ID: 1124618130

View in Genome Browser
Species Human (GRCh38)
Location 15:31257185-31257207
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124618130_1124618135 -5 Left 1124618130 15:31257185-31257207 CCCTCACCAGACACTGATTCTGC No data
Right 1124618135 15:31257203-31257225 TCTGCTGGTACCTTGATTTTGGG No data
1124618130_1124618134 -6 Left 1124618130 15:31257185-31257207 CCCTCACCAGACACTGATTCTGC No data
Right 1124618134 15:31257202-31257224 TTCTGCTGGTACCTTGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124618130 Original CRISPR GCAGAATCAGTGTCTGGTGA GGG (reversed) Intergenic
No off target data available for this crispr