ID: 1124621216

View in Genome Browser
Species Human (GRCh38)
Location 15:31275155-31275177
Sequence CCCGCCATTGCTCCTTCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124621216_1124621219 -2 Left 1124621216 15:31275155-31275177 CCTTTGGAAGGAGCAATGGCGGG No data
Right 1124621219 15:31275176-31275198 GGATAAGTCCCCACGGTAGAAGG No data
1124621216_1124621220 1 Left 1124621216 15:31275155-31275177 CCTTTGGAAGGAGCAATGGCGGG No data
Right 1124621220 15:31275179-31275201 TAAGTCCCCACGGTAGAAGGAGG No data
1124621216_1124621218 -9 Left 1124621216 15:31275155-31275177 CCTTTGGAAGGAGCAATGGCGGG No data
Right 1124621218 15:31275169-31275191 AATGGCGGGATAAGTCCCCACGG No data
1124621216_1124621226 20 Left 1124621216 15:31275155-31275177 CCTTTGGAAGGAGCAATGGCGGG No data
Right 1124621226 15:31275198-31275220 GAGGATCCCAGAGGCCTGGTTGG No data
1124621216_1124621225 16 Left 1124621216 15:31275155-31275177 CCTTTGGAAGGAGCAATGGCGGG No data
Right 1124621225 15:31275194-31275216 GAAGGAGGATCCCAGAGGCCTGG No data
1124621216_1124621224 11 Left 1124621216 15:31275155-31275177 CCTTTGGAAGGAGCAATGGCGGG No data
Right 1124621224 15:31275189-31275211 CGGTAGAAGGAGGATCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124621216 Original CRISPR CCCGCCATTGCTCCTTCCAA AGG (reversed) Intergenic
No off target data available for this crispr