ID: 1124616276

View in Genome Browser
Species Human (GRCh38)
Location 15:31244661-31244683
Sequence TGGAAGAATCGGTCTGCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124616276_1124616279 -1 Left 1124616276 15:31244661-31244683 CCTAGAGCAGACCGATTCTTCCA No data
Right 1124616279 15:31244683-31244705 AGCTGCATCTCTGAGCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124616276 Original CRISPR TGGAAGAATCGGTCTGCTCT AGG (reversed) Intergenic
No off target data available for this crispr