ID: 1124621105

View in Genome Browser
Species Human (GRCh38)
Location 15:31274534-31274556
Sequence CAGCTGATGTTGAGGAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124621103_1124621105 -4 Left 1124621103 15:31274515-31274537 CCAACACGTGAAAGGGCAACAGC No data
Right 1124621105 15:31274534-31274556 CAGCTGATGTTGAGGAAACATGG No data
1124621099_1124621105 26 Left 1124621099 15:31274485-31274507 CCTAAACCTTTTGGACAAATAAA No data
Right 1124621105 15:31274534-31274556 CAGCTGATGTTGAGGAAACATGG No data
1124621098_1124621105 29 Left 1124621098 15:31274482-31274504 CCTCCTAAACCTTTTGGACAAAT No data
Right 1124621105 15:31274534-31274556 CAGCTGATGTTGAGGAAACATGG No data
1124621100_1124621105 20 Left 1124621100 15:31274491-31274513 CCTTTTGGACAAATAAACTTCGC No data
Right 1124621105 15:31274534-31274556 CAGCTGATGTTGAGGAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124621105 Original CRISPR CAGCTGATGTTGAGGAAACA TGG Intergenic
No off target data available for this crispr