ID: 1124616995

View in Genome Browser
Species Human (GRCh38)
Location 15:31249078-31249100
Sequence CGCCCTCGCTGGCTGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124616995_1124617008 25 Left 1124616995 15:31249078-31249100 CCTCCCTGCAGCCAGCGAGGGCG No data
Right 1124617008 15:31249126-31249148 CCTGGCCTGTGCCTCTCTGGAGG No data
1124616995_1124617003 7 Left 1124616995 15:31249078-31249100 CCTCCCTGCAGCCAGCGAGGGCG No data
Right 1124617003 15:31249108-31249130 GGCTGTCTGCCGCCAGAGCCTGG No data
1124616995_1124617009 26 Left 1124616995 15:31249078-31249100 CCTCCCTGCAGCCAGCGAGGGCG No data
Right 1124617009 15:31249127-31249149 CTGGCCTGTGCCTCTCTGGAGGG No data
1124616995_1124617006 22 Left 1124616995 15:31249078-31249100 CCTCCCTGCAGCCAGCGAGGGCG No data
Right 1124617006 15:31249123-31249145 GAGCCTGGCCTGTGCCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124616995 Original CRISPR CGCCCTCGCTGGCTGCAGGG AGG (reversed) Intergenic
No off target data available for this crispr