ID: 1124608760

View in Genome Browser
Species Human (GRCh38)
Location 15:31193277-31193299
Sequence CTGCTTTCCCTCAGGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124608754_1124608760 15 Left 1124608754 15:31193239-31193261 CCAGGACTTCTTCAGATCAGAGG No data
Right 1124608760 15:31193277-31193299 CTGCTTTCCCTCAGGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124608760 Original CRISPR CTGCTTTCCCTCAGGAAAAA TGG Intergenic
No off target data available for this crispr