ID: 1124610487

View in Genome Browser
Species Human (GRCh38)
Location 15:31204605-31204627
Sequence TGTGGGGGGCTTGCCGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124610485_1124610487 -9 Left 1124610485 15:31204591-31204613 CCTGACTGGTGATTTGTGGGGGG No data
Right 1124610487 15:31204605-31204627 TGTGGGGGGCTTGCCGCTGTAGG No data
1124610477_1124610487 22 Left 1124610477 15:31204560-31204582 CCTGTGATATTCACAAGTGGGGA No data
Right 1124610487 15:31204605-31204627 TGTGGGGGGCTTGCCGCTGTAGG No data
1124610472_1124610487 30 Left 1124610472 15:31204552-31204574 CCACTCTCCCTGTGATATTCACA No data
Right 1124610487 15:31204605-31204627 TGTGGGGGGCTTGCCGCTGTAGG No data
1124610481_1124610487 -7 Left 1124610481 15:31204589-31204611 CCCCTGACTGGTGATTTGTGGGG No data
Right 1124610487 15:31204605-31204627 TGTGGGGGGCTTGCCGCTGTAGG No data
1124610483_1124610487 -8 Left 1124610483 15:31204590-31204612 CCCTGACTGGTGATTTGTGGGGG No data
Right 1124610487 15:31204605-31204627 TGTGGGGGGCTTGCCGCTGTAGG No data
1124610475_1124610487 23 Left 1124610475 15:31204559-31204581 CCCTGTGATATTCACAAGTGGGG No data
Right 1124610487 15:31204605-31204627 TGTGGGGGGCTTGCCGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124610487 Original CRISPR TGTGGGGGGCTTGCCGCTGT AGG Intergenic
No off target data available for this crispr