ID: 1124621221

View in Genome Browser
Species Human (GRCh38)
Location 15:31275184-31275206
Sequence GGGATCCTCCTTCTACCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124621221_1124621226 -9 Left 1124621221 15:31275184-31275206 CCCCACGGTAGAAGGAGGATCCC No data
Right 1124621226 15:31275198-31275220 GAGGATCCCAGAGGCCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124621221 Original CRISPR GGGATCCTCCTTCTACCGTG GGG (reversed) Intergenic
No off target data available for this crispr