ID: 1124621222

View in Genome Browser
Species Human (GRCh38)
Location 15:31275185-31275207
Sequence TGGGATCCTCCTTCTACCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124621222_1124621226 -10 Left 1124621222 15:31275185-31275207 CCCACGGTAGAAGGAGGATCCCA No data
Right 1124621226 15:31275198-31275220 GAGGATCCCAGAGGCCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124621222 Original CRISPR TGGGATCCTCCTTCTACCGT GGG (reversed) Intergenic
No off target data available for this crispr