ID: 1124618129

View in Genome Browser
Species Human (GRCh38)
Location 15:31257177-31257199
Sequence AGTGTCTGGTGAGGGCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 5, 1: 7, 2: 23, 3: 46, 4: 361}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124618129_1124618134 2 Left 1124618129 15:31257177-31257199 CCAGGAAGCCCTCACCAGACACT 0: 5
1: 7
2: 23
3: 46
4: 361
Right 1124618134 15:31257202-31257224 TTCTGCTGGTACCTTGATTTTGG No data
1124618129_1124618135 3 Left 1124618129 15:31257177-31257199 CCAGGAAGCCCTCACCAGACACT 0: 5
1: 7
2: 23
3: 46
4: 361
Right 1124618135 15:31257203-31257225 TCTGCTGGTACCTTGATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124618129 Original CRISPR AGTGTCTGGTGAGGGCTTCC TGG (reversed) Intergenic
900131939 1:1090992-1091014 AGTGAACGGTGAGGGCGTCCAGG + Intronic
901064851 1:6489789-6489811 AGTATCTGGGGATGGCTGCCAGG + Intronic
901185277 1:7368871-7368893 AGTGACTGGCAAGGGCTTCGTGG - Intronic
901218919 1:7571195-7571217 AGTGTCTGCTGAGGGCTTTCTGG + Intronic
901857249 1:12052467-12052489 AGTGGTCAGTGAGGGCTTCCTGG - Intergenic
902295524 1:15464263-15464285 AGGGTCTGATGAGGGCTCCAGGG - Intronic
902298415 1:15484164-15484186 AGGGTCTGATGAGGGCTCCAGGG - Intronic
902609812 1:17590381-17590403 AGTGCCTGGTGTGTGATTCCTGG + Intronic
903939501 1:26919605-26919627 GGTGTGTGGAAAGGGCTTCCAGG - Intronic
904865911 1:33578734-33578756 AGTCCCTGGTGGGGTCTTCCAGG + Intronic
907009284 1:50948373-50948395 AGCTTCTGGTGAGGGCCTCAAGG + Intronic
907088896 1:51706157-51706179 ATTCTCTGGTGAAGGCTTCTAGG + Intronic
907300700 1:53484833-53484855 AGTGTATGGTGAGGCCATGCCGG + Intergenic
907879967 1:58539780-58539802 ATTGCCTGGAGAGTGCTTCCAGG + Intronic
910268563 1:85367688-85367710 GGTGTCTGTTGAGAGGTTCCTGG + Intronic
910695875 1:90015327-90015349 AGTGTATGGTGAAGGATACCAGG + Intronic
910898387 1:92092496-92092518 GGGTTCTGGTGAGGGCTTCCTGG - Intronic
911716649 1:101141041-101141063 AGTGTCTGGTGAGGGCTTTACGG + Intergenic
913046619 1:115078642-115078664 GGATTCTGGTGAGGGCTCCCTGG - Intronic
914076196 1:144353529-144353551 AGTGTCTGGTGTGGCCTTATTGG + Intergenic
914102982 1:144612967-144612989 AGTGTCTGGTGTGGCCTTATTGG - Intergenic
916264496 1:162877019-162877041 GGTGTCTGATGAGTGTTTCCTGG - Intergenic
916679275 1:167089379-167089401 AGACACTGTTGAGGGCTTCCAGG - Intronic
917524433 1:175774593-175774615 AGTCTCAGGTGTGGGCTTTCTGG - Intergenic
918511575 1:185318314-185318336 AGAGTTTGGTAAAGGCTTCCAGG + Intergenic
919461848 1:197885949-197885971 AGTGTCTGGTGAGGGCTCTCTGG + Intergenic
919974847 1:202603677-202603699 AGTGTGTTGGGAGGGGTTCCAGG - Intronic
920435066 1:205942241-205942263 AGTGCCTGGGAAGGCCTTCCTGG + Intronic
921126314 1:212181091-212181113 AGTGTCTGGTGACTGCTTTCTGG - Intergenic
921130730 1:212217409-212217431 GGTGTCTGGTGAGGGGTTTCTGG + Intergenic
922418347 1:225442348-225442370 AGAGCCCTGTGAGGGCTTCCTGG + Intergenic
922724681 1:227917400-227917422 AGAGGCCGGTGGGGGCTTCCTGG - Intergenic
922929245 1:229376008-229376030 TGCTTCTGGTGAGGGCTTCAGGG + Intergenic
923449848 1:234106264-234106286 AGTGTCTGCTGGGGACTTCTGGG + Intronic
1062836200 10:637459-637481 TTTGTCTGGTGAGGGCTTCCTGG + Intronic
1062931144 10:1353508-1353530 AATGTCTGGGGAGGTCTTGCTGG - Intronic
1063608513 10:7543586-7543608 AGGGTCTGCAGACGGCTTCCCGG - Intergenic
1063667653 10:8073867-8073889 TGTGTCTGGAGAGGGCGGCCGGG - Exonic
1065068737 10:22000817-22000839 TGTGTCTGGTGAGGGCCTTCTGG - Intronic
1065362180 10:24898974-24898996 GGGTTCTGGTGAGGGCTTCCGGG - Intronic
1065610776 10:27468933-27468955 AATGTCTGGGGAGGTCTTGCTGG - Intergenic
1065664598 10:28044184-28044206 TGCTTCTGGTGAGGGCTTCAGGG - Intergenic
1066779144 10:38924156-38924178 AGTGTCTGGTGAGGCGTTATTGG + Intergenic
1069286757 10:66724296-66724318 ACTATCTTGTGAGGACTTCCTGG - Intronic
1070062715 10:73000622-73000644 GGCATCTGGTGAGGGCTTCACGG + Intergenic
1070284133 10:75071338-75071360 AGTGTCTGGGGAAGGCTTGGTGG + Intergenic
1070637276 10:78139587-78139609 AGGCGCTGGTGAGGGCTGCCCGG - Intergenic
1071411712 10:85403254-85403276 ACTGTCTGTAGAGGTCTTCCTGG - Intergenic
1073709134 10:106018748-106018770 AATGTCTGGAGAGGTCTTGCTGG + Intergenic
1074123138 10:110508157-110508179 AGTTTCTCGTCAGGGTTTCCTGG - Intronic
1076386156 10:130057469-130057491 AGTATTTGGTGAGGATTTCCTGG - Intergenic
1076534919 10:131170772-131170794 AGGGACTGGGGAGGGCATCCAGG + Intronic
1076627715 10:131832170-131832192 AGTGGCTGGTGCAGGCCTCCCGG + Intergenic
1076846163 10:133070511-133070533 AGTGAGTGGTGAGGGCCTCAGGG - Intergenic
1077254064 11:1572725-1572747 TGGGTCTGGGGAGGGCTCCCCGG - Intergenic
1077472356 11:2769971-2769993 AGGGTCTGGTCAGGGCTTATGGG + Intronic
1077638594 11:3861003-3861025 GGTGGCTGCAGAGGGCTTCCTGG + Intronic
1078480741 11:11673139-11673161 AGTTTCTGGGGAGGCCTTCCTGG + Intergenic
1079986138 11:27202638-27202660 TGTGTCTGGGTAGGGCTTCCAGG + Intergenic
1080133107 11:28819515-28819537 TGTTTCTGGTGAGGGCTTCAGGG + Intergenic
1080981142 11:37407749-37407771 ACTCTCTGGTGAAGGTTTCCCGG - Intergenic
1081167534 11:39824089-39824111 AGTTTCTGGTGAGGGCTTCTGGG + Intergenic
1081431656 11:42983135-42983157 AGGGTGTGGTGTGGGCTTCCAGG - Intergenic
1081777598 11:45686248-45686270 AGTGCCTGGTAAGGGCTTTTGGG - Intergenic
1081914845 11:46724104-46724126 AATGGCTAGGGAGGGCTTCCCGG - Intronic
1082909409 11:58353660-58353682 TGTGCATGGTGTGGGCTTCCTGG + Intergenic
1083256823 11:61501644-61501666 TGCATCTGGTGAGGGCTTCAGGG + Intergenic
1083534764 11:63457504-63457526 AATGTCTGGGGAGGTCTTGCTGG - Intergenic
1084343764 11:68528764-68528786 AGGGTCTGGTGACTGCTTCCAGG - Intronic
1084448564 11:69218628-69218650 AGGGTCTGGTGAGGGCAGGCTGG + Intergenic
1084939659 11:72605747-72605769 TGGGGCTGGAGAGGGCTTCCTGG + Intronic
1085607490 11:77915332-77915354 AGTGGCTGGTGAGACCCTCCAGG + Intronic
1086005373 11:82029811-82029833 AATGTTTGGAGAGGTCTTCCTGG - Intergenic
1087369618 11:97266414-97266436 TGCATCTGGTGAGGGCTTCAGGG + Intergenic
1087789179 11:102389347-102389369 AGCTTCTGGTGAGGGCCTCATGG + Intergenic
1088376497 11:109147079-109147101 AGCTTCTGGTGAGGGCCTCAGGG + Intergenic
1088749151 11:112829184-112829206 AGTGGATGGTGAAGGCTTCCTGG - Intergenic
1089617262 11:119701894-119701916 AATGTCTGGGGCTGGCTTCCTGG - Intronic
1089707348 11:120289199-120289221 ATTGTCTGTTGAATGCTTCCAGG - Intronic
1089731096 11:120519468-120519490 AGTGTCGGGTGAGGGCTTTTGGG - Intronic
1089869972 11:121663765-121663787 AGGGTGTGGAGAGGGCTTGCTGG - Intergenic
1090039499 11:123277840-123277862 AGCTTCTGGTGAGGGCTTCAGGG + Intergenic
1090474706 11:127009441-127009463 ACTGTCTGGTGAGGGCTTCCTGG + Intergenic
1092580514 12:9835898-9835920 AATGTCTGGGGAGGTCTTGCTGG + Intronic
1092892272 12:12980002-12980024 AGTGTCTGGTGCAGGCATGCAGG + Intronic
1093034760 12:14321937-14321959 GTTGTCTGGTGAGGGCTTACAGG + Intergenic
1093951436 12:25167734-25167756 AATGTCTGGGGAGGTCTTGCTGG - Intronic
1093988798 12:25567759-25567781 TGCTTCTGGTGAGGGCTTCAGGG - Intronic
1095806163 12:46323225-46323247 AATGTCTGGAGAGGTCTTGCTGG + Intergenic
1096613524 12:52818634-52818656 AGTGTTTGCTCAGGGCTTTCTGG + Intergenic
1097960560 12:65528255-65528277 AGTTCTTGGTGAGGGCTTCCTGG - Intergenic
1098291054 12:68957034-68957056 ATTGTCTGGTGATGGCGTCAGGG - Intronic
1100605480 12:96148947-96148969 AGTGACTGGAGAGGGATTCATGG - Intergenic
1101022389 12:100566373-100566395 AACGTCTGGTGAGGACTTCCTGG + Intergenic
1102507423 12:113392506-113392528 AGGGTCAGGGGTGGGCTTCCTGG + Exonic
1102745960 12:115249276-115249298 AGTGTCTGGGGAAGACTCCCTGG + Intergenic
1103843781 12:123887264-123887286 TGTGGCTGAGGAGGGCTTCCTGG + Exonic
1103947650 12:124535437-124535459 AGTGTGTGGTGGGGGCCTCGGGG - Intronic
1104090135 12:125509393-125509415 TGTGACTGGTGATTGCTTCCAGG + Intronic
1107697671 13:43016337-43016359 GGTGTCTGGTGAGGGCCTTTGGG + Intergenic
1108714854 13:53068971-53068993 AGGGACTGGTGCTGGCTTCCTGG + Intergenic
1108813534 13:54262171-54262193 AGTTTCTGGTGAGGGCCTCAGGG - Intergenic
1109535360 13:63710596-63710618 ACTCTCTGGTGAAGGTTTCCTGG + Intergenic
1110615124 13:77533031-77533053 ATTGATTGGTGATGGCTTCCTGG - Intergenic
1111643655 13:91002670-91002692 TGTTTCTGGTGAGGGCATCAGGG - Intergenic
1112051606 13:95648789-95648811 AGTTTCTGATGAGGGCCTTCTGG + Intergenic
1112679759 13:101750062-101750084 GGTATCTGATGAGGGCTTTCTGG - Intronic
1113278169 13:108758116-108758138 GGTGTCTGGTGAGGGCTTTCTGG - Intronic
1113501533 13:110779311-110779333 TGTGTCTGGTGAGGGCTTCTTGG + Intergenic
1113697300 13:112355341-112355363 GGCATCTGGAGAGGGCTTCCTGG + Intergenic
1115839215 14:37447543-37447565 AGTGCCTGGTGAGTGCCTCAGGG - Intronic
1116275553 14:42827382-42827404 AGTGTGTGGTGAATGCTTCCAGG + Intergenic
1116320444 14:43454989-43455011 AGTGTCTGGTGTGGACCCCCAGG + Intergenic
1117964947 14:61197440-61197462 CATGTCTGGTGAGGGCCTTCTGG + Intronic
1119465511 14:74855077-74855099 AGTGACTGGCTAGGGTTTCCTGG - Exonic
1119531801 14:75366858-75366880 AGTGTGTGGGGAGGGTTTTCAGG + Intergenic
1121192678 14:92044025-92044047 AATGTCTGGGGAGGCCTTGCTGG + Exonic
1121389393 14:93561370-93561392 AATGTCTGGGGAGGTCTTGCTGG + Intronic
1121519884 14:94578765-94578787 GGTCTCTGGTGAGGGCTCTCTGG - Intronic
1123880805 15:24676277-24676299 AGTGGCTGGGATGGGCTTCCTGG - Exonic
1124062115 15:26303330-26303352 AGTGTCTAGTGAGGGCCTCCTGG + Intergenic
1124354803 15:28986931-28986953 GCTGTCTGGTGAGGGCTTCCTGG + Intronic
1124508840 15:30305162-30305184 AGTATCTGGTAAGGGCCTTCTGG + Intergenic
1124618129 15:31257177-31257199 AGTGTCTGGTGAGGGCTTCCTGG - Intergenic
1124642626 15:31405658-31405680 ACCCTCTGGTGAGGGCTGCCAGG + Intronic
1124734718 15:32233500-32233522 AGTATCTGGTAAGGGCCTTCTGG - Intergenic
1125093987 15:35829853-35829875 TGTATCTGGCGAGGGCTTCAGGG + Intergenic
1125237159 15:37528863-37528885 ACTTTCTGGTGAGAACTTCCTGG + Intergenic
1126529802 15:49700257-49700279 AATGTCTGGGGAGGTCTTGCTGG + Intergenic
1126867325 15:52950637-52950659 TGCATCTGGTGAGGGCTTCAGGG + Intergenic
1127669788 15:61184373-61184395 GGTGTCTGGGGAGGGCTTCCTGG - Intronic
1128667717 15:69550763-69550785 GGTGACTGGGGTGGGCTTCCTGG + Intergenic
1129223193 15:74146807-74146829 ACTCTCTGGTGAGGCTTTCCTGG - Intergenic
1129912563 15:79240552-79240574 AGTGCCTGGGGAGGGCTGCCTGG - Intergenic
1130656587 15:85795535-85795557 AGTGCATGGTGTGGGCGTCCAGG - Intergenic
1131233168 15:90674098-90674120 GGTGTCTGGTGAGGGCTGGGAGG + Intergenic
1131621254 15:94070633-94070655 AGGGTCTGGTGAAAGCTTCAAGG + Intergenic
1132476384 16:140752-140774 AGTGGCTGCCTAGGGCTTCCAGG + Intergenic
1132626161 16:892645-892667 GGTGCCTGTTGGGGGCTTCCTGG - Intronic
1133253795 16:4503362-4503384 AGAGTATGCAGAGGGCTTCCTGG - Intronic
1134098291 16:11434104-11434126 AGTGGCTCGGGAGGGCTTCCTGG - Intronic
1134335838 16:13298958-13298980 TGTGTCTGGGAAAGGCTTCCAGG - Intergenic
1134666040 16:16019489-16019511 AGAGTCTGGTTGGGGCTGCCTGG + Intronic
1135085015 16:19468357-19468379 TGTGTGTGCTCAGGGCTTCCTGG + Intronic
1135618005 16:23928656-23928678 GGGGACTGGGGAGGGCTTCCTGG + Intronic
1136073502 16:27803001-27803023 AGGGGCTCGTGAGGGCCTCCAGG - Intronic
1137416756 16:48289370-48289392 GCTCTCTGGAGAGGGCTTCCAGG + Intronic
1137672917 16:50290032-50290054 AGAGGCTGGTGAGGGATACCAGG - Intronic
1138006708 16:53343917-53343939 TGCTTCTGGTGAGGGCTTCAGGG - Intergenic
1138197610 16:55063289-55063311 AGTGTCTTGAGAGAGTTTCCAGG + Intergenic
1138339291 16:56278306-56278328 CTTGTCTGGTGTGAGCTTCCTGG + Intronic
1138726260 16:59142645-59142667 GGCTTCTGGTGAGGGCTTCAGGG - Intergenic
1143201186 17:5114913-5114935 AGGTTCTGGTGAGAGCTCCCTGG - Intronic
1143240506 17:5439410-5439432 AGGGTCTGGTGAGAGCTGGCGGG - Intronic
1146724925 17:35148876-35148898 AGTGTGGGGAGAGGGTTTCCTGG - Intronic
1148674082 17:49435004-49435026 AGTGTATGGTGAGGGGTTGGAGG - Intronic
1149149004 17:53536520-53536542 TGTTTCTGGTGAGGGCTGCAGGG - Intergenic
1150577629 17:66444186-66444208 TGTGTTTGCTGAGGGCTCCCTGG + Intronic
1151874441 17:76858813-76858835 AGTGGGAGGGGAGGGCTTCCAGG - Intergenic
1151901728 17:77020386-77020408 AGTGTCTGCTCTGGGCTGCCTGG - Intergenic
1153614826 18:6924724-6924746 TACTTCTGGTGAGGGCTTCCAGG + Intergenic
1153935354 18:9915023-9915045 GGTGCCTGGCGAGGGCTGCCCGG + Intronic
1154168808 18:12036100-12036122 AGTGTCTCCTGTGGGCTTCTCGG + Intergenic
1155116515 18:22773624-22773646 TGGTTCTGGTGAGGGCTTCATGG - Intergenic
1155530029 18:26757786-26757808 AGTGTTGGGTGAGGCCCTCCAGG + Intergenic
1155735162 18:29212767-29212789 GGCTTCTGGTGAGGGCTTTCAGG + Intergenic
1156155882 18:34301245-34301267 AGTTTGTGGTGAATGCTTCCAGG - Intergenic
1156237750 18:35220556-35220578 AATGTCTGGGGAGGTCTTGCTGG - Intergenic
1156484698 18:37457346-37457368 TGTGTCTGGAGGGGGCTTTCAGG - Intronic
1156538015 18:37882526-37882548 AGTGTCTGGTTAGGGCCTAAAGG + Intergenic
1156820627 18:41368300-41368322 AGTTGCTGGTGAGTGCTTCAGGG + Intergenic
1157512600 18:48288756-48288778 GATGTCTGGTGAGGGCTTTCTGG - Intronic
1157897486 18:51482867-51482889 AGTGTCCAGTGAAGCCTTCCAGG - Intergenic
1158350938 18:56563823-56563845 ACAGTCTGGTGAGGGCCACCAGG - Intergenic
1158554354 18:58463107-58463129 ACTCTCTGGTTGGGGCTTCCAGG - Intergenic
1159018254 18:63120415-63120437 AGTGCCTGGAGGGGCCTTCCGGG + Intergenic
1160534641 18:79585571-79585593 AGTGTCAGGTGGGGGCTGCTAGG - Intergenic
1161710405 19:5844383-5844405 AGTATCTGTCCAGGGCTTCCAGG + Exonic
1161931878 19:7346026-7346048 TGTTTGTGGTGAGGGCTTTCCGG + Intergenic
1162762726 19:12897900-12897922 AGTGTCTGGGGAGGGGGTACAGG + Intronic
1162795089 19:13082865-13082887 AGCCTCTGGTGTGGGCTTCCGGG - Intronic
1163641998 19:18467188-18467210 AGAGTCTGGTCTGGGCTTGCAGG + Intronic
1164603326 19:29578205-29578227 GGTGTCTGGTGAGGGCTTCCTGG - Intergenic
1165166865 19:33863232-33863254 AGCCTCTGCTGAGGCCTTCCTGG + Intergenic
1166397029 19:42448936-42448958 AATGTCTGGGGAGGTCTTGCTGG + Intergenic
1166793122 19:45409572-45409594 AGTCTCTGGGGAGGGATTCTGGG - Exonic
1167101088 19:47404706-47404728 GGTGTTTAGAGAGGGCTTCCTGG - Intronic
1167577858 19:50326348-50326370 AGTGTCTTGAGGGGGCATCCAGG + Intronic
1168122462 19:54259514-54259536 AGCTTGTGGTGAAGGCTTCCTGG + Intronic
1168698231 19:58418178-58418200 GGTATCTGCTGGGGGCTTCCTGG + Exonic
925163336 2:1701906-1701928 GGTGTCTGCTGAGGGCCACCCGG - Intronic
925376020 2:3386761-3386783 AGAGTCTTGGGAGGGCTTCATGG + Intronic
925531455 2:4867703-4867725 TGTGACTGGTGGGGGGTTCCAGG + Intergenic
926973448 2:18489643-18489665 AGTGTGTGGCGCGGCCTTCCTGG - Intergenic
927308359 2:21599666-21599688 AGTGACTGGGGAAGGCTTCCTGG - Intergenic
928253914 2:29705564-29705586 AGTGTCTGGGGAGGCATTGCAGG + Intronic
928317590 2:30258090-30258112 AATGTCTGCTGAGCGCATCCTGG - Exonic
928770472 2:34698222-34698244 AATGTCTGGGGAGGTCTTGCTGG + Intergenic
928778654 2:34794291-34794313 AATGTCTGGGGAGGTCTTGCTGG - Intergenic
928863927 2:35895361-35895383 AGTTTGTGGTGAATGCTTCCAGG + Intergenic
929567866 2:43000829-43000851 CCAGTCTGGTGGGGGCTTCCAGG + Intergenic
929582607 2:43092325-43092347 AGTTGCTGGTGAGGGCTTAAAGG - Intergenic
929959778 2:46487805-46487827 AGTCTCTGGGTGGGGCTTCCTGG - Intergenic
931140255 2:59449732-59449754 GTTGTCTGGTGAGGGCCTTCTGG - Intergenic
932266809 2:70374618-70374640 TGTGTCTGGTGAGAGCTTTCTGG - Intergenic
934141907 2:89054963-89054985 AATGTCTGGGGAGGTCTTGCTGG - Intergenic
934227329 2:90145583-90145605 AATGTCTGGGGAGGTCTTCCTGG + Intergenic
934895995 2:98120573-98120595 CGTGTCTGCTGTGTGCTTCCTGG - Intronic
935838373 2:107079781-107079803 AGGGTCTTATGAAGGCTTCCTGG + Intergenic
935999138 2:108808101-108808123 AGTGTGTGGTAAGGTCTTTCAGG + Intronic
936497476 2:113034903-113034925 AGTGTGTGGTGAGGGAGTTCAGG + Intronic
937204054 2:120224385-120224407 AGAGACTGGTGAGGGCAGCCAGG - Intergenic
937362313 2:121237776-121237798 AGTGTCTGAGCAGGGCTTTCTGG - Intronic
937629047 2:124078797-124078819 AGTGTCTGGAGAGGGATGCAGGG + Intronic
938174480 2:129112290-129112312 GGTGTCTGGGGAGGGCTCTCAGG + Intergenic
938586406 2:132694976-132694998 GGTGTCTGGTGAGGGCTTCTGGG + Intronic
939607267 2:144268257-144268279 TGCTTCTGGTGAGGGCTTCAGGG - Intronic
940493802 2:154399407-154399429 AGTGTCTGATAAAGGCTTCTAGG + Intronic
940787190 2:157994199-157994221 TGCTTCTGGTGAGGGCTTCATGG + Intronic
941872612 2:170401515-170401537 AGTGGGAGGTGAGGGCCTCCTGG - Exonic
941985197 2:171503644-171503666 GCTGTCTGGTGAGGGCTTCCTGG + Intergenic
942712071 2:178847920-178847942 GGTGTCTAGTGAGGACTTCCTGG - Intronic
943865726 2:192922863-192922885 AATGTCTGGAGAGGTCTTGCTGG - Intergenic
945315952 2:208370894-208370916 AGCTCCTGGTGAGGGCTTCAGGG + Intronic
946000780 2:216480516-216480538 AGAGGCTGATGAGGGCATCCTGG + Intronic
946166878 2:217869794-217869816 GGACTCTGGTGAGGGCTTCTGGG + Intronic
946830661 2:223725189-223725211 AATGATTGCTGAGGGCTTCCTGG + Intergenic
947527296 2:230886499-230886521 AGTGACTAGTGCAGGCTTCCTGG + Intergenic
947785690 2:232817064-232817086 AGTGCTTGATGAGGGCTTTCAGG + Intronic
948225283 2:236305077-236305099 GGTGTCTGGTGAGGGCCTTCTGG + Intergenic
948736844 2:240014448-240014470 GGAGGCTGGTGAGGGCCTCCTGG - Intronic
948941922 2:241201017-241201039 TGTGTGTGGTGAGGGGTTCTGGG + Intronic
1168862677 20:1057150-1057172 GGTTTCTGGTGAGGCCTTTCTGG - Intergenic
1169741021 20:8894234-8894256 AGTTTCTGGTGAGGGGCTCAGGG - Intronic
1170796928 20:19556001-19556023 GGTGTCTGGTAAGGCCTTTCTGG + Intronic
1171306741 20:24113107-24113129 AGTGTCTGGGGAGAGATTTCAGG - Intergenic
1172210111 20:33191344-33191366 GGGATGTGGTGAGGGCTTCCTGG + Intergenic
1172248639 20:33463487-33463509 TGTGTGTGGGGAGGGATTCCTGG + Intergenic
1174181309 20:48676683-48676705 AGTCTCTGTTGGGGGCTGCCTGG - Intronic
1175255272 20:57641201-57641223 AGTGTCTGGGGAGGGCTTCCTGG - Intergenic
1175297675 20:57920397-57920419 AGTGTCTGGTGAGGACTGGAGGG + Intergenic
1175725197 20:61313217-61313239 AGTGTCTGATGAGGGATTTGCGG + Intronic
1175867071 20:62184556-62184578 AGTCACTGGGGAGGGCTTCTTGG + Intronic
1175968233 20:62670619-62670641 AGAGTCTGGGGACGGCTCCCTGG - Intronic
1178633540 21:34282800-34282822 AGCTTCTGCTGATGGCTTCCTGG + Intergenic
1179141105 21:38726264-38726286 TGCTTCTGGTGAGGGCTTCAGGG + Intergenic
1179482455 21:41686825-41686847 GGCGTCTGGTGAGGGCTTTCTGG - Intergenic
1179886370 21:44315910-44315932 TGTGTCTGGTGAAGCCTTCCAGG - Intronic
1181087868 22:20451213-20451235 AATGTCTGATGAGGTCTTGCTGG + Intronic
1181788042 22:25241748-25241770 AGAGGCTGTCGAGGGCTTCCTGG + Intergenic
1182250508 22:28996295-28996317 AATGTATGGTGAGGTTTTCCAGG + Intronic
1182765702 22:32756755-32756777 AGTTTCTGGTGAGGGCTTCAGGG - Intronic
1183039578 22:35166542-35166564 AGTGTCTGGAGTGGACCTCCAGG + Intergenic
1183485007 22:38083962-38083984 AGTGTGATGTGAGGGCTGCCTGG - Intronic
1183731879 22:39622758-39622780 AGTGTCTGGTGTGGGCACCTGGG + Intronic
1184684822 22:46091497-46091519 AGTAGCGTGTGAGGGCTTCCTGG - Intronic
1184810316 22:46827003-46827025 AGTCTCTGTTGATGGCTTCCTGG - Intronic
1184912268 22:47543962-47543984 GGTGTCTGGTGAGGGTTTCCTGG - Intergenic
1184971715 22:48027035-48027057 CGTGTCTGGGGAGGGCTTCCTGG - Intergenic
1185073328 22:48669117-48669139 GGTGTCTGGCGGGGGCTTCCTGG - Intronic
1185265881 22:49903809-49903831 TGTGGCTGCTGAGGGCTGCCTGG + Exonic
949852558 3:8433639-8433661 GATGTCTGGTGAGGTCTTTCTGG + Intergenic
949906481 3:8862811-8862833 AGGGTGAGTTGAGGGCTTCCTGG - Intronic
950097392 3:10338026-10338048 AGTGGCTGGTGAGAGCTGGCCGG + Intronic
950289831 3:11774702-11774724 AGTGTCTAGTGAGGGCTTTCTGG + Intergenic
950301750 3:11885607-11885629 AGTGCTTGGTGAGGACTTCTAGG - Intergenic
950898498 3:16475174-16475196 TGCTTCTGGTGAGGGCTTCCAGG - Intronic
951423152 3:22511050-22511072 AGCTTGTGGTGAGTGCTTCCTGG - Intergenic
952340983 3:32446851-32446873 TGCTTCTGGTGAGGGCTTCAGGG - Intronic
952585549 3:34887791-34887813 GGTGTCTGCTGAGGGCCTTCTGG - Intergenic
953453683 3:43024922-43024944 AGTCTCAGGGGAAGGCTTCCTGG + Intronic
957762872 3:84582169-84582191 AGTCTCTAGTGAAGGTTTCCAGG - Intergenic
959080314 3:101793975-101793997 AGTGTCTTGAGAGAGTTTCCAGG - Intronic
959988570 3:112604745-112604767 AGATTCTGGTGAGGATTTCCTGG + Exonic
961411762 3:126727309-126727331 TCTGTCTGGTAAGGGCTTTCCGG + Intronic
961476850 3:127152392-127152414 AGGGCCAGGTAAGGGCTTCCTGG + Intergenic
962185794 3:133258227-133258249 AGTTTCTGGTGAGGGCCCGCTGG - Intronic
962821335 3:139050247-139050269 TGTGTCTGGTGAGGGTTATCAGG + Intronic
963320377 3:143803912-143803934 AATGTCTGGGGAGGTCTTGCTGG - Intronic
963786722 3:149542298-149542320 GGTGTCTGGTGGAGGCTCCCTGG - Intronic
964178634 3:153856763-153856785 AGTGTCTGTTGAGGACCTTCTGG - Intergenic
964191495 3:154007364-154007386 AGTGTCAGGTAAGGGCATTCGGG + Intergenic
964239527 3:154574918-154574940 AGTTTGTGGTGAATGCTTCCTGG - Intergenic
965625891 3:170683798-170683820 AATGTCTGGGGAGGTCTTGCTGG + Intronic
965980337 3:174681997-174682019 AGTGTGTGGTGAGTACTGCCTGG - Intronic
966279740 3:178212874-178212896 AATGTCTGGGGAGGTCTTGCTGG - Intergenic
966872804 3:184302600-184302622 AGTTTCTGGTTAGGGCTTGAGGG + Intronic
967014682 3:185471146-185471168 ACTCTCTGGTGAAGGTTTCCTGG + Intronic
967835572 3:193959729-193959751 AGAGTTTGGAGAGGTCTTCCAGG - Intergenic
967911305 3:194544717-194544739 AGCTTCTGGTGAGGGCCTCATGG - Intergenic
968448528 4:664293-664315 AGCGTCTGGGGAGGGCTGCAGGG - Intronic
969398545 4:6938677-6938699 GGAGGCTGGAGAGGGCTTCCTGG - Intronic
970630320 4:17935678-17935700 TGCTTCTGGTGAGGGCCTCCGGG - Intronic
970959554 4:21856707-21856729 AGTGGAAGGGGAGGGCTTCCAGG - Intronic
971265384 4:25092143-25092165 AGTGTCTGGTGTGGCATTACTGG + Intergenic
971895906 4:32593623-32593645 TGTTTCTGGTAAGGGCTTCAGGG - Intergenic
972165990 4:36284783-36284805 GGTGTCTGGTGAGGGCTTTCTGG + Intronic
972774153 4:42226180-42226202 AGTATCTGGGGAGAGCTTCGTGG + Intergenic
973038402 4:45437945-45437967 AGTATCTGCTGAGGGCTTACAGG - Intergenic
973553511 4:52058676-52058698 AGTGAATGGGGAGGGCATCCAGG - Intronic
974565290 4:63573087-63573109 AGTGGTTTGTCAGGGCTTCCAGG + Intergenic
976812317 4:89110911-89110933 AGTGTCGGGTCAGCGCTCCCCGG - Intronic
976944069 4:90742554-90742576 AGGGGCTAGTGAGGGCTTTCTGG - Intronic
978069278 4:104446621-104446643 ATTATATGGAGAGGGCTTCCTGG + Intergenic
981479218 4:145219664-145219686 AGGGTCTGATGAGGCCTCCCTGG - Intergenic
983037411 4:162885008-162885030 GGTTTCTGGTGAGGGCTTCTGGG + Intergenic
983922788 4:173365528-173365550 AGTGGCAGGTGATGGCTTTCTGG + Intergenic
984070893 4:175110288-175110310 AGGCTCTGGTGAGGGTTTTCTGG - Intergenic
984164995 4:176295958-176295980 AATGTCTGGGGAGGTCTTGCTGG + Intergenic
984598045 4:181693845-181693867 ATTGGCTGGTTAGGTCTTCCTGG + Intergenic
984891680 4:184499510-184499532 AGTCTCTGGTGAAGCTTTCCTGG - Intergenic
984991327 4:185384251-185384273 AGTGTCTGGTGAGAGCTTTCAGG - Intronic
985510561 5:310976-310998 GGTGTTTGGTGAGTGCTTCCCGG + Intronic
986082588 5:4409887-4409909 CCTGTCAGGTCAGGGCTTCCAGG - Intergenic
986123582 5:4866060-4866082 AGTGCCTGGTGGGGGCTTCCTGG + Intergenic
986178543 5:5372433-5372455 ATTGTCTGCTCAGTGCTTCCTGG - Intergenic
987278597 5:16389107-16389129 TGCATCTGGTGAGGGCTTCATGG + Intergenic
987286799 5:16465521-16465543 AGTGACCGCCGAGGGCTTCCAGG - Exonic
988490305 5:31700262-31700284 AGTGTATGGTGGGGCCTTTCAGG + Intronic
988771056 5:34434043-34434065 AGGGTCTGGAGTGGACTTCCAGG - Intergenic
990118789 5:52423651-52423673 AGTATCTGGAAAGGGTTTCCAGG - Intergenic
992332742 5:75733844-75733866 AGTGTCTTGTAAGGGCTTTCTGG + Intergenic
994564008 5:101417096-101417118 GGTGTGTGGTGAGGGCTTTCTGG + Intergenic
995124815 5:108569606-108569628 AATGTCTGGGGAGGTCTTGCTGG + Intergenic
995375585 5:111470822-111470844 ATTCTCTGGTGAAGGTTTCCTGG + Intronic
996459565 5:123725654-123725676 AGTTTGTGGTGAGTGCTGCCAGG - Intergenic
997832685 5:137164709-137164731 AGTTTGTGGTGAAGGCTGCCAGG - Intronic
1000975373 5:167758555-167758577 ACTGTATGGAGAGGGCTACCTGG - Intronic
1001557774 5:172647976-172647998 ACTGACTGGTGGGGGCTGCCTGG - Intronic
1002340139 5:178510760-178510782 AGTTTCAGGAGTGGGCTTCCTGG - Intronic
1003486752 6:6586778-6586800 AGTGTCTGGTGAGGGGCCTCTGG - Intergenic
1003644123 6:7900727-7900749 AGTGTCTGGTGAGGGCTTTCTGG + Intronic
1003873080 6:10416880-10416902 AGAGCATGGGGAGGGCTTCCTGG - Intronic
1003911192 6:10745301-10745323 ATTGTCTGGGGAGGCGTTCCAGG + Intergenic
1004027224 6:11831131-11831153 TGCTTCTGGTGAGGGCTGCCGGG + Intergenic
1006166273 6:32067661-32067683 AGTGTCTGCTGTGGGCGTCACGG - Intronic
1006822836 6:36912126-36912148 AAGATGTGGTGAGGGCTTCCAGG - Intronic
1007300354 6:40863353-40863375 AATGTCTGGGGAGGTCTTGCTGG + Intergenic
1007697511 6:43743221-43743243 AGTGTGTGGTGAGCTCTTGCAGG + Intergenic
1008641998 6:53473886-53473908 AGTTTGTCGTGAGTGCTTCCAGG + Intergenic
1008849857 6:56011939-56011961 AATGTCTGGGGAGGTATTCCTGG + Intergenic
1008982648 6:57502662-57502684 AGTGTCTGTTTCTGGCTTCCGGG + Intronic
1009812469 6:68686208-68686230 AGTCTCTGGTGAAGCTTTCCTGG + Intronic
1010329877 6:74610622-74610644 AGAGTCTTCTGAGGGTTTCCTGG - Intergenic
1013424118 6:109995068-109995090 AGAGTCTGGTGGCAGCTTCCAGG + Intergenic
1013479160 6:110538433-110538455 AGGGTCTGGCCAGGGCTTTCAGG + Intergenic
1017140478 6:151185128-151185150 AGTCTCTGGTGATGTCTTCAAGG + Intergenic
1017653093 6:156600988-156601010 AGTGTTGAGTGGGGGCTTCCAGG - Intergenic
1017792889 6:157817068-157817090 AGTGTCTGGTGAGTGCCCCCTGG - Intronic
1017907531 6:158767329-158767351 GCTGTCTAGTGAGGGCATCCGGG - Exonic
1018370104 6:163160300-163160322 AGTCTTTGGTGACAGCTTCCAGG - Intronic
1019114481 6:169748337-169748359 ATTGCCTGGTGAGAGTTTCCAGG - Intronic
1019322849 7:423457-423479 AGCGTCTGCTGAGGGCTTCCTGG - Intergenic
1019408125 7:894543-894565 GGTGTCTGGGGGGGGCATCCGGG - Intronic
1019554141 7:1620163-1620185 CGTGTCTGCCGAAGGCTTCCTGG + Intergenic
1019970044 7:4533532-4533554 CATATCTGGTGAGGGCCTCCTGG + Intergenic
1020573043 7:9890401-9890423 AGTTTCTGGTGAATACTTCCTGG - Intergenic
1021805532 7:24350908-24350930 ACTGGCTGGTGAGGGTTTGCGGG - Intergenic
1023165061 7:37335666-37335688 GGTGGCTGCCGAGGGCTTCCGGG - Intronic
1025895741 7:65698629-65698651 AGTGGCTGGTGAGACCCTCCAGG - Intergenic
1026180829 7:68039076-68039098 AGTGTTTGCTGTGGGCTACCAGG + Intergenic
1026454856 7:70562098-70562120 TGCTTCTGGTGAGGGCTTCAGGG - Intronic
1028652749 7:93169693-93169715 AGGGTCTGGAGTGGACTTCCAGG - Intergenic
1030078993 7:105761301-105761323 ATTGTCTGGAGACGGCTTCCTGG - Intronic
1031889146 7:127274141-127274163 AGTATCCAGTGAGGGCTTTCTGG + Intergenic
1032084649 7:128877532-128877554 AGTGACTGGCGTAGGCTTCCAGG + Exonic
1032458935 7:132095040-132095062 TGTGGTTGGTTAGGGCTTCCAGG + Intergenic
1033159507 7:138983079-138983101 ATTGTCTACTGAGGGCTTACTGG - Intergenic
1033706392 7:143889812-143889834 ACTGTCTGGTGAAGCTTTCCTGG - Intronic
1033773565 7:144581192-144581214 AGTGTCTGGTGAGGGCCCCTTGG - Intronic
1034084464 7:148311169-148311191 AATGTCTGGGGAGGTCTTGCTGG + Intronic
1034676447 7:152895902-152895924 AGTGTCGGTGGAGGTCTTCCTGG + Intergenic
1035039544 7:155917500-155917522 TGTGTTTGGTGAGGGCTTGGTGG + Intergenic
1035310660 7:157965896-157965918 AGTGGCTCTCGAGGGCTTCCTGG - Intronic
1037961023 8:23098452-23098474 AGCTTCTGGTGAGGGCCTCAGGG + Intronic
1038066744 8:23971252-23971274 AGTGTCTGGTGTGGCCTTAGTGG - Intergenic
1038084937 8:24185634-24185656 AGTTTTTGGTGAAGGCTTTCTGG + Intergenic
1038856935 8:31344176-31344198 AGCATCTGGTGAGGACTTCATGG - Intergenic
1039451099 8:37675603-37675625 AGAGCCGGGTGAGGGCTGCCCGG - Intergenic
1039597387 8:38802681-38802703 TGTTTCTGGTGAGGGCATCAGGG + Intronic
1041017702 8:53608199-53608221 AGTGGATGGTGAGGGCCTCTGGG + Intergenic
1041768441 8:61445528-61445550 TGCTTCTGGTGAGGGCTTCAGGG - Intronic
1042082502 8:65070922-65070944 AGTTTGTGGTGAATGCTTCCAGG + Intergenic
1042766541 8:72328520-72328542 AGTGTATGTTTAGGACTTCCTGG + Intergenic
1044926269 8:97211391-97211413 AGTGTCTGTTAAGGGCTTTCTGG + Intergenic
1045510277 8:102807711-102807733 AAGGTGTGGCGAGGGCTTCCTGG + Intergenic
1046136943 8:110039597-110039619 AATGTCTGATGAGGGTTTGCTGG + Intergenic
1046229890 8:111340211-111340233 TGCCTCTGGTGAGGGCTTCAAGG - Intergenic
1046716796 8:117576913-117576935 AGAATCTGGGGTGGGCTTCCTGG + Intergenic
1047437604 8:124847752-124847774 AGTTTCTGGTCAGGCATTCCTGG - Intergenic
1048489706 8:134881206-134881228 GGGGTCTAGTGAGGGCTTCCTGG - Intergenic
1048968296 8:139629692-139629714 AGTTTCTGGTGGGGGCTCTCCGG + Intronic
1049237987 8:141522233-141522255 AGTGGCGGCTGAGGGCTGCCCGG - Intergenic
1049411282 8:142475083-142475105 GGAGCCTGGAGAGGGCTTCCAGG + Intronic
1049434973 8:142582303-142582325 AGGGGCTGGTGAGGGTTTCTAGG - Intergenic
1049442832 8:142617100-142617122 GGGGTTTGGTGAGGGCTTCTGGG - Intergenic
1049537754 8:143189867-143189889 GGTGTCTGCTGAGGGTCTCCAGG + Intergenic
1050477131 9:6051685-6051707 TGTGTCTGTTGAGGGCCTCATGG + Intergenic
1050552206 9:6758243-6758265 AGGGTCCGGAGAGGTCTTCCCGG + Intronic
1051783071 9:20711854-20711876 AGTGGCTGGGGAGTGCCTCCAGG + Intronic
1052116940 9:24660209-24660231 ACTGCCTGGTGAGAGTTTCCAGG - Intergenic
1053290172 9:36874492-36874514 AGTGGCTGGTGTGGGTTCCCAGG - Intronic
1053350321 9:37409644-37409666 AGGGTCCTGGGAGGGCTTCCTGG + Intergenic
1054851946 9:69855657-69855679 AGTCTCTGGTGCTGGTTTCCTGG - Intronic
1056143920 9:83710457-83710479 ACTGGCTTGTGAGGGCTTACTGG - Intergenic
1058144764 9:101399084-101399106 AGCCTCTGGTGAGGCCTACCCGG - Exonic
1059948567 9:119438326-119438348 AGTGACTGGAGATGGCTTCATGG - Intergenic
1060739512 9:126089020-126089042 AATGAATGCTGAGGGCTTCCTGG - Intergenic
1061716338 9:132520794-132520816 AGTGTCTGGGGAGGGGCTCCTGG - Intronic
1062688862 9:137831004-137831026 GGTGTCTGGGGAGGGTTTCCTGG + Intronic
1185672409 X:1823717-1823739 AGTGTGTGGGAACGGCTTCCTGG + Intergenic
1185842608 X:3406574-3406596 AGTGTCTAGTGAGGGTTTCCTGG - Intergenic
1185848405 X:3462338-3462360 AGTGTCTGGTGAGGGCTTCCTGG + Intergenic
1185875185 X:3696199-3696221 GGTGTCTGGTGAGGGCTTCCTGG - Intronic
1185881532 X:3745644-3745666 AGTGTCTGGTGAGGGCTTCCTGG + Intergenic
1185888553 X:3803888-3803910 ATTGTCTGGTGAGGGCTTCCTGG + Intergenic
1185969017 X:4641061-4641083 AGTGTCTAGTGAGGGCTTCCTGG - Intergenic
1186472371 X:9831746-9831768 AGTGTCTGGTGAGGGCTTCCTGG + Intronic
1186718157 X:12275320-12275342 AGTTTCTGGGGAGGCCTTCAGGG - Intronic
1187443216 X:19338481-19338503 AGTGTCTGGTGAGGGCCTTCTGG - Intergenic
1188200325 X:27288222-27288244 AATGTCTGGGGAGGTCTTGCTGG + Intergenic
1188742937 X:33808897-33808919 AGTTTCTGGTGAATGCTGCCTGG + Intergenic
1189337756 X:40180839-40180861 GGTGTCTGTTGAGGGCCTGCTGG + Intergenic
1190931298 X:54951331-54951353 AGAGGATGGGGAGGGCTTCCTGG + Intronic
1192147675 X:68693054-68693076 CGTGGCAGGGGAGGGCTTCCAGG - Intronic
1192218124 X:69178029-69178051 TGTGTGTGGTGAGGCCTGCCTGG + Intergenic
1192412547 X:70947221-70947243 TGTTTCTGGTGAGGGCCTCAGGG + Intergenic
1192503773 X:71668883-71668905 AGTGTCTGGCGTGGGGCTCCTGG + Intergenic
1194749280 X:97666312-97666334 TGTATCTGGTGAGGGCCTCAGGG - Intergenic
1196525116 X:116722075-116722097 AATGTCTGGGGAGGTCTTGCTGG + Intergenic
1196777493 X:119352817-119352839 AGCTCCTGGTGAGGGCTTCAGGG + Intergenic
1196903150 X:120406401-120406423 ACTGTCTGGAGAGAGTTTCCAGG - Intergenic
1197264012 X:124346999-124347021 AGGCTCTGGTGAGGGCCTTCTGG - Intronic
1198138980 X:133783620-133783642 AATGTCTGAAGAGGGCTTCCAGG + Intronic
1199982699 X:152929489-152929511 AGTGCTTGGGGAGGGCTTCCTGG + Intronic
1200815219 Y:7524467-7524489 AGTGTCTGGTGAGGGCTTCCTGG - Intergenic
1201232835 Y:11881638-11881660 AGTGTCTGGTGAAGGATTCCTGG + Intergenic
1201540464 Y:15100346-15100368 AATGTCTGGGGAGGTCTTGCTGG + Intergenic
1201792245 Y:17855382-17855404 AGTTTCTTCTGAGGGTTTCCTGG - Intergenic
1201809309 Y:18050604-18050626 AGTTTCTTCTGAGGGTTTCCTGG + Intergenic
1202353834 Y:24024943-24024965 AGTTTCTTCTGAGGGTTTCCTGG - Intergenic
1202516945 Y:25645169-25645191 AGTTTCTTCTGAGGGTTTCCTGG + Intergenic