ID: 1124621023

View in Genome Browser
Species Human (GRCh38)
Location 15:31273970-31273992
Sequence TTTCTGTCAAGAGGCTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124621023_1124621027 8 Left 1124621023 15:31273970-31273992 CCAGGGGAGCCTCTTGACAGAAA No data
Right 1124621027 15:31274001-31274023 GTATGCGGTGTCTCTCACCCAGG No data
1124621023_1124621025 -7 Left 1124621023 15:31273970-31273992 CCAGGGGAGCCTCTTGACAGAAA No data
Right 1124621025 15:31273986-31274008 ACAGAAACCTTGCATGTATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124621023 Original CRISPR TTTCTGTCAAGAGGCTCCCC TGG (reversed) Intergenic