ID: 1124621226

View in Genome Browser
Species Human (GRCh38)
Location 15:31275198-31275220
Sequence GAGGATCCCAGAGGCCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124621214_1124621226 21 Left 1124621214 15:31275154-31275176 CCCTTTGGAAGGAGCAATGGCGG No data
Right 1124621226 15:31275198-31275220 GAGGATCCCAGAGGCCTGGTTGG No data
1124621216_1124621226 20 Left 1124621216 15:31275155-31275177 CCTTTGGAAGGAGCAATGGCGGG No data
Right 1124621226 15:31275198-31275220 GAGGATCCCAGAGGCCTGGTTGG No data
1124621221_1124621226 -9 Left 1124621221 15:31275184-31275206 CCCCACGGTAGAAGGAGGATCCC No data
Right 1124621226 15:31275198-31275220 GAGGATCCCAGAGGCCTGGTTGG No data
1124621213_1124621226 22 Left 1124621213 15:31275153-31275175 CCCCTTTGGAAGGAGCAATGGCG No data
Right 1124621226 15:31275198-31275220 GAGGATCCCAGAGGCCTGGTTGG No data
1124621222_1124621226 -10 Left 1124621222 15:31275185-31275207 CCCACGGTAGAAGGAGGATCCCA No data
Right 1124621226 15:31275198-31275220 GAGGATCCCAGAGGCCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124621226 Original CRISPR GAGGATCCCAGAGGCCTGGT TGG Intergenic
No off target data available for this crispr