:101126777-101126799 ATCTTTGCCTGTAAGGAAGAAGG + Exonic
1195532495 X:105972433-105972455 CTCTTTTTCTGGAACTCTGATGG + Intergenic
1196781687 X:119389251-119389273 CACCTTTTCTGGATGGCAGATGG + Intergenic
1197356190 X:125439423-125439445 CTCTTGGTCTGGAGAGCATATGG - Intergenic
1197386958 X:125813806-125813828 CTCTCTGTCTGGTAGGGTGAGGG - Intergenic
1200774904 Y:7161511-7161533 CTCTTTTCCTGGCTGGCAGATGG - Intergenic
1200873356 Y:8126357-8126379 CTCTTTGTTCTTAAGGCAGAGGG + Intergenic
1201101835 Y:10683954-10683976 CGCTTGGACTGGAATGCAGAGGG + Intergenic
1201147059 Y:11070696-11070718 TTGTTTGTCTGAAACGCAGATGG - Intergenic
1201914465 Y:19167586-19167608 CTCTTTGTTCTTAAGGCAGATGG - Intergenic
1201963959 Y:19711131-19711153 TTCTTTGTCTTGTAGGCAGTTGG - Intronic