ID: 1124618134

View in Genome Browser
Species Human (GRCh38)
Location 15:31257202-31257224
Sequence TTCTGCTGGTACCTTGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124618130_1124618134 -6 Left 1124618130 15:31257185-31257207 CCCTCACCAGACACTGATTCTGC No data
Right 1124618134 15:31257202-31257224 TTCTGCTGGTACCTTGATTTTGG No data
1124618131_1124618134 -7 Left 1124618131 15:31257186-31257208 CCTCACCAGACACTGATTCTGCT No data
Right 1124618134 15:31257202-31257224 TTCTGCTGGTACCTTGATTTTGG No data
1124618128_1124618134 13 Left 1124618128 15:31257166-31257188 CCGACTGTGAACCAGGAAGCCCT No data
Right 1124618134 15:31257202-31257224 TTCTGCTGGTACCTTGATTTTGG No data
1124618129_1124618134 2 Left 1124618129 15:31257177-31257199 CCAGGAAGCCCTCACCAGACACT 0: 5
1: 7
2: 23
3: 46
4: 361
Right 1124618134 15:31257202-31257224 TTCTGCTGGTACCTTGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124618134 Original CRISPR TTCTGCTGGTACCTTGATTT TGG Intergenic
No off target data available for this crispr