ID: 1124628923

View in Genome Browser
Species Human (GRCh38)
Location 15:31326457-31326479
Sequence GCATGACGTCCGGGGGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124628923_1124628940 27 Left 1124628923 15:31326457-31326479 CCCGCCGCCCCCGGACGTCATGC No data
Right 1124628940 15:31326507-31326529 CCCTCCTCCCACCGGCCCAGGGG No data
1124628923_1124628934 19 Left 1124628923 15:31326457-31326479 CCCGCCGCCCCCGGACGTCATGC No data
Right 1124628934 15:31326499-31326521 GTTTCCGCCCCTCCTCCCACCGG No data
1124628923_1124628938 26 Left 1124628923 15:31326457-31326479 CCCGCCGCCCCCGGACGTCATGC No data
Right 1124628938 15:31326506-31326528 CCCCTCCTCCCACCGGCCCAGGG No data
1124628923_1124628936 25 Left 1124628923 15:31326457-31326479 CCCGCCGCCCCCGGACGTCATGC No data
Right 1124628936 15:31326505-31326527 GCCCCTCCTCCCACCGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124628923 Original CRISPR GCATGACGTCCGGGGGCGGC GGG (reversed) Intergenic
No off target data available for this crispr