ID: 1124621113

View in Genome Browser
Species Human (GRCh38)
Location 15:31274663-31274685
Sequence GCCTGCAGTCCTCTACTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124621110_1124621113 10 Left 1124621110 15:31274630-31274652 CCTGGGTGCGCGGCACAGTCAAG No data
Right 1124621113 15:31274663-31274685 GCCTGCAGTCCTCTACTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124621113 Original CRISPR GCCTGCAGTCCTCTACTTGC AGG Intergenic
No off target data available for this crispr