ID: 1124610725

View in Genome Browser
Species Human (GRCh38)
Location 15:31206677-31206699
Sequence CCTATAAGGTACCCCCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124610716_1124610725 24 Left 1124610716 15:31206630-31206652 CCAAATTCCTTGATTCTTGGAGC No data
Right 1124610725 15:31206677-31206699 CCTATAAGGTACCCCCAGCATGG No data
1124610720_1124610725 0 Left 1124610720 15:31206654-31206676 CCAGAACTCCAAACAGTGAGGGG No data
Right 1124610725 15:31206677-31206699 CCTATAAGGTACCCCCAGCATGG No data
1124610717_1124610725 17 Left 1124610717 15:31206637-31206659 CCTTGATTCTTGGAGCTCCAGAA No data
Right 1124610725 15:31206677-31206699 CCTATAAGGTACCCCCAGCATGG No data
1124610722_1124610725 -8 Left 1124610722 15:31206662-31206684 CCAAACAGTGAGGGGCCTATAAG No data
Right 1124610725 15:31206677-31206699 CCTATAAGGTACCCCCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124610725 Original CRISPR CCTATAAGGTACCCCCAGCA TGG Intergenic
No off target data available for this crispr