ID: 1124631013

View in Genome Browser
Species Human (GRCh38)
Location 15:31337175-31337197
Sequence TAAGTGGCCTGCGGCAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 198}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124631008_1124631013 -9 Left 1124631008 15:31337161-31337183 CCCACTAGGCATGCTAAGTGGCC 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1124631013 15:31337175-31337197 TAAGTGGCCTGCGGCAGGGCAGG 0: 1
1: 0
2: 0
3: 20
4: 198
1124631006_1124631013 -4 Left 1124631006 15:31337156-31337178 CCTCTCCCACTAGGCATGCTAAG 0: 1
1: 0
2: 0
3: 3
4: 91
Right 1124631013 15:31337175-31337197 TAAGTGGCCTGCGGCAGGGCAGG 0: 1
1: 0
2: 0
3: 20
4: 198
1124630999_1124631013 13 Left 1124630999 15:31337139-31337161 CCATCTGCCCCCATGTCCCTCTC 0: 1
1: 2
2: 16
3: 101
4: 912
Right 1124631013 15:31337175-31337197 TAAGTGGCCTGCGGCAGGGCAGG 0: 1
1: 0
2: 0
3: 20
4: 198
1124631000_1124631013 6 Left 1124631000 15:31337146-31337168 CCCCCATGTCCCTCTCCCACTAG 0: 1
1: 0
2: 5
3: 41
4: 387
Right 1124631013 15:31337175-31337197 TAAGTGGCCTGCGGCAGGGCAGG 0: 1
1: 0
2: 0
3: 20
4: 198
1124630998_1124631013 24 Left 1124630998 15:31337128-31337150 CCACAGGGGTGCCATCTGCCCCC 0: 1
1: 1
2: 2
3: 35
4: 318
Right 1124631013 15:31337175-31337197 TAAGTGGCCTGCGGCAGGGCAGG 0: 1
1: 0
2: 0
3: 20
4: 198
1124631004_1124631013 3 Left 1124631004 15:31337149-31337171 CCATGTCCCTCTCCCACTAGGCA 0: 1
1: 0
2: 1
3: 24
4: 290
Right 1124631013 15:31337175-31337197 TAAGTGGCCTGCGGCAGGGCAGG 0: 1
1: 0
2: 0
3: 20
4: 198
1124631003_1124631013 4 Left 1124631003 15:31337148-31337170 CCCATGTCCCTCTCCCACTAGGC 0: 1
1: 0
2: 2
3: 20
4: 241
Right 1124631013 15:31337175-31337197 TAAGTGGCCTGCGGCAGGGCAGG 0: 1
1: 0
2: 0
3: 20
4: 198
1124631009_1124631013 -10 Left 1124631009 15:31337162-31337184 CCACTAGGCATGCTAAGTGGCCT 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1124631013 15:31337175-31337197 TAAGTGGCCTGCGGCAGGGCAGG 0: 1
1: 0
2: 0
3: 20
4: 198
1124631005_1124631013 -3 Left 1124631005 15:31337155-31337177 CCCTCTCCCACTAGGCATGCTAA 0: 1
1: 0
2: 1
3: 7
4: 127
Right 1124631013 15:31337175-31337197 TAAGTGGCCTGCGGCAGGGCAGG 0: 1
1: 0
2: 0
3: 20
4: 198
1124631001_1124631013 5 Left 1124631001 15:31337147-31337169 CCCCATGTCCCTCTCCCACTAGG 0: 1
1: 1
2: 3
3: 32
4: 311
Right 1124631013 15:31337175-31337197 TAAGTGGCCTGCGGCAGGGCAGG 0: 1
1: 0
2: 0
3: 20
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124631013 Original CRISPR TAAGTGGCCTGCGGCAGGGC AGG Intronic
900151094 1:1179708-1179730 GCAGTGGCCTGGTGCAGGGCAGG - Exonic
900372967 1:2340409-2340431 TCAGTGGCCAGGGGCAGGGCAGG - Intronic
901854903 1:12038408-12038430 AAAGTGGCCTGAGGGAGGGAAGG - Intergenic
902329358 1:15723631-15723653 TCTGTGGGCTGAGGCAGGGCAGG + Intronic
903879725 1:26500615-26500637 CGCGTGACCTGCGGCAGGGCGGG - Intergenic
906481130 1:46199518-46199540 TCAGTGGTCTGGGGCAGGGTGGG + Intronic
907270546 1:53288443-53288465 GATGGGGCCTGCGGCATGGCTGG + Intronic
908986049 1:70023286-70023308 TAAGTGGCCTCCAGCAGGAAAGG + Exonic
918472147 1:184885538-184885560 TCAGTGGCCTGCAGAGGGGCAGG - Intronic
920312499 1:205056826-205056848 TCATTGTCCTGCTGCAGGGCAGG - Intronic
921438744 1:215158769-215158791 TATGTGGCCTGGGGTAGGGCAGG - Intronic
1064048836 10:12042890-12042912 TGAGTGGCGGGCGGGAGGGCTGG - Intronic
1064443070 10:15370932-15370954 TCAGTGGGCGGCGGCGGGGCCGG - Intronic
1065198483 10:23290017-23290039 TAAACGGCCTGCTTCAGGGCAGG + Intronic
1066202757 10:33158083-33158105 TTACTGTCCTACGGCAGGGCAGG - Intergenic
1067269060 10:44773839-44773861 TCAGAGCCCTGCAGCAGGGCAGG - Intergenic
1070328925 10:75404575-75404597 TCTGGGGCCTGCGACAGGGCCGG + Intergenic
1070571625 10:77644019-77644041 CCAGTGACCTGGGGCAGGGCTGG - Intergenic
1072475637 10:95757398-95757420 GAGGTGGTCTGAGGCAGGGCTGG + Intronic
1074454585 10:113586256-113586278 TGGGTGGCCAGTGGCAGGGCTGG + Intronic
1074580484 10:114714288-114714310 TAAGTGACCTGCTGCAGATCAGG + Intergenic
1075203951 10:120430756-120430778 TAAGTGGCATGGGGCAGGGGTGG - Intergenic
1077010419 11:376891-376913 TGGGTGGCCTGCGCCCGGGCTGG - Exonic
1077907655 11:6546546-6546568 GCAGTGGCAGGCGGCAGGGCAGG - Exonic
1081907997 11:46681269-46681291 TGAGTGGCCACGGGCAGGGCTGG - Intronic
1083269287 11:61563278-61563300 TAGTTGGCCAGGGGCAGGGCTGG - Intronic
1084003796 11:66312994-66313016 TAAGTGGGCTGAGCCCGGGCTGG + Intergenic
1084086293 11:66856866-66856888 TGAGTGCGCTGCGGCAGCGCCGG + Intronic
1084554684 11:69868712-69868734 AAAGGGGGCTGCGGCCGGGCTGG - Intergenic
1089643972 11:119865811-119865833 TAAGTGGCAGGCAGCAGGGCTGG - Intergenic
1091678358 12:2508049-2508071 CCAGAGGCCTGCAGCAGGGCTGG + Intronic
1092106081 12:5922562-5922584 TTGGTGGCCTGCAACAGGGCTGG + Intronic
1096555532 12:52401227-52401249 TAGGTGGCCTGGGGCAACGCAGG + Intronic
1097197476 12:57251247-57251269 TGAGAGGTCTGGGGCAGGGCCGG + Intronic
1098267321 12:68735767-68735789 TAATTGGTCTGAGGTAGGGCTGG + Intronic
1100399643 12:94217663-94217685 GAAGTGGCATGGGGCAGGACTGG - Intronic
1100814456 12:98372854-98372876 TAAGTGGCCAACTGTAGGGCAGG + Intergenic
1104724278 12:131066479-131066501 AAGGTGGCCTGCGGTAGGGAGGG - Intronic
1106367899 13:29100972-29100994 TAAGTGGGGTGGGGCAGGGTGGG + Intronic
1106435442 13:29719713-29719735 TAGGTGGTCTGCAGCAGGGCTGG + Intergenic
1109687899 13:65844590-65844612 TACGTCGGCTGTGGCAGGGCAGG - Intergenic
1110525095 13:76526696-76526718 GAAGTGTCCTGAGGCAGTGCAGG + Intergenic
1112568020 13:100567978-100568000 GAGGTGGCATGAGGCAGGGCAGG + Intronic
1113938094 13:114005746-114005768 AAGGTGGCATCCGGCAGGGCCGG - Intronic
1113938120 13:114005820-114005842 AAGGTGGCGTCCGGCAGGGCAGG - Intronic
1113938146 13:114005894-114005916 AAGGTGGCGTCCGGCAGGGCAGG - Intronic
1113938169 13:114005968-114005990 AAGGTGGCGTCCGGCAGGGCAGG - Intronic
1113938181 13:114006004-114006026 AAGGTGGCGTCCGGCAGGGCAGG - Intronic
1113938195 13:114006042-114006064 AAGGTGGCGTCCGGCAGGGCAGG - Intronic
1113938207 13:114006078-114006100 AAGGTGGCGTCCGGCAGGGCAGG - Intronic
1113938241 13:114006188-114006210 AAGGTGGCGTCCGGCAGGGCAGG - Intronic
1113938253 13:114006226-114006248 AAGGTGGCATCCGGCAGGGCAGG - Intronic
1113938276 13:114006298-114006320 AAGGTGGCGTCCGGCAGGGCAGG - Intronic
1113938290 13:114006336-114006358 AAGGTGGCGTCCGGCAGGGCAGG - Intronic
1113938302 13:114006374-114006396 AAGGTGGCGTCCGGCAGGGCAGG - Intronic
1113938314 13:114006412-114006434 AAGGTGGCATCCGGCAGGGCAGG - Intronic
1113938337 13:114006484-114006506 AAGGTGGCGTCCGGCAGGGCAGG - Intronic
1113938351 13:114006522-114006544 AAGGTGGCGTCCGGCAGGGCAGG - Intronic
1113938374 13:114006598-114006620 AAGGTGGCATCCGGCAGGGCAGG - Intronic
1113938397 13:114006670-114006692 AAGGTGGCGTCCGGCAGGGCAGG - Intronic
1113938411 13:114006708-114006730 AAGGTGGCGTCCGGCAGGGCAGG - Intronic
1113938445 13:114006818-114006840 AAGGTGGCGTCCGGCAGGGCAGG - Intronic
1113938457 13:114006856-114006878 AAGGTGGCATCCGGCAGGGCAGG - Intronic
1113938480 13:114006928-114006950 AAGGTGGCGTCCGGCAGGGCAGG - Intronic
1113938492 13:114006966-114006988 AAGGTGGCATCCGGCAGGGCAGG - Intronic
1113938527 13:114007078-114007100 AAGGTGGCATCCGGCAGGGCAGG - Intronic
1113938562 13:114007188-114007210 AAGGTGGCGTCCGGCAGGGCAGG - Intronic
1113938574 13:114007224-114007246 AAGGTGGCGTCCGGCAGGGCAGG - Intronic
1113938609 13:114007317-114007339 AAGGTGGCGTCCGGCAGGGCAGG - Intronic
1113938623 13:114007355-114007377 AAGGTGGCGTCCGGCAGGGCAGG - Intronic
1117255395 14:53971957-53971979 TAAGAGGTCTGCTGCAGGGCTGG - Intergenic
1117351228 14:54883817-54883839 TATGAGGCCTGGGGCAGGGGTGG + Intronic
1118975640 14:70673782-70673804 TGAGTGTGCTGGGGCAGGGCTGG + Exonic
1119137631 14:72235150-72235172 TAAGTGGCCTGAGGTAGGTGTGG + Intronic
1121570807 14:94945244-94945266 GCAGTGGCCTGCGGCACAGCAGG + Intergenic
1121732159 14:96194444-96194466 CCAGTGGCCTGCGGCAGCACGGG + Intergenic
1122396969 14:101440750-101440772 TAAGATGCCTTCGGCAGGGGAGG + Intergenic
1122620833 14:103056975-103056997 TAAGTGCGCGCCGGCAGGGCCGG - Intronic
1122860255 14:104579331-104579353 ACAGGGGCCTGGGGCAGGGCGGG + Intronic
1123508392 15:20969746-20969768 TTAGTGGCCTTCTGCAGGGCAGG - Intergenic
1123565612 15:21543495-21543517 TTAGTGGCCTTCTGCAGGGCAGG - Intergenic
1123601876 15:21980782-21980804 TTAGTGGCCTTCTGCAGGGCAGG - Intergenic
1124371112 15:29105294-29105316 GCAGGGGGCTGCGGCAGGGCTGG - Intronic
1124631013 15:31337175-31337197 TAAGTGGCCTGCGGCAGGGCAGG + Intronic
1125024560 15:35017546-35017568 TAAAGGGCTTGCTGCAGGGCTGG - Intergenic
1126358061 15:47817182-47817204 TAGGTGGCCTGAGTCAGGGGCGG - Intergenic
1126390181 15:48140617-48140639 TTAGTGGGCTTTGGCAGGGCGGG - Exonic
1129596994 15:76973220-76973242 GAGGAGGCCTGGGGCAGGGCGGG + Intergenic
1129742869 15:77998433-77998455 CAGGTGGCCTGGGGCAGGGTGGG + Intronic
1129842602 15:78753013-78753035 CAGGTGGCCTGGGGCAGGGTGGG - Intergenic
1202973984 15_KI270727v1_random:270588-270610 TTAGTGGCCTTCTGCAGGGCAGG - Intergenic
1132717776 16:1300825-1300847 TAAGATGCTTGAGGCAGGGCAGG - Intergenic
1133973868 16:10586333-10586355 GAAGTTGCCTGCGGCGGGGTAGG - Intergenic
1134094466 16:11410591-11410613 AAGGTGGCCTGGGCCAGGGCTGG + Intronic
1135501135 16:22996759-22996781 TAAGTGTCCCAAGGCAGGGCAGG - Intergenic
1136381282 16:29897043-29897065 TCAGTGGCCCGTGGCAGGGAGGG + Exonic
1136655916 16:31709179-31709201 CAGGTGGGCTGTGGCAGGGCCGG + Intergenic
1138536606 16:57663655-57663677 TGACTGGCCTGGGGCTGGGCCGG - Exonic
1139469532 16:67170723-67170745 TGAGAGTCCTGCGGCAGGGCGGG - Intronic
1141756514 16:85994948-85994970 CAAGAGGCCTTCAGCAGGGCTGG + Intergenic
1142813349 17:2406886-2406908 TGAGTGGCCTGGGGCAGAACAGG - Intronic
1143372429 17:6448684-6448706 AAAGTGGCCTGGCTCAGGGCAGG + Intronic
1143586433 17:7852939-7852961 GAGGAGGCCTGAGGCAGGGCTGG - Intronic
1144701724 17:17344910-17344932 CAAGTGGCCTGCGACAGGTGAGG + Intronic
1147164138 17:38584490-38584512 AAAGTGGCCTGAGGCTGGGGTGG + Intronic
1147377948 17:40033926-40033948 TAAGAGGCCTTCAGCAGGGGAGG - Intronic
1147419194 17:40313673-40313695 TGAGTGGCATGAGGCAGGGTAGG - Intronic
1151682896 17:75631043-75631065 GGACTGTCCTGCGGCAGGGCAGG - Intronic
1152132547 17:78485750-78485772 AAAGAGGCCTGGGGCAGGGGAGG + Exonic
1152452061 17:80387757-80387779 TAAGTGGCTGGAGGCAGGGCTGG - Intronic
1152634850 17:81426735-81426757 GGTGTGGCCTGAGGCAGGGCAGG - Intronic
1154216755 18:12421124-12421146 TGAGAGGCCTGCGCCAGGCCAGG - Intronic
1156716838 18:40022418-40022440 TGAGGGTCCTGAGGCAGGGCAGG + Intergenic
1158883233 18:61801032-61801054 TAAGAGGCAGGGGGCAGGGCTGG - Intergenic
1158920566 18:62187193-62187215 GAAGTGGGCTGGGGCGGGGCTGG + Intergenic
1159942413 18:74418541-74418563 TAAGTGGATTGCGTCAGGGATGG - Intergenic
1162754283 19:12847833-12847855 GCAGTGGCCTGCGGGAGGGACGG - Exonic
1163581505 19:18142017-18142039 TAAGTGGCCTGGGGAAGTGTAGG + Intronic
1165834450 19:38745622-38745644 TGAGTGGCGTGGGCCAGGGCAGG - Intronic
1167503941 19:49861729-49861751 TAGGTGGCCTGCGGCGGGGTGGG - Intronic
1168598176 19:57695901-57695923 TGAGTGGGCTGGGGCGGGGCTGG - Intronic
924991610 2:317413-317435 TAGGTGGCCTGAGGGAGGCCTGG + Intergenic
925027360 2:620621-620643 TTAGTGGCATGTGGCTGGGCGGG + Intergenic
929111243 2:38406893-38406915 CAAATGGCCTGAGACAGGGCTGG - Intergenic
930153366 2:48080177-48080199 TAAGTGGCCTTTGGCAAGTCTGG - Intergenic
932442113 2:71744026-71744048 TCAGTGTCCTGAGCCAGGGCAGG - Intergenic
934564308 2:95330006-95330028 GAAGTGGTCAGAGGCAGGGCAGG - Intronic
934735120 2:96686131-96686153 ACACTGGCCTGCAGCAGGGCTGG + Intergenic
934993430 2:98936651-98936673 TCAGTGGCCTGCGGCGGGCGTGG + Intergenic
937318358 2:120946360-120946382 TGAGCGGCCTGCAGAAGGGCTGG + Intronic
937991388 2:127664282-127664304 TAGGTGGCCAGGGGCGGGGCGGG - Intronic
942892873 2:181013569-181013591 TAAGTGACCTGAGGGAGGGAAGG + Intronic
947841694 2:233211880-233211902 TCAGTGGCAGGTGGCAGGGCTGG - Intronic
948783878 2:240340865-240340887 ACAGAGGCCTGGGGCAGGGCAGG + Intergenic
948940080 2:241191067-241191089 TGAGTGTTCTGGGGCAGGGCGGG + Intronic
1169215943 20:3794928-3794950 GAAGTGGCCTCTGGCTGGGCGGG - Intronic
1174104065 20:48149640-48149662 TAGGTGGCCTGGGGCCAGGCAGG + Intergenic
1175638013 20:60601754-60601776 CAAGTGGACTACGGCAGGACTGG - Intergenic
1176663231 21:9660213-9660235 TTAGCTGCCTCCGGCAGGGCAGG + Intergenic
1179954342 21:44729829-44729851 AAAGCGGCCTGCAGCAGGGAGGG + Intergenic
1181475874 22:23167468-23167490 CCAGAGGCCTGCAGCAGGGCTGG - Intergenic
1182347125 22:29674205-29674227 TAAGGGGCCTGAAGCAGGGCAGG - Intronic
1182350041 22:29694275-29694297 GACGTGGCCTGAGGCAAGGCAGG - Intronic
1183256239 22:36764215-36764237 TCAGTGGCAGGAGGCAGGGCTGG + Intronic
1183389770 22:37538927-37538949 TAAGTGGCTGTCAGCAGGGCAGG + Intergenic
1183658968 22:39207243-39207265 CAGGTGGCCTGGAGCAGGGCTGG + Intergenic
1184246275 22:43237279-43237301 AAAGGGGCCTGGTGCAGGGCAGG - Intronic
1184884693 22:47335615-47335637 TCAGGGGCGTGAGGCAGGGCCGG + Intergenic
1184895045 22:47401748-47401770 GAAGCCGCCTGGGGCAGGGCAGG + Intergenic
1185413845 22:50699304-50699326 TGAGTGCCCTGGGGCAGGGATGG + Intergenic
951819444 3:26791656-26791678 ACAGTGGACTGGGGCAGGGCAGG - Intergenic
954837765 3:53484912-53484934 GAAGTGGCCTGCTGAAGGGAAGG + Intergenic
955432075 3:58856496-58856518 TAAGTGGCCTACAGCAGAGAGGG - Intronic
961456895 3:127028846-127028868 TAAGTGTGCTGCAGCAGGGGCGG + Intronic
961554912 3:127690924-127690946 GCTGTGGCCTGGGGCAGGGCTGG + Exonic
963074972 3:141337462-141337484 TCTGTGGACTGCGGCAGGGTTGG - Intronic
966119437 3:176506065-176506087 CATGTAGCCTGCGGCGGGGCGGG + Intergenic
968885864 4:3331844-3331866 TCATGGGCCTGCGGCAGAGCTGG + Intronic
969131001 4:4991079-4991101 TGAGAGCCCTGCAGCAGGGCGGG + Intergenic
969668068 4:8573707-8573729 TGAGTGGCCTCAGGCAGGGAAGG - Intronic
969728196 4:8938313-8938335 GAAGGGGCATGCGGCAGGACAGG + Intergenic
970141635 4:12989321-12989343 TAAGTGGCCGGCGGCGGGGATGG + Intergenic
972487517 4:39556363-39556385 TATGTGGCCTGGGGCAGGGAAGG - Intronic
972495006 4:39626211-39626233 TCAGTGGGCTGGGGCAGGGGTGG - Intronic
985412092 4:189695839-189695861 TTAGCTGCCTCCGGCAGGGCAGG - Intergenic
985578909 5:686483-686505 TGAGTGGGCTGGGGCGGGGCAGG - Intronic
985593755 5:778546-778568 TGAGTGGGCTGGGGCGGGGCAGG - Intergenic
995182355 5:109240677-109240699 GAAGGGGCCTGCAGCAGAGCTGG + Intergenic
995367238 5:111376426-111376448 TTAGGGGTCTGCGGCAGGGTAGG - Intronic
995924503 5:117354527-117354549 TGTGTGACCTGCAGCAGGGCAGG + Intergenic
995984606 5:118154404-118154426 TAAGTGACCTGTGTCAGTGCAGG - Intergenic
997749327 5:136329425-136329447 TAAGTGCCTTGCGACAGGGTTGG + Intronic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
1002422262 5:179154790-179154812 TAAGTGGCCTGGGGAAGGGTGGG - Intronic
1002433837 5:179219697-179219719 GAGGTGTCCTGCAGCAGGGCTGG + Intronic
1010750730 6:79613985-79614007 TAAGTGGTGTGCAGCAGGGGCGG + Intergenic
1013428266 6:110034261-110034283 TAAGGGGCCCGCAGCAGGGAAGG - Intergenic
1014778068 6:125533538-125533560 GAGGTGGCCTGGGGCAGGGGTGG - Intergenic
1017900604 6:158715791-158715813 TAAGTGTCCTGTGGCAGAGACGG - Intronic
1019646229 7:2130457-2130479 TACGTCGTCTGCGGCAGGTCTGG + Intronic
1021136956 7:16977019-16977041 TATGTGGCCTACTGCAGTGCAGG - Intergenic
1022486820 7:30785378-30785400 TCAGTGGTGTGCGGCAAGGCTGG + Intronic
1022978303 7:35578433-35578455 TGAGTGGCCAGCGGCAGCCCAGG + Intergenic
1023736551 7:43240823-43240845 GAAGTGGCCTCAGGCAGGGCTGG + Intronic
1031682393 7:124690512-124690534 CCAGTGGCCTGGGGCAGGGGTGG + Intergenic
1036381464 8:8238640-8238662 TCTGGGGGCTGCGGCAGGGCAGG - Intergenic
1037343022 8:17867663-17867685 TAAGTGTCTTGGGGCAGGGAGGG + Intronic
1037825789 8:22159905-22159927 TAAGGGCCCTGGGGGAGGGCAGG + Intronic
1038147718 8:24913732-24913754 TAAATGGGCTGCGGCGAGGCCGG + Exonic
1038334676 8:26636594-26636616 GAGGAGGCCTGCGGCAGGGCTGG - Intronic
1041535650 8:58922838-58922860 TGAGGGGCGAGCGGCAGGGCAGG + Intronic
1044202505 8:89453318-89453340 AAAGTGGCCAGTGGCAGGGATGG + Intergenic
1048311114 8:133323231-133323253 AAAGTTTCCTGGGGCAGGGCAGG + Intergenic
1048926520 8:139276940-139276962 TAGGTAGCCTGGGGCAGGGGAGG + Intergenic
1049601366 8:143509352-143509374 CAAGGAGCCTGCAGCAGGGCTGG - Intronic
1050101820 9:2127737-2127759 TAAGTGTGCTGAGGCAGGGATGG - Intronic
1052977258 9:34420489-34420511 TGAGTGCCCTGTGGCAGGGTAGG - Intronic
1053539678 9:38960361-38960383 TAAGTGGTAAGTGGCAGGGCAGG - Intergenic
1054626463 9:67403557-67403579 TAAGTGGTAAGTGGCAGGGCAGG + Intergenic
1055301418 9:74887201-74887223 GAAGCGGACTGCGGCGGGGCGGG + Intronic
1056501447 9:87213808-87213830 TAAGGGCCCAGCAGCAGGGCTGG + Intergenic
1057857023 9:98609710-98609732 GGAGTGGCCTGGGGCAGAGCTGG + Intronic
1059097212 9:111430983-111431005 AAAGAGGCCTGGGGCAGGGTAGG + Intronic
1060537194 9:124399843-124399865 TGAGAGGCCTGGGGCAGGGAGGG - Intronic
1060754878 9:126205604-126205626 CAAGTGGCCTGGGGCTGGACAGG + Intergenic
1062086064 9:134649136-134649158 CCAGTGGCCTGGGGCTGGGCTGG - Intronic
1062252739 9:135606440-135606462 TAAGGGGCCTTCTGCAGGCCAGG - Intergenic
1062283966 9:135764917-135764939 TTAGGGGCCTGGGGCAGGGCCGG - Intronic
1062573505 9:137196082-137196104 TGAGGGGCCTGCCCCAGGGCTGG - Intronic
1062599196 9:137312418-137312440 GAAGTGCCCTGTGTCAGGGCTGG - Intronic
1203662868 Un_KI270753v1:61552-61574 TTAGCTGCCTCCGGCAGGGCAGG - Intergenic
1203670502 Un_KI270755v1:7142-7164 TTAGCTGCCTCCGGCAGGGCAGG + Intergenic
1185681860 X:1895104-1895126 TAAGTGACCAGAGGCTGGGCTGG + Intergenic
1186393428 X:9183591-9183613 TGAGTGGCCAGGGGCAGGACTGG - Intergenic
1187397912 X:18934179-18934201 TATGTGGGTTGGGGCAGGGCTGG - Intronic
1195106043 X:101601963-101601985 TAAGTGGCCTAAGGCAGGTGGGG + Intergenic
1195106840 X:101611804-101611826 TAAGTGGCCTAAGGCAGGTGGGG - Intergenic
1200116439 X:153771733-153771755 TTGGGGGCCTGGGGCAGGGCTGG - Intronic
1200207417 X:154327135-154327157 GAAGTGGCCCAGGGCAGGGCTGG - Intronic