ID: 1124612822

View in Genome Browser
Species Human (GRCh38)
Location 15:31220235-31220257
Sequence GACACAGGCTGAGCGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 348}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124612822_1124612834 29 Left 1124612822 15:31220235-31220257 CCATCCCCCGCTCAGCCTGTGTC 0: 1
1: 0
2: 1
3: 33
4: 348
Right 1124612834 15:31220287-31220309 TCCCTGGTGCCAAAAAGGCTGGG 0: 90
1: 1154
2: 1711
3: 1325
4: 910
1124612822_1124612833 28 Left 1124612822 15:31220235-31220257 CCATCCCCCGCTCAGCCTGTGTC 0: 1
1: 0
2: 1
3: 33
4: 348
Right 1124612833 15:31220286-31220308 GTCCCTGGTGCCAAAAAGGCTGG 0: 91
1: 1113
2: 1769
3: 1374
4: 958
1124612822_1124612830 13 Left 1124612822 15:31220235-31220257 CCATCCCCCGCTCAGCCTGTGTC 0: 1
1: 0
2: 1
3: 33
4: 348
Right 1124612830 15:31220271-31220293 TCTTCCATGAAACTGGTCCCTGG 0: 275
1: 558
2: 1130
3: 1239
4: 1262
1124612822_1124612829 6 Left 1124612822 15:31220235-31220257 CCATCCCCCGCTCAGCCTGTGTC 0: 1
1: 0
2: 1
3: 33
4: 348
Right 1124612829 15:31220264-31220286 AAAATTGTCTTCCATGAAACTGG 0: 366
1: 675
2: 884
3: 752
4: 745
1124612822_1124612832 24 Left 1124612822 15:31220235-31220257 CCATCCCCCGCTCAGCCTGTGTC 0: 1
1: 0
2: 1
3: 33
4: 348
Right 1124612832 15:31220282-31220304 ACTGGTCCCTGGTGCCAAAAAGG 0: 413
1: 844
2: 1234
3: 1037
4: 767
1124612822_1124612836 30 Left 1124612822 15:31220235-31220257 CCATCCCCCGCTCAGCCTGTGTC 0: 1
1: 0
2: 1
3: 33
4: 348
Right 1124612836 15:31220288-31220310 CCCTGGTGCCAAAAAGGCTGGGG 0: 91
1: 1146
2: 1621
3: 1295
4: 1028

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124612822 Original CRISPR GACACAGGCTGAGCGGGGGA TGG (reversed) Intergenic
900317059 1:2062275-2062297 GACAGAGGCTGAGCGGAGGTGGG - Intronic
900352877 1:2245047-2245069 GACAAAGGCTGAGCCTGGGAAGG - Intronic
900359074 1:2279268-2279290 GAGGCAGGCTGAGGGGTGGAAGG + Intronic
900415900 1:2534544-2534566 GAGCCAGGCTGACCTGGGGAAGG + Intergenic
901429997 1:9208177-9208199 AAAAAAGGCTGAGCGAGGGATGG - Intergenic
901465149 1:9416680-9416702 GACGCAGGCTGAGGGTGGGTGGG + Intergenic
902633462 1:17719645-17719667 GACACAGGCTTTGCTGGGAAGGG + Intergenic
902905362 1:19552692-19552714 GAAACAGGCTGAGGGGTAGAGGG - Intergenic
903210745 1:21816755-21816777 AAAAAAGGCTGAGCGGGGGATGG - Intronic
903500889 1:23799732-23799754 GGCAGAGGCTGAGCGGGGGTTGG - Intronic
904112049 1:28133780-28133802 AACACAGACTGTGCGGGGGATGG - Intergenic
904356355 1:29942635-29942657 GACACAGGCTCTGCTGGGGTGGG - Intergenic
904532860 1:31180762-31180784 GACAGAGGCTGAGTGTAGGAAGG + Exonic
904893329 1:33795479-33795501 CACACAGGCTGTGCAGTGGAGGG - Intronic
904966264 1:34376841-34376863 GACACAGGGTGAGGGGGAGGAGG - Intergenic
907053245 1:51343972-51343994 GAGACAGGAGGAGCTGGGGAAGG + Intronic
907372079 1:54010248-54010270 GGCACAGGCTGGGCTGGGGCTGG - Intronic
907768676 1:57437922-57437944 GGCAGAGGCAGAGCGGGGGCTGG - Intronic
911189119 1:94930087-94930109 GACACAAGCAGAGCAGGAGAGGG - Intergenic
912390143 1:109297284-109297306 GACACAGGGTGGGCGCAGGAGGG - Intronic
914339873 1:146750968-146750990 TTCAAAGGCTGAGTGGGGGAGGG - Intergenic
915235738 1:154480037-154480059 CACACAGGGTCAGCGGTGGAGGG + Exonic
915269644 1:154744642-154744664 GACAAAGGCAGAGCTGGGAATGG - Intronic
915393182 1:155562555-155562577 GAGTCGGGCGGAGCGGGGGACGG - Intronic
919920487 1:202164009-202164031 GAGACAGGGTGAGTGGGGCAGGG + Intergenic
920647996 1:207817341-207817363 GACTCAGGCTCAGCTGAGGATGG - Intergenic
920762212 1:208795536-208795558 GAAACAGGCGGAGGGGGGGCAGG + Intergenic
921089653 1:211830671-211830693 GCCACAGCCGGAGCGGGGCAGGG - Exonic
922116493 1:222618434-222618456 GGCGCAGGCAGAGCGGGAGAAGG - Intronic
923674839 1:236071455-236071477 GCCAGAGGCTGAGGGAGGGAGGG - Intergenic
1062836558 10:639897-639919 GATACAGGCCGGGCGGGGGAGGG - Intronic
1063474647 10:6317778-6317800 GACAGAGGCTGAGGGTGGAAAGG + Intergenic
1064592115 10:16904840-16904862 GAAACAGGCAGAGGGGGTGAGGG + Intronic
1066255176 10:33671548-33671570 GAAAGAGGCTGAGAGGGTGAGGG + Intergenic
1066669072 10:37817789-37817811 CACAAAGGCTCAGCTGGGGATGG - Intronic
1069695223 10:70381414-70381436 GACTCAGGCTGGCTGGGGGAGGG + Intronic
1070479701 10:76870235-76870257 GACTCAGGGTCAGCGTGGGAAGG - Intronic
1070782680 10:79146701-79146723 GACACAGGCAGGGCTGGGGCTGG + Intronic
1073009605 10:100349038-100349060 GAAGCAGGCTGGACGGGGGATGG - Intronic
1073143584 10:101264759-101264781 GACACAGGGTGGGATGGGGAGGG - Intergenic
1073216468 10:101839579-101839601 GACAGAAGCGGAGCAGGGGATGG - Intronic
1075015604 10:118908192-118908214 GAAACAGGCTGAGTGGGGCAGGG - Intergenic
1075622779 10:123939934-123939956 CACACAGGCAGAGCTGGGTAGGG + Intronic
1076795071 10:132794355-132794377 GACAGAAGCCGAGCGTGGGACGG + Intergenic
1076843890 10:133059762-133059784 GACCCAGGCTGAGTGGGGGGTGG - Intergenic
1077330702 11:1982703-1982725 CACACAGGCTGTGTGGGGCAGGG + Intronic
1078334424 11:10452095-10452117 GACAGAGGCTGAGCTAAGGATGG - Intronic
1079158245 11:17968848-17968870 GAGACAGGCAGTGCTGGGGAGGG + Intronic
1080616619 11:33950049-33950071 GAAACAAGCTGAGCCGGGGCTGG + Intergenic
1081623816 11:44634864-44634886 GACACATCCTGGGTGGGGGAGGG + Intergenic
1081816377 11:45945865-45945887 GACACAGGCTGAACAGGTGCAGG + Exonic
1082983509 11:59145269-59145291 GAGAGAGGCAGAGAGGGGGAAGG + Exonic
1083325771 11:61872249-61872271 GTCACAGGCTGGGCAGGGAAGGG + Intergenic
1083447113 11:62715457-62715479 GACACAGGGTGAAGGGGGGCAGG - Intronic
1083486867 11:62988575-62988597 GGCACAGGCTTAGAGAGGGAGGG - Intergenic
1083686431 11:64378844-64378866 GACACAGTCTGCATGGGGGAGGG + Intergenic
1084030000 11:66475776-66475798 GCCACGGGCTGGGCTGGGGAAGG - Exonic
1084567648 11:69940465-69940487 GACACAGGCTTTGGGGTGGATGG - Intergenic
1084860616 11:72015567-72015589 GACACAGGCCCAGCGGGAGAAGG - Exonic
1084966007 11:72744950-72744972 GCCCCAGGCAGAGCAGGGGAGGG + Intronic
1085459130 11:76682604-76682626 GTCACAGGCTGCTGGGGGGAAGG + Intergenic
1085507879 11:77070382-77070404 GGCACTGGCTGAGCAGGGGCTGG - Intronic
1089345971 11:117792129-117792151 GACAGAGGTAGAGAGGGGGAGGG - Intronic
1089523743 11:119083176-119083198 GACACAGGTTGAGGGGGAAAGGG - Intergenic
1090400331 11:126444791-126444813 GACCCAGGCTGAGGGAGGAAGGG - Intronic
1090803657 11:130189595-130189617 GACACAAGAGGAGCTGGGGAAGG + Intronic
1090854039 11:130596493-130596515 GACACAGCCTGAGTGAGGTAGGG - Intergenic
1090884681 11:130865399-130865421 GACACAGGCTGGGATGGAGATGG - Intergenic
1091142396 11:133246520-133246542 GAAACAGTCTGTGCAGGGGAAGG + Intronic
1202813682 11_KI270721v1_random:37882-37904 CACACAGGCTGGGTGGGGCAGGG + Intergenic
1091390442 12:122976-122998 GACACAGGCTGTGCTGTGGTGGG + Intronic
1091937576 12:4445737-4445759 GACCCAGGCTGAGCCGCGGCCGG + Intergenic
1092140852 12:6182486-6182508 GCCCCAGGATGGGCGGGGGAAGG + Intergenic
1093731268 12:22568276-22568298 GACACAGGATGCGGTGGGGAAGG + Intergenic
1096065176 12:48734057-48734079 CACATAGGCTGGGCGGGGGATGG - Intergenic
1096214794 12:49792979-49793001 GCCACAGGCTGGGGAGGGGAGGG + Exonic
1096229541 12:49889425-49889447 GCCTGAGGCTGAGCAGGGGAAGG - Intronic
1096627292 12:52903694-52903716 GACACGGGCTGAATGGGCGAGGG + Intronic
1096771567 12:53939018-53939040 GGCACGGGCGGAGCGGGGGGTGG + Exonic
1097015192 12:55981038-55981060 GACACCGGGGGAGCCGGGGAAGG + Intronic
1097896107 12:64825637-64825659 AACACAGGCTGACAGTGGGAAGG - Intronic
1097981606 12:65742039-65742061 GACACGGGCTGCGCGTGGGGTGG - Intergenic
1098243561 12:68492278-68492300 GGCACAGGCGGAAAGGGGGATGG + Intergenic
1099293369 12:80800197-80800219 GACACAGTCTGGGCCGGGTACGG + Intronic
1100980286 12:100157773-100157795 TACACAGGATGAACGGGGCAGGG + Intergenic
1102033800 12:109759670-109759692 GGCAGAGGCAGAGTGGGGGAAGG + Intronic
1102372763 12:112396063-112396085 GACACAGACTGGGCTGGGCATGG + Intergenic
1102626597 12:114240067-114240089 GGTGCAGGATGAGCGGGGGAAGG - Intergenic
1102882237 12:116494387-116494409 GATACAGGCTGAACTGGGAAGGG + Intergenic
1103627106 12:122227584-122227606 GACACAGGCAGAGGGCGGGCAGG - Intronic
1103904068 12:124318571-124318593 GACAAAGGCAGAGGTGGGGAGGG - Intergenic
1103944008 12:124516342-124516364 GGCTCAGGCTGAGTGGGAGACGG + Intronic
1103945740 12:124525444-124525466 CACACAGGCTGATGGGGAGATGG - Intronic
1104322041 12:127761159-127761181 GATCCAGGCTGAGCCGCGGAAGG + Intergenic
1104706966 12:130954835-130954857 CTCACCGGCTGAGCGGTGGATGG + Intronic
1106178480 13:27351274-27351296 AACCCAGCCTGAGCAGGGGAGGG + Intergenic
1107020378 13:35745062-35745084 GACACAGCCTGTGCTGAGGAAGG + Intergenic
1108030075 13:46220449-46220471 GACACAAGCTTGGTGGGGGAGGG - Intronic
1112653593 13:101424834-101424856 GACACGAGCTGAGAGGGAGAGGG + Intergenic
1113023466 13:105915013-105915035 CACACAGGGTGAGCTGGGGAGGG + Intergenic
1113346492 13:109483056-109483078 GACAGAGGAGGAGCGGGGAAGGG - Intergenic
1118699226 14:68416825-68416847 GACCCAGGCTGAGGGAGAGAAGG + Intronic
1120895432 14:89527106-89527128 GAAACAGGATGAGGGGGTGAAGG + Intronic
1121109183 14:91300804-91300826 GAAACAGGCTGGGAAGGGGAGGG - Intronic
1121122093 14:91382511-91382533 GAAACACGCTGAGCTGGAGATGG - Intronic
1121639134 14:95473558-95473580 GACAAAGGCTTGGCGGTGGAAGG + Intronic
1121764916 14:96478174-96478196 GACAGAGGGAGGGCGGGGGAAGG + Intronic
1122077622 14:99246157-99246179 GACCCAGGCCGAGTGGGGGAGGG + Intronic
1122353833 14:101112042-101112064 CACCCAGGCTGAGCTGGGGCTGG + Intergenic
1122794537 14:104199476-104199498 GACACAGGCTGAGCAGGTCAGGG + Intergenic
1123160469 14:106274077-106274099 AACACAGGCTGTGGAGGGGATGG + Intergenic
1123208229 14:106734705-106734727 AACACAGGCTGTGGAGGGGATGG + Intergenic
1123449495 15:20351080-20351102 GACAGAGGCTGAGCTGGAGAAGG - Intergenic
1124612822 15:31220235-31220257 GACACAGGCTGAGCGGGGGATGG - Intergenic
1127995748 15:64152349-64152371 GACAGAGGCTGGGCCGGGGCCGG - Intronic
1128052770 15:64678172-64678194 GTCAGAGGATGAGCGGTGGAAGG + Exonic
1128731972 15:70027290-70027312 GACACCGGCTGGGCAGGGAAGGG - Intergenic
1129478215 15:75802204-75802226 GACCCAGGCAGGGCGGGGTAGGG - Intergenic
1129696030 15:77741149-77741171 GACATTGGCTGGGCTGGGGAAGG + Intronic
1129772250 15:78209715-78209737 AACACAGGCTGAGATGGGGCAGG - Intronic
1130189165 15:81715199-81715221 GACAAAGGCTGGGAGGCGGAGGG - Intergenic
1130303936 15:82700294-82700316 GACACAGGGGTTGCGGGGGAGGG - Intronic
1131057385 15:89383732-89383754 AGCACAGGCTGAGGGGAGGAGGG - Intergenic
1131885541 15:96907994-96908016 GGCACAGGATGGGCGGGGGGAGG + Intergenic
1132204684 15:99978173-99978195 GACACAGGCTGCGTGGGAGGCGG + Intronic
1132465964 16:77660-77682 GTCACAGGCTGGTCGGGGGAAGG - Intronic
1132645627 16:998056-998078 CACACAGCCTGCGCGGGGGCTGG + Intergenic
1132750740 16:1456282-1456304 GACAGGGGCTGTGCAGGGGAAGG + Intronic
1133138795 16:3729945-3729967 GACCCAGACTTAGCGGTGGAGGG - Intronic
1134095709 16:11417110-11417132 GACAGAGGGTGAGGGGGGGTGGG - Intronic
1135302886 16:21345872-21345894 GCAACAGAGTGAGCGGGGGAAGG - Intergenic
1136049034 16:27637649-27637671 GGCACAGGCTGAGAGGAGGCAGG + Intronic
1136478395 16:30526802-30526824 GACACTTCCTGTGCGGGGGAGGG - Intronic
1136834884 16:33493525-33493547 GACCCAGCCTGGGTGGGGGATGG - Intergenic
1138278980 16:55758288-55758310 GACCCAGGCTGAGCATGGTAGGG - Intergenic
1138658967 16:58506842-58506864 GACGCAGGCTTAGAGGGGGCTGG - Intronic
1139022867 16:62773438-62773460 TACAAAGGCTGAGCCGTGGAGGG + Intergenic
1139635439 16:68255669-68255691 GACACAAGACGAGAGGGGGAGGG - Intronic
1139909979 16:70391716-70391738 GACACAGGCTGGCCGGGGCCTGG + Intronic
1139939804 16:70597005-70597027 CAAACAGGTTGAGCTGGGGACGG - Intronic
1139994418 16:70966442-70966464 TTCAAAGGCTGAGTGGGGGAGGG + Intronic
1140847523 16:78904585-78904607 GAGGCAGGCTGACCTGGGGAAGG - Intronic
1141187165 16:81796247-81796269 GAGACAGTCTGTGCTGGGGAGGG - Intronic
1141600603 16:85123947-85123969 GACACCGGCTGGGCCTGGGATGG + Intergenic
1141940805 16:87274737-87274759 GACACTGGCTGAGAGGAGCAAGG - Intronic
1142280970 16:89147338-89147360 GCCACAGAGTGAGCGGGGGAGGG + Intronic
1142281021 16:89147511-89147533 GTCACAGAGTGAGCGGGGGGGGG + Intronic
1203009919 16_KI270728v1_random:230507-230529 GACCCAGCCTGGGTGGGGGATGG + Intergenic
1203145050 16_KI270728v1_random:1793813-1793835 GACCCAGCCTGGGTGGGGGATGG - Intergenic
1142805554 17:2369488-2369510 GGCACAGGCTGGACGGGGGGAGG - Intronic
1143527026 17:7479027-7479049 GAGCCAGGCAGAGAGGGGGAGGG - Intronic
1143747473 17:9004447-9004469 GACATCTGCTGAGCGGGTGACGG + Intergenic
1143780188 17:9225291-9225313 CACACAGGCTGAGCTGAGGGTGG - Intronic
1145024543 17:19458110-19458132 GACTCAGGCCTAGCAGGGGAAGG + Intergenic
1146580820 17:34037142-34037164 CACAAAGGCTCAGCTGGGGATGG - Intronic
1146669006 17:34724018-34724040 GAAACAGGCTGAGCTGGAGCAGG + Intergenic
1146782731 17:35689451-35689473 GACACATACTGAGCTGGGGGTGG - Intronic
1147040009 17:37711241-37711263 GACACAGGCAGAGCAGGACAGGG + Intronic
1147406153 17:40213792-40213814 CACACAGGCTCAGCGGGGTGCGG + Intergenic
1147566057 17:41537039-41537061 GACCCAGCCTGAGCGGGTCAGGG - Intergenic
1147951767 17:44111443-44111465 GCCAGAGGCTGGGCTGGGGAAGG + Intronic
1147987132 17:44313089-44313111 GGCACAGGCTGAGCCAGGGCAGG - Exonic
1148683337 17:49486964-49486986 GACACAGGTGGAGGGTGGGATGG - Intergenic
1148796606 17:50200247-50200269 ACCACAGGGTGAGAGGGGGAGGG + Intronic
1149997515 17:61412654-61412676 GACACAGGCAGAGCCGGGTCCGG + Exonic
1150048732 17:61938157-61938179 GACCCAAGCTGAGCTGGGGGTGG + Intergenic
1150122162 17:62613030-62613052 CACAAAGGCTCAGCTGGGGATGG + Exonic
1150221405 17:63497612-63497634 GACACAGACTCAGATGGGGAGGG - Intronic
1150730363 17:67687710-67687732 CACACAGGCTGAGCAGTGAAGGG + Intronic
1151898500 17:76996613-76996635 GGAGCAGGCTGAGCTGGGGAAGG - Intergenic
1151990733 17:77572395-77572417 GACACAGGCTTCCCGGAGGAGGG + Intergenic
1152339137 17:79714806-79714828 GACAGAGGCTGAGCTGGAGAAGG + Intergenic
1152562442 17:81085334-81085356 GACACAGGCTGAGAGGTCGCAGG - Intronic
1152883561 17:82834327-82834349 GAGACAGGGTGAGTGGGAGATGG + Intronic
1153943175 18:9994475-9994497 GACACAGGGGAAGCAGGGGAGGG + Intergenic
1154175738 18:12086611-12086633 GCCACAGCCTGAGCCAGGGAAGG - Intergenic
1155125357 18:22870015-22870037 GTCAGAGGCGGAGTGGGGGAGGG + Intronic
1155795574 18:30032466-30032488 GACACAGGCTGTGTAGGGAAAGG + Intergenic
1157567465 18:48689279-48689301 GACAGAGGCTGTGCTGAGGAAGG - Intronic
1157972054 18:52282032-52282054 GAGACAGGCAGAGAGGGAGAGGG + Intergenic
1158800289 18:60898978-60899000 GACACTGGCTGAGGGTGGGTTGG + Intergenic
1160021777 18:75186959-75186981 CACACAGGCTGAGGGGGACAGGG - Intergenic
1160691001 19:460699-460721 GACAGCGGCTGAGCGCGGGCAGG + Exonic
1160835516 19:1122858-1122880 GACACAGGCTGGGCTGGGTTGGG + Intronic
1160911590 19:1476376-1476398 GAGGCACGCTGTGCGGGGGACGG - Intronic
1160947701 19:1651401-1651423 GAAAAAAACTGAGCGGGGGAGGG - Intronic
1161169721 19:2806780-2806802 AACACAGGCCGAGAGGGGCAGGG + Intronic
1161533413 19:4804004-4804026 GACCCCGGCTGAGGAGGGGACGG - Intergenic
1162419776 19:10559535-10559557 GGCCCAGGCAGAGAGGGGGAGGG + Intronic
1162558417 19:11401962-11401984 GACCCAGGCTCAGCTGGGGTGGG + Intronic
1162951485 19:14074100-14074122 CACCCAGGCTGCGCGGGGGTGGG + Intronic
1163071221 19:14843638-14843660 GAGAAAGGCTGAGAGTGGGAAGG - Intergenic
1163666644 19:18606720-18606742 GACGCAGGCCGGGCGCGGGAGGG + Exonic
1164037561 19:21467815-21467837 GACTCAGGCTGTGTGGGGGTAGG + Intronic
1165353080 19:35287316-35287338 GGCCCAGGCTGGGCGGGAGAGGG + Intergenic
1165394769 19:35558213-35558235 GCCATAGGCGGAGCGGGAGATGG + Intronic
1165898252 19:39156109-39156131 GACTTAGCCTGACCGGGGGAGGG - Intronic
1166121375 19:40689635-40689657 GATACAGGCTGGGCTGGGGGCGG - Intronic
1166213115 19:41319967-41319989 GAGTCAGGCTGGGCAGGGGAGGG - Intronic
1166214468 19:41326163-41326185 GACACAGCCTGCGCTGGGTATGG + Intronic
1166671157 19:44710355-44710377 GGCACAGGCTGAGCGTGGGGTGG + Intronic
1166982763 19:46640934-46640956 GAAACAGGCTGAGGGGGACAGGG - Intergenic
1166997627 19:46727346-46727368 GAAACAGGATGAGCAGGGCACGG + Intronic
1167169485 19:47821792-47821814 GACATTGGCTGGGAGGGGGAGGG - Intronic
1167234006 19:48302937-48302959 GAGGCAGGCTGAGGGAGGGAAGG + Intronic
1167409731 19:49337857-49337879 GGCACAGCCTGAGAGGGGGAGGG + Intronic
1167414968 19:49365260-49365282 GAGACAGGAGGAGAGGGGGATGG + Intronic
1168059561 19:53883331-53883353 GACACAGCCTGTGGTGGGGAGGG + Intronic
925300492 2:2808189-2808211 GACACAGGCTGACTGGGGTGTGG + Intergenic
925636021 2:5942010-5942032 GACACAGGCTCTGTGGAGGATGG - Intergenic
925659852 2:6190892-6190914 GACACAAGAGGAGCTGGGGAGGG - Intergenic
925905038 2:8535184-8535206 GGTCCAGGCTGAGCGGGTGAGGG + Intergenic
926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG + Intergenic
927496523 2:23555121-23555143 GACACAAGTTGAGGGGGGGGGGG - Intronic
927574459 2:24189895-24189917 GAGCCAGGCTGCTCGGGGGACGG + Intronic
927905006 2:26849294-26849316 GACCCGCGCTGTGCGGGGGAGGG + Intronic
927990145 2:27442083-27442105 CACACAGGCTGGGCGGGAGCCGG - Exonic
928099325 2:28426437-28426459 GACAGATGCGGGGCGGGGGAGGG - Intergenic
930136024 2:47905353-47905375 GACCCAAGCTGAGCGGAGGCGGG - Intronic
932773476 2:74514273-74514295 GAGCCAGGCTCAGCGCGGGAGGG - Intronic
934514873 2:94980498-94980520 GACACGGGCAGAGCGGGGCATGG - Intergenic
936040352 2:109145108-109145130 GACACAGACAGAGCCGGTGAGGG - Intronic
938772240 2:134510613-134510635 GACACAGGCAGAGGAGGAGAAGG + Intronic
939871682 2:147533204-147533226 TAGACAGGCTGAGAGGAGGAAGG + Intergenic
939873706 2:147553034-147553056 GACAAAGGCTGAGCAGAGGCAGG - Intergenic
941089377 2:161157338-161157360 GACACAGGCTGAAGGAGGCAAGG + Intronic
942489241 2:176473504-176473526 AATACAGGCTGACCTGGGGAAGG - Intergenic
945198772 2:207261421-207261443 GGCACAGGATGTGCGGGGGCAGG + Intergenic
946779333 2:223176780-223176802 TCCACAGGATCAGCGGGGGATGG - Intronic
947876155 2:233469511-233469533 GCCACAGGCTGAGAGGGCGGAGG - Exonic
948420967 2:237859759-237859781 GACACCGGCTGGCCAGGGGAAGG - Intronic
948704572 2:239780863-239780885 GACACAGGCAGATCTGGGCAGGG - Intronic
1168841546 20:913016-913038 GGCACAGGCTGAGCAGATGATGG + Intronic
1168862205 20:1053682-1053704 GAAACAGGCTGAGGAGGGAAAGG - Intergenic
1169201483 20:3712384-3712406 GAAACTGGCTGAGCGGGATAGGG - Intergenic
1169942418 20:10951455-10951477 GACAGAGGCTGAGGTGGAGAAGG + Intergenic
1170551667 20:17482100-17482122 GACAGAGGCGGAGCTGGGGAGGG - Exonic
1170855403 20:20048926-20048948 TACACAGGCACAGTGGGGGAAGG + Intronic
1171958589 20:31477369-31477391 GACATAGGGTGAGTGGGGGAAGG + Intronic
1172013961 20:31862116-31862138 AACAAAGGATGAGAGGGGGAGGG - Intronic
1173443334 20:43096591-43096613 TACACAGGCAGAGCTGTGGATGG - Intronic
1174086760 20:48014371-48014393 GGAACAGGCTGAGCGGCAGAGGG - Intergenic
1175943019 20:62546572-62546594 CACACAAGCTGAGCGGAGGGCGG - Intergenic
1176014463 20:62922717-62922739 GACACAGCCTGTGCTGGCGAGGG + Intronic
1176097156 20:63349453-63349475 GTCCCAGGCTGAGCGGGGCAGGG - Intronic
1176302046 21:5103025-5103047 GAGACAGGCCTGGCGGGGGAGGG + Intergenic
1179446181 21:41432392-41432414 GACACTGGCTGAGCTGTCGATGG + Intronic
1179597941 21:42455662-42455684 GATACAGGCTGGGAGAGGGAAGG + Intergenic
1179854983 21:44158875-44158897 GAGACAGGCCTGGCGGGGGAGGG - Intergenic
1179937433 21:44614241-44614263 CACACGGTCTGAGCTGGGGATGG + Intronic
1179991073 21:44948540-44948562 GACACAGGCAGGGTGGGGCAAGG + Intronic
1179991443 21:44950144-44950166 GACACAGGCAGGGTGGGGCAAGG - Intronic
1180174003 21:46078741-46078763 GGCAGAGGCTGAGCTGGAGAGGG + Intergenic
1180987208 22:19912004-19912026 GCCACAGGCTGAGGTGGGCAGGG + Intronic
1181085877 22:20439084-20439106 GGCACAGGCAGAGAGTGGGATGG + Intronic
1181631728 22:24155254-24155276 GAAACAGGCTCAGGAGGGGAGGG - Intronic
1182772094 22:32803198-32803220 GACACAGGCAGAGGGCGGCAAGG - Intronic
1183491740 22:38120555-38120577 GACACCTGCTGAGCGCAGGAGGG - Intronic
1183543521 22:38443474-38443496 GTCACAGACTGAGATGGGGAAGG - Intronic
1183618694 22:38960219-38960241 GACAGAGGCTGTGCTGGGTAGGG - Intronic
1183623897 22:38990164-38990186 GACAGAGGCTGTGCTGGGTAGGG - Intronic
1183945772 22:41324975-41324997 GGCCAAGGCAGAGCGGGGGAAGG - Intronic
1183984740 22:41563181-41563203 CACACAGGCTGTGTGGGGGAAGG + Intronic
1184920254 22:47600786-47600808 CACACAGGCTGGGAGGGGCAGGG - Intergenic
1185335538 22:50269595-50269617 GACAGAGTCTGGGTGGGGGAGGG - Intronic
949956278 3:9271438-9271460 GACATAGGCTGTCCTGGGGAGGG - Intronic
950004504 3:9682967-9682989 TCCACAGGCTGAGTGGTGGAGGG + Intronic
950111251 3:10420136-10420158 GGCACAGGCTGAGTGGGGGAGGG + Intronic
950406312 3:12807291-12807313 GACCCAGGCTGAGCAGGGAGTGG - Exonic
950903935 3:16520556-16520578 GGCACAGGGTGGGCGGGGGTGGG + Intergenic
952858879 3:37795695-37795717 GTAGCAGGCTGAGCTGGGGAAGG - Intronic
952867079 3:37861686-37861708 GACACAGGGTGAGTGGAGGGCGG - Intergenic
953530487 3:43735863-43735885 GACACAGGCTGCGGGAGGCAGGG + Intergenic
953913559 3:46904685-46904707 AAGACGGGCTGAGCGGGAGATGG - Intergenic
954222979 3:49165961-49165983 CACACAGGCAGACCGGGGGAGGG + Intronic
954415366 3:50390814-50390836 AGCACGGGGTGAGCGGGGGAAGG + Intronic
955214972 3:56977609-56977631 TACACAGGCTGACAGGGAGATGG + Intronic
956205844 3:66753925-66753947 GACACAGGTTGAGTCTGGGATGG + Intergenic
960073784 3:113460318-113460340 GAAACAGGCTGAGAGAGGGTTGG - Intronic
961552634 3:127677849-127677871 GGCTCAGGCAGAGCTGGGGATGG + Intronic
965521449 3:169671444-169671466 GCCACAGGCTGACTGGGAGATGG - Intergenic
965834905 3:172840631-172840653 GACACAGGGTGAAAGGGGAAAGG - Intergenic
966917490 3:184593098-184593120 GGCCCTGGCTGAGCAGGGGAGGG + Intronic
966924059 3:184633296-184633318 GGCAGGGGCTGAGCTGGGGAGGG - Intronic
967809715 3:193746550-193746572 GATACAGGCTGAGAGTGGCAAGG - Intergenic
968445810 4:651473-651495 GAGACAGACTGAGTGTGGGAGGG + Intronic
969398627 4:6939042-6939064 GCCACCGGCTGAGCCGGAGAGGG - Intronic
969517279 4:7654711-7654733 GTGACAGGCTGAGCAGTGGAAGG - Intronic
973003510 4:44981854-44981876 GACACATGCTGGGCTGGTGACGG - Intergenic
974145646 4:57943937-57943959 GCCAGAGGCTGGGTGGGGGATGG + Intergenic
977423532 4:96835158-96835180 GACAGAGGGTGTGCTGGGGAAGG + Intergenic
979993582 4:127404565-127404587 GACACAAGATGAGAGAGGGAGGG + Intergenic
980099005 4:128522699-128522721 GATAGAGGCTGAGTGGGGAATGG - Intergenic
985228438 4:187788826-187788848 GACACAGGATGAGCCGGGTGCGG + Intergenic
986306930 5:6523022-6523044 CACACAGGCTGAGGCAGGGATGG + Intergenic
986415734 5:7526119-7526141 GACAGAGCCTGAGCAGAGGAGGG - Intronic
987468156 5:18296717-18296739 GGCACAGGCTGAGGGAGAGAAGG + Intergenic
992483273 5:77171916-77171938 GGCACAGGATGAGGGGAGGAAGG + Intergenic
993909509 5:93664109-93664131 CACCCAGGCTGGGCGGGGGTGGG + Intronic
995145261 5:108781480-108781502 AACACAGGCTGGGCTGGGCACGG - Intronic
995376912 5:111484211-111484233 GGCACAGGCTGAGCTGATGAAGG + Exonic
997593091 5:135087444-135087466 GGCACTGGCTGAGGGGAGGAGGG + Intronic
998131795 5:139655187-139655209 GGGACAGGCTGAGGGTGGGATGG - Intronic
1000065937 5:157693500-157693522 GTCACAGGATGAGAGGGGGCTGG + Intergenic
1000220146 5:159207893-159207915 GACCCAGGCTGAGCGGCCGATGG - Intronic
1001529987 5:172454679-172454701 GACAAAGGCCGGGCGGGGGCCGG - Intergenic
1002845749 6:942850-942872 AACACAGGTTGAGTGGGAGAGGG + Intergenic
1003137055 6:3441730-3441752 GGCACAGGATGAGCGGGGCAGGG - Intronic
1003374932 6:5568126-5568148 GACACAGACAGAAAGGGGGAAGG - Intronic
1005260862 6:24057853-24057875 GACAGAGGCTGAGTGGGGACAGG - Intergenic
1005578565 6:27212322-27212344 GAGACGGGCAGGGCGGGGGAGGG + Intergenic
1005947347 6:30604042-30604064 TATCCAGGCTGAGCGGGAGAAGG - Exonic
1006003209 6:30982865-30982887 GACACAGTCTGATGGGAGGAGGG - Intergenic
1006085094 6:31589673-31589695 CACACAGGCTCAGGGAGGGAAGG + Intronic
1007714295 6:43845528-43845550 GACACAGGCTGAGCCCCGGGAGG - Intergenic
1012542375 6:100376278-100376300 GACTCAGGCTCAGGGGAGGAGGG - Intergenic
1015199720 6:130565653-130565675 GACACAGGGTGGGCAGGTGAGGG + Intergenic
1015848106 6:137542928-137542950 GTCACAGGCTGGGAGGAGGAGGG + Intergenic
1016858466 6:148695197-148695219 GACAGAGGCTGAGAAGGGGATGG - Intergenic
1017448984 6:154536412-154536434 GAAACAGGGTGGGTGGGGGAAGG - Intergenic
1017501133 6:155024057-155024079 GACACAGGCTTAGAGAGGGTGGG + Intronic
1017767754 6:157620726-157620748 CACTCAGGCTGATCGGGTGATGG - Intronic
1018701825 6:166433289-166433311 TACAGATGCTGGGCGGGGGAGGG - Intronic
1018733297 6:166669262-166669284 GAGACAGGCAGCCCGGGGGAAGG - Intronic
1018748914 6:166784933-166784955 TACACGGGCTGAGCTGGGGCTGG + Intronic
1018792339 6:167158012-167158034 GAAAGAGGATGAGCAGGGGAGGG + Exonic
1019287758 7:232047-232069 GGGACACGCTGAGCCGGGGAAGG + Intronic
1019332710 7:468579-468601 GAAATAGGCTGTGAGGGGGATGG - Intergenic
1019513674 7:1430405-1430427 GACTTGGGCTGAGCAGGGGAGGG - Intronic
1020025281 7:4895394-4895416 GACACAGGCTAGGGGTGGGATGG + Intergenic
1021630137 7:22636961-22636983 TACCGAGGCTGAGCGGGGGCAGG - Intergenic
1022342906 7:29485813-29485835 GCAGCAGGCTGAGTGGGGGAAGG - Intronic
1022466932 7:30658277-30658299 GAAACAGGCTGAACGAGGGCAGG - Intronic
1025191427 7:56898650-56898672 GCCACAGCCTGAGAGGGGGTTGG - Intergenic
1025680521 7:63678284-63678306 GCCACAGCCTGAGAGGGGGTTGG + Intergenic
1026842648 7:73679035-73679057 CAAACAGGCTGAGAGAGGGACGG - Intergenic
1026928549 7:74210287-74210309 TACACAGGCTGGACAGGGGAAGG - Intronic
1027813470 7:82936977-82936999 GTCAGAGGCTAAGCGGGGAAGGG + Intronic
1029204288 7:98859559-98859581 GAGACAGGGTGAGCAGGGAAAGG + Intronic
1029458786 7:100683972-100683994 GATACAGGGTGGGGGGGGGATGG - Intronic
1032677216 7:134142054-134142076 GACACATGCAGACCTGGGGAAGG - Intronic
1032986557 7:137343762-137343784 GACGAAGGCTGGGCGAGGGAGGG + Exonic
1034533192 7:151710264-151710286 GAGACAGGCTGGGCGGGGCACGG - Intronic
1034555711 7:151849202-151849224 GACACAGGCTGCCTGGGGAAAGG + Intronic
1034992081 7:155554287-155554309 GCAACAGGCTGAGTGGGGCAGGG + Intergenic
1035202634 7:157277076-157277098 GCCCCAGACTGAACGGGGGACGG - Intergenic
1035226967 7:157439044-157439066 GACACAGGCTGAGGAGGGACAGG - Intergenic
1035265439 7:157688415-157688437 CCCAGAGGCTGAGCAGGGGAAGG + Intronic
1035814989 8:2529440-2529462 GACACTGGGTAAGCGGGAGATGG - Intergenic
1036776732 8:11617899-11617921 GCCACAGGCAGGGCGGGGGAGGG + Intergenic
1039421940 8:37450598-37450620 GACCCTGGCTGAGTGGGGCACGG + Intergenic
1039478051 8:37851577-37851599 CACACAGGCTGGGAGGGGGCAGG + Intergenic
1039950856 8:42171717-42171739 GACGCCGGCTGAGAGGGAGAAGG - Intergenic
1041753584 8:61288327-61288349 GGCGCAGGCTGAGCGGGCGCCGG - Intronic
1042171935 8:66000087-66000109 GACACAGACAGAGGGAGGGAGGG - Intergenic
1046738156 8:117799688-117799710 GAATCCGGCTGAGTGGGGGAGGG - Exonic
1047012797 8:120690765-120690787 GGTACAGGCTGAGCAGGGTATGG - Intronic
1048390459 8:133958836-133958858 TACACAGGCAGTGCGGGGAAAGG + Intergenic
1049299962 8:141864331-141864353 GGCACCTGCTGAGCTGGGGAGGG - Intergenic
1049337793 8:142095805-142095827 GACCCAGCCTGAGCAGGGGATGG + Intergenic
1049473488 8:142786569-142786591 GGCACGGGCTGGGCGGGGGTGGG + Exonic
1049685429 8:143937450-143937472 GACCCAGGCTGAGGGAAGGAAGG + Intronic
1049841754 8:144777665-144777687 GGCACAGGCAGAGGGGGTGATGG + Intronic
1051657598 9:19397844-19397866 AACACAGGCAGAGTGAGGGAAGG + Intergenic
1056604946 9:88077858-88077880 GAGACAGAGGGAGCGGGGGAGGG + Intergenic
1057498526 9:95578690-95578712 AACACAGACTAAGCGGGGAAGGG + Intergenic
1060897065 9:127225014-127225036 GTAACAGGCTGAGCGGGCGCGGG + Intronic
1060969818 9:127731655-127731677 GACACAGGGTGTGGGGTGGAGGG + Exonic
1061139145 9:128753713-128753735 CACACTGGCTGGGCTGGGGATGG + Intronic
1061573796 9:131493794-131493816 CACACAGGCTGAGCGGGCCTAGG + Intronic
1062052930 9:134456833-134456855 GATGCAGGCTGAGCAGGGGAAGG - Intergenic
1186457569 X:9722061-9722083 GAGACAGGGTCAGCGGGGCACGG - Intergenic
1186998526 X:15150077-15150099 GAGCCAGGCTGAGAAGGGGAAGG - Intergenic
1187516123 X:19972658-19972680 GAAACGGGCTAAGCAGGGGAGGG - Intergenic
1187862599 X:23696578-23696600 GAAACAGGCTTAGAGAGGGAAGG - Intergenic
1188854870 X:35181558-35181580 GTCACAGGGTGAGTGGAGGACGG - Intergenic
1190188779 X:48258147-48258169 GAGACAAGCTGAGAGGAGGAAGG - Intronic
1192853379 X:74981177-74981199 GACACTGGCGGATGGGGGGATGG - Intergenic
1196750040 X:119107800-119107822 CCCACAGGCTGAGACGGGGAAGG + Intronic
1197721258 X:129746291-129746313 GACTCAGGCTGAGCGGCAGATGG + Exonic
1198518445 X:137429960-137429982 GGTACAGGTAGAGCGGGGGAGGG + Intergenic
1199942160 X:152637693-152637715 GACACAGGCAGGGCGGGGCCGGG - Intergenic
1200207316 X:154326258-154326280 CAGGCAGGCTGAGCAGGGGATGG - Intronic