ID: 1124631630

View in Genome Browser
Species Human (GRCh38)
Location 15:31340978-31341000
Sequence CAGGATGAACACAGGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124631630_1124631636 -7 Left 1124631630 15:31340978-31341000 CCCTGTGCCCTGTGTTCATCCTG 0: 1
1: 0
2: 4
3: 33
4: 275
Right 1124631636 15:31340994-31341016 CATCCTGACAATTTGGGCTCTGG 0: 1
1: 0
2: 1
3: 7
4: 100
1124631630_1124631638 -1 Left 1124631630 15:31340978-31341000 CCCTGTGCCCTGTGTTCATCCTG 0: 1
1: 0
2: 4
3: 33
4: 275
Right 1124631638 15:31341000-31341022 GACAATTTGGGCTCTGGACCTGG 0: 1
1: 0
2: 0
3: 6
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124631630 Original CRISPR CAGGATGAACACAGGGCACA GGG (reversed) Intronic
900146037 1:1158990-1159012 CAGGATGAAAGCAGGGCAGTGGG + Intergenic
901219970 1:7578227-7578249 CAGGATCCACAGAGGGCACCTGG - Intronic
901630695 1:10646854-10646876 CAGGATCAACTCGGGGCCCATGG + Intronic
901690865 1:10972554-10972576 CAGGAAGAACACAAGGCACCTGG + Intronic
902280644 1:15371781-15371803 CAGGCTGAAGACAGGGTCCAAGG + Intronic
902330355 1:15728272-15728294 CCGGATGAGCACCGGGCACATGG + Exonic
902580574 1:17405039-17405061 CAGGGTGGCCACAGGTCACATGG + Intergenic
903768253 1:25748483-25748505 CAGGGTGAACACAGGACACAGGG - Intronic
905242232 1:36588658-36588680 CAACAGGAGCACAGGGCACAAGG - Intergenic
906076640 1:43056686-43056708 CAGGATCATCTCAGGGCTCATGG + Intergenic
906281599 1:44558218-44558240 CAGGATGATTTCAGGGCAAAAGG - Intronic
906395018 1:45455356-45455378 CAGGATGAAGTCATGGGACAGGG - Intronic
906792224 1:48669044-48669066 CAGAAGAAACACAGGGAACACGG - Intronic
907016991 1:51025600-51025622 CAGGATCAACGGAGGGCAAAAGG + Intergenic
907251200 1:53141118-53141140 CAGGCTGAAGACAAGGCCCAAGG - Intronic
907528746 1:55071531-55071553 CCCGATGAAGCCAGGGCACAGGG - Intronic
914390271 1:147215001-147215023 CAGGATGATCAGAAGGCAGAAGG + Intronic
915090738 1:153422801-153422823 CAGGAAGAAAAGAGGGCAAAGGG + Exonic
915094570 1:153452440-153452462 CAGGAAGAAAAGAGGGCAAAGGG - Intergenic
915279844 1:154814935-154814957 CTGGATGATCACAGCACACAAGG - Intronic
916189612 1:162166384-162166406 CAGGACATACTCAGGGCACAAGG - Intronic
919859787 1:201731919-201731941 CAGCATGAGCACAGGGCAGCTGG - Intronic
920092683 1:203465485-203465507 CAGGATGATCTGAGGGCACCAGG - Intergenic
923613626 1:235517998-235518020 CAGAATGAACAAGGGGAACAAGG - Intergenic
924635964 1:245788126-245788148 CCAGATTAACACAGGGAACAGGG + Intronic
924635980 1:245788202-245788224 CCAGATTAACACAGGGAACAGGG + Intronic
1063010235 10:2014382-2014404 CATAATGATCACGGGGCACATGG - Intergenic
1063957517 10:11280690-11280712 CAGGATGGACAGAGGACACATGG + Intronic
1064066615 10:12187672-12187694 GAGGAGGAAGACAGGTCACATGG - Intronic
1064593236 10:16916392-16916414 TAGGATCAACACAGGGTACTAGG - Intronic
1066084127 10:31960359-31960381 AAGGATGAACAGGGGGCCCACGG - Intergenic
1067088367 10:43254451-43254473 CAGGAAGAGCACAGCCCACAGGG - Intronic
1067419367 10:46133478-46133500 CTGGGGGGACACAGGGCACAAGG - Intergenic
1067426631 10:46215919-46215941 CTGGGGGAACACAGCGCACAAGG + Intergenic
1067504718 10:46840075-46840097 CTGGGGGGACACAGGGCACAAGG - Intergenic
1068114525 10:52722755-52722777 CAGGAGGAACAGAGGGAACAGGG + Intergenic
1068232447 10:54187015-54187037 CAGGATGAACACAAAACAAATGG - Intronic
1069574673 10:69517864-69517886 CAGGAGGAAAACTGGGCCCATGG + Intergenic
1069915221 10:71783029-71783051 CAGGAAGCACACAGCTCACAGGG - Intronic
1070962157 10:80506897-80506919 CAGTTTGACCACAGGCCACAGGG + Intronic
1071500867 10:86203510-86203532 CAGGACGAGCACTGGGCACCGGG + Intronic
1072267458 10:93744376-93744398 TAGGAAGAAAACAGGGAACAAGG - Intergenic
1072630087 10:97139799-97139821 CAGTGTGCACACAGGGCACTGGG + Intronic
1072802118 10:98399534-98399556 CAGGATGAACACATGTCGGATGG - Intronic
1075083629 10:119399911-119399933 CAGCCTGAACAAAGGCCACAAGG - Intronic
1075139115 10:119815727-119815749 GAGGTAGAACACAGGACACAAGG + Intronic
1075640183 10:124059076-124059098 TAGGCTGAACACCGGCCACACGG + Intronic
1076611518 10:131728933-131728955 CAGGATGTACACTTGGCTCACGG - Intergenic
1076865260 10:133163457-133163479 CAGGATGAGCTCAGAGCAGAAGG + Intronic
1077035990 11:494775-494797 CAGGCTGCACACAGGCCAGAAGG + Exonic
1077581213 11:3418515-3418537 GAGCAGGAACACAGGGCACGTGG + Intergenic
1077776754 11:5280662-5280684 CAGGATGCTTACAGGGCAGATGG - Intronic
1078443255 11:11385087-11385109 CAGGATGTACAGAGATCACATGG + Intronic
1079904223 11:26224543-26224565 CAGTGTGCACACAGGGCATAAGG - Intergenic
1081530943 11:43958961-43958983 GGGGATGAACACATGGCAGAAGG + Intergenic
1081991463 11:47339830-47339852 CAGGAGGAGCACAGGTCACTGGG + Intronic
1083934283 11:65862276-65862298 CAGGGTGAGCACAGGGATCAGGG + Exonic
1084045094 11:66563792-66563814 CAGGGTGAGCAGAGGGCACTGGG - Exonic
1084834270 11:71791481-71791503 GAGCAGGAACACAGGGCACGTGG - Intronic
1084876299 11:72136143-72136165 CAGCATGCACACAGGTCAGAGGG + Intronic
1084881271 11:72173212-72173234 CAGCATGCACACAGGTCAGAGGG + Intergenic
1085768219 11:79302680-79302702 CAAGGTGAACTCAGGGAACAGGG - Intronic
1088247693 11:107835205-107835227 CAGGCTGAACACAGTACACCTGG + Intronic
1089344815 11:117784451-117784473 CACGCTGAAGACTGGGCACATGG + Intronic
1089760136 11:120717139-120717161 CGCGATGAGCACAGGGCACCTGG - Intronic
1090428406 11:126626444-126626466 CAGAATGCACACAGGCCACAGGG + Intronic
1090593274 11:128294180-128294202 CAGGATGAAGACAGAGCAAGGGG - Intergenic
1091439518 12:501786-501808 CAGGATCATCACAGGGCACTTGG - Intronic
1092613129 12:10192377-10192399 TGGGATGGACACAGGGGACAGGG - Intergenic
1092729896 12:11521073-11521095 CAAGATTAAGACAGGGCCCAGGG - Intergenic
1092731612 12:11540203-11540225 CAGGAAGAACACTGGAAACAAGG - Intergenic
1092732029 12:11544076-11544098 CAGGATGCACCAAGGGCACCTGG + Intergenic
1094482497 12:30896009-30896031 CTGGATGTACACAGGTCTCATGG - Intergenic
1095965329 12:47863629-47863651 CAGGATAAACACAGGAGCCAGGG + Intronic
1096202070 12:49691614-49691636 CAAGCTCAGCACAGGGCACAGGG + Intronic
1096729098 12:53592122-53592144 CAGCAGTCACACAGGGCACATGG + Intronic
1099530013 12:83766877-83766899 CATGATTAAAACAGGACACAAGG - Intergenic
1100376635 12:94022493-94022515 CAGCATCAACACAAAGCACATGG - Intergenic
1103725180 12:122994299-122994321 CAGGCTGATCCCAGGGCACAGGG + Intronic
1104034915 12:125091553-125091575 CAGGATGCTCACAGGGCAAGGGG - Intronic
1104380011 12:128299101-128299123 AAGGTTGAACACAGGGCTCAGGG - Intronic
1104705909 12:130947274-130947296 CAGGAAGAACAAAGGTCAAAAGG + Intergenic
1104969411 12:132524419-132524441 CAGGGTGCACACAAGGCAGACGG - Intronic
1104973564 12:132542132-132542154 CAGGATGACCAGATGGCACAGGG + Intronic
1107185264 13:37510640-37510662 CAGAAAGTACACATGGCACAGGG - Intergenic
1108177832 13:47811849-47811871 CAGGATGAACACAGAGAAGGTGG + Intergenic
1108260967 13:48655828-48655850 CTGGTTGAGCCCAGGGCACATGG + Intronic
1108414959 13:50188406-50188428 CAGGATGAGAGCAGGACACAGGG + Intronic
1110569903 13:76992105-76992127 CAGGAGGTAGACACGGCACAGGG + Exonic
1112175430 13:97018771-97018793 CAGGGTGAGCACAGGGCCCAGGG - Intergenic
1113048708 13:106184931-106184953 CAGGATGAGCACATGACCCAAGG + Intergenic
1113181991 13:107639563-107639585 CAGGCTGCAATCAGGGCACAGGG - Intronic
1113485430 13:110649338-110649360 CAGGATAAAGACATGGCCCAAGG + Intronic
1113775982 13:112944899-112944921 CACCATGAACACTGGGCCCACGG - Intronic
1115395096 14:32899715-32899737 CACCATGATCACAGGGCACGGGG + Intergenic
1115573357 14:34687636-34687658 CAGGTTGTAAACACGGCACATGG + Intergenic
1118303402 14:64634766-64634788 CAGGAGGTGCACAGGGAACAGGG + Intergenic
1118793797 14:69121044-69121066 CACCATGAACAAAAGGCACAAGG + Intronic
1121463983 14:94102441-94102463 GAGGGTGAGCACAGGGCACAGGG - Intronic
1121727078 14:96160621-96160643 GTGGATGAAGACAGGGCTCAGGG - Intergenic
1121783200 14:96635863-96635885 GAGGAAGAAGACTGGGCACAGGG + Intergenic
1122277873 14:100604473-100604495 CAGGAGGAGCAAAGGGCTCACGG + Intergenic
1124035808 15:26052829-26052851 CAGGATGAGGACAGGACACAGGG - Intergenic
1124631630 15:31340978-31341000 CAGGATGAACACAGGGCACAGGG - Intronic
1125537500 15:40450598-40450620 CAGGAATAAAACAGGGGACAGGG - Intronic
1129607860 15:77033567-77033589 GTGGATGCTCACAGGGCACATGG - Intronic
1131324049 15:91425326-91425348 CAGGGTGAACACAGCAAACATGG - Intergenic
1131441175 15:92460874-92460896 CAGGCTCCACACAGGGCACGAGG - Intronic
1131448835 15:92521888-92521910 CAGGATGAAGTCACGGGACAGGG + Intergenic
1132246051 15:100297160-100297182 CAGCATATACACAGGGCCCAGGG + Intronic
1134132491 16:11659165-11659187 GAGGAAGAAGACAGGGCACGAGG + Intergenic
1134241240 16:12508656-12508678 CAGGCTTAACAGAGGGCACCAGG - Intronic
1134855382 16:17514436-17514458 CAGGATGAAGTCATGGTACAAGG + Intergenic
1135165998 16:20139597-20139619 TAGGATGAAGCCAGGGCACAGGG + Intergenic
1135245468 16:20853058-20853080 CCAGATAAACACAGGGCCCATGG + Intronic
1138131810 16:54486178-54486200 CAGGATGAAAGCAGGTCCCAGGG + Intergenic
1139053737 16:63156606-63156628 GAGGATTCCCACAGGGCACAGGG - Intergenic
1142289125 16:89184718-89184740 CAGGCTGAACAGAGGACACACGG - Intronic
1145897154 17:28465817-28465839 CAAGAAGAGCACTGGGCACATGG + Intronic
1150773028 17:68057560-68057582 AAATATGAACACAGGGCATAGGG + Intergenic
1151214144 17:72566125-72566147 CAGGAGGACCACTGGGCACAAGG - Intergenic
1151334674 17:73432930-73432952 GAGGAAGCACACAGGGCAGATGG + Intronic
1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG + Intronic
1151885958 17:76923536-76923558 GAAGATGAAGACAGGGCACGTGG + Intronic
1152068841 17:78125437-78125459 CAGGAAGCTCACAGAGCACAGGG + Intronic
1152573302 17:81129775-81129797 CAGGGTCAGCACAGGGCTCAGGG + Intronic
1152730081 17:81965862-81965884 CAGGCTGGGCACAGGGCACCAGG + Intergenic
1152750656 17:82061016-82061038 CAGGCTGAGCACTGGGCACACGG + Intronic
1153336282 18:3928996-3929018 CAGGAGGAAGACAGAGCAAAGGG - Intronic
1153934637 18:9910733-9910755 CAAAATGAACATAGGTCACATGG + Intergenic
1156106198 18:33665014-33665036 CAGAAAGAAGACAGGGAACAAGG - Intronic
1156815861 18:41310256-41310278 CAGGATGAAGTCATGGGACAGGG + Intergenic
1157404249 18:47410152-47410174 CTGGATGAAAACAGCCCACAGGG - Intergenic
1160144526 18:76352577-76352599 CAGGGTCAACACAGAGGACAAGG + Intergenic
1160443970 18:78913237-78913259 CAGAATGCACGCTGGGCACACGG - Intergenic
1161078628 19:2299372-2299394 CCGGATGCATTCAGGGCACATGG - Intronic
1162013803 19:7832796-7832818 CAGGAGGACCACGGGGAACAGGG + Intronic
1162042200 19:7977787-7977809 CAGGATGAGCACAAGGCTCCAGG + Intronic
1163268215 19:16234067-16234089 CAGGATGAGCACAGGCCTCAGGG - Intronic
1164102136 19:22065711-22065733 CAGGACAAACACAGGTGACATGG + Intronic
1164704788 19:30312279-30312301 CAGGATGAACAGAGGGGGCGGGG + Intronic
1164863539 19:31582956-31582978 CAGAATGTACACAGTCCACATGG + Intergenic
1164906483 19:31972572-31972594 CCAGATGAACACAGGGCACACGG + Intergenic
1165163036 19:33829331-33829353 CAGGATGAGCCCCGGGCACTCGG + Intergenic
1165241518 19:34472156-34472178 CAGGGTGAGGACAGGGCACGCGG - Intergenic
1165611127 19:37154107-37154129 CAGGCTGAACACAGAGAAAAGGG + Intronic
1165730766 19:38143264-38143286 GAGGAAGAACAGAGGGCACGAGG - Intronic
925140402 2:1546392-1546414 CAGTAAGCCCACAGGGCACAAGG - Intergenic
925303278 2:2832014-2832036 CCAGATGATCCCAGGGCACATGG + Intergenic
926137069 2:10343854-10343876 AGGGATGAACACATGGCCCATGG + Intronic
926772360 2:16389723-16389745 CAGGCTGGACACATGGCTCAGGG - Intergenic
927152418 2:20203689-20203711 CACCAGGAAGACAGGGCACAGGG - Intronic
927212440 2:20647046-20647068 CATGATGAAAACGAGGCACAGGG + Intronic
927485039 2:23482776-23482798 CAGGATGAATACCCAGCACATGG + Intronic
928886340 2:36152756-36152778 CAGGAGGAAGACAGAGCACATGG + Intergenic
929822605 2:45285367-45285389 CATGATGAACACTGGGCTCAAGG - Intergenic
929911571 2:46094159-46094181 CAGCAGGCACACAGGGCAGAAGG - Intronic
930755371 2:54967555-54967577 CAAGAGGACCACAGGGAACAGGG + Intronic
931710572 2:64986632-64986654 CAGGAGGCATAGAGGGCACATGG + Intergenic
932222605 2:70011332-70011354 CAGGTTGAAAACAGGGGGCAGGG + Intergenic
932476273 2:72008298-72008320 CTGGATGAACACAGGCGAGAGGG + Intergenic
932736974 2:74261085-74261107 CATGCAGAACACAGCGCACAGGG - Intronic
932744106 2:74317479-74317501 CGGGCTGAACACAGGGGAGATGG + Intronic
932824941 2:74930500-74930522 CAGGATGAATTCGGGGCACTGGG + Intergenic
933350943 2:81151523-81151545 CAGGATTAGCACAGGGTACTGGG - Intergenic
934111724 2:88749714-88749736 CAGCATGAACAAAGGCCTCAGGG + Intronic
934681737 2:96288589-96288611 CAGGATGCACACAGCACACAGGG + Intronic
936834143 2:116686477-116686499 AATGATGAGCACAGGGCACGAGG + Intergenic
937149009 2:119673048-119673070 TAGGAGCAGCACAGGGCACATGG + Intergenic
937986677 2:127641170-127641192 CAGGATTCACACTGGGCAGAGGG + Intronic
938201428 2:129376026-129376048 AAGGCTGAACACAGGGCTGAGGG - Intergenic
939734826 2:145830446-145830468 CCGGAAAAACACAGGGCATAAGG + Intergenic
939763228 2:146211140-146211162 CAAGAAGAACAGAGGGTACATGG + Intergenic
940724565 2:157321666-157321688 CAGGAAGAACAAAGGTCACCAGG - Exonic
947362763 2:229363276-229363298 CAGCAGCCACACAGGGCACATGG - Intronic
947428973 2:230009165-230009187 CAGGAGGAAGTCAGGACACAGGG + Intronic
947820072 2:233063307-233063329 CAGGATGAGGTCAGGGCACCTGG - Intronic
948082642 2:235219265-235219287 GTGGATGAACACAGGGCAAAGGG - Intergenic
948699264 2:239750245-239750267 CAGGATGAGCGCAGGGGACGAGG - Intergenic
948862901 2:240761491-240761513 CGTGATGTACACAGAGCACAGGG - Intronic
948930432 2:241128419-241128441 CAGGATGATCACAGAGCCAAGGG + Intronic
1169405457 20:5317660-5317682 CAGACTGAACACAGTCCACAAGG + Intergenic
1171353278 20:24522049-24522071 CAGGATGAACACAGCTGTCAGGG - Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172706446 20:36885803-36885825 CAGGAAGAAGACAGGCCACACGG + Intronic
1173705241 20:45105403-45105425 CAGGAAGGACACAGGGTAAATGG + Intergenic
1175364174 20:58440098-58440120 CAGGATGTACACTGGGAAGAGGG - Intronic
1175723325 20:61300624-61300646 CAGGAGGAACACTGGACAGAGGG - Intronic
1176139904 20:63540383-63540405 CAGGAGACACACAGGGCTCAGGG + Intergenic
1176622973 21:9071229-9071251 CAGACTGAACAGAGAGCACACGG - Intergenic
1177736188 21:25092821-25092843 CCTCAGGAACACAGGGCACAGGG + Intergenic
1178787515 21:35667499-35667521 CGGGATGTTCACTGGGCACAGGG - Intronic
1179418454 21:41216869-41216891 CACGATGGACAGTGGGCACAGGG + Intronic
1179495594 21:41769487-41769509 CAGGAGGAACACAGGGTAGTGGG - Intergenic
1179888470 21:44324525-44324547 CACGATGAACACACGGCGCTTGG - Exonic
1180620108 22:17155670-17155692 CAGGATGTACACAGAGAACCAGG + Intronic
1181419916 22:22790531-22790553 CAGGATGGACACTGCCCACAGGG + Intronic
1181459885 22:23079640-23079662 CTGGTGGAGCACAGGGCACAGGG + Intronic
1181487050 22:23238134-23238156 CGGGATGACCAGAGGGCCCAGGG - Intronic
1182703898 22:32262515-32262537 CAGCAGGGACACAGGCCACATGG - Intergenic
1183948440 22:41339701-41339723 CAGGATGAAGCCAGGCGACAGGG + Intronic
1184769757 22:46590186-46590208 CAGGAGGCACGCAGGGCACAGGG - Intronic
1184849513 22:47112286-47112308 CTGGGTGAACACTGGGCAGAAGG - Intronic
1184927252 22:47651496-47651518 CAGGGTGGTCAAAGGGCACAGGG + Intergenic
950548218 3:13651656-13651678 CAGGCTGAACACAGGGCTGTAGG - Intergenic
950702002 3:14757344-14757366 AAGGAGGAGCACAGTGCACAGGG - Intronic
951853705 3:27170967-27170989 CAGGATGAACTCAGGGCATTTGG - Intronic
952873802 3:37925102-37925124 AAGGATGGACAGAGGGGACAGGG - Intronic
953186454 3:40642420-40642442 TAGGGTGGACACAGGACACAGGG + Intergenic
953262755 3:41356143-41356165 CAGGGAGAACACAGGGGACAGGG - Intronic
954259013 3:49425381-49425403 CAGGTTGCTCACAGGGCACTGGG + Exonic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
955800465 3:62680996-62681018 CAGCAGGATCACAGGGAACATGG - Intronic
956353654 3:68366375-68366397 CAGAAAGAACAGAGGGCACAAGG + Intronic
956791885 3:72686320-72686342 CATGATGGAAACAGGGCCCATGG + Intergenic
957114161 3:76003191-76003213 CAGGATTAAGAGAGGGCATAGGG - Intronic
959343762 3:105165627-105165649 CAGCATGAACACAGGGAGTAAGG - Intergenic
961192489 3:124973692-124973714 CAGGATGACCCCAGGGCCCCCGG - Intronic
961774158 3:129272097-129272119 CAGCATGAAGACAGGGAACCTGG + Intronic
961887746 3:130107525-130107547 GAGCAGGAACACAGGGCACGTGG + Intronic
965504397 3:169496574-169496596 CAGGAAGAACAACTGGCACAAGG - Intronic
966819838 3:183915684-183915706 CAGGATGATCTCAGGGCACAGGG + Intergenic
967183290 3:186925014-186925036 CAGGAAGAAAACAGGCCAAATGG + Intergenic
968943090 4:3649321-3649343 CAGGATGAACACAGGGAAGGAGG - Intergenic
969196497 4:5567507-5567529 CAGGATGAAAACATTGCACCAGG - Intronic
970189637 4:13501473-13501495 AAGGAAGAACATAGGGCAGATGG - Intergenic
970575520 4:17423208-17423230 CAGGAGGAACAGAGAGCAAAGGG + Intergenic
971132900 4:23833254-23833276 CAGTACCAACACTGGGCACATGG + Intronic
973107160 4:46354476-46354498 CAAGAAAAACACAGGGAACAAGG + Intronic
973628102 4:52792679-52792701 CAGGATGAACACTGGAAAGATGG + Intergenic
977309066 4:95362294-95362316 CAGGATGAGCACATGACCCAAGG + Intronic
979754628 4:124325562-124325584 CAGGATGAATTCAGGGCTCTAGG + Intergenic
982677782 4:158395795-158395817 CAGGAGGAAATCAGGGGACAGGG + Intronic
982754611 4:159203455-159203477 GAGCATGTACACAGGGCACTGGG + Intronic
982829335 4:160041790-160041812 CAGGATGAAAAGATGGCAGAAGG + Intergenic
984788369 4:183590647-183590669 AAGCATGAACACACGGCACTTGG - Intergenic
984901488 4:184590579-184590601 CCAGAGGAACACGGGGCACAGGG - Intergenic
985428573 4:189855679-189855701 CAGGAGGAACAGAGGGGAAATGG - Intergenic
985607348 5:865134-865156 CAGGGTCCACAGAGGGCACAGGG + Intronic
985670372 5:1203692-1203714 CAGCATGACCAAAAGGCACAGGG - Intronic
985937000 5:3105047-3105069 CAGGATGGTCAGAGGGCACTGGG - Intergenic
985941161 5:3137379-3137401 CTGGATGCTCACAGGGCACATGG - Intergenic
986721955 5:10565929-10565951 CAGGATAAACCAAAGGCACAAGG - Intronic
987125916 5:14812578-14812600 CAGGCTGAAGACAGGGCTCAAGG - Intronic
987327946 5:16829230-16829252 CAGGCAGCACCCAGGGCACAGGG - Intronic
988650707 5:33147510-33147532 TAGGATGAAGACAAGCCACAGGG + Intergenic
989675978 5:43973186-43973208 CAGGATGAAGACAGGGGCAAAGG + Intergenic
994649265 5:102506024-102506046 CAGGCTGAAGACAGAGCCCAAGG + Intergenic
997127500 5:131242902-131242924 CATTGTGAACAAAGGGCACAGGG + Intergenic
999373124 5:151068284-151068306 CTGGATGACCACTGGGCAGACGG + Intronic
999424489 5:151475518-151475540 CTGCATGAACACAGAGCACACGG - Intronic
999950237 5:156641727-156641749 AAGGATGATCACAGGGCCCACGG - Intronic
1000903242 5:166933615-166933637 CAGGATGGACCCAGGGCAGGCGG - Intergenic
1001650561 5:173312892-173312914 CAGGATGAACCCAGATCTCATGG - Intergenic
1003192078 6:3883116-3883138 CAGGAGGCACAGAAGGCACAGGG - Intergenic
1005840932 6:29744258-29744280 CAGGCTCACCAGAGGGCACAGGG + Intergenic
1006072440 6:31507287-31507309 CAGGCTCACCAGAGGGCACAGGG - Exonic
1006679690 6:35788061-35788083 CAGGGTGAACACAGAGCTCTGGG - Exonic
1006900003 6:37493854-37493876 CAGGCTGTGCACAGGGCTCAGGG - Intronic
1007406957 6:41640728-41640750 CCAGATGCAGACAGGGCACAAGG + Intronic
1010643726 6:78361873-78361895 CATGATGTTCACAGGCCACATGG + Intergenic
1011002917 6:82611238-82611260 CAGGAAGATCACAAGGCAGAAGG + Intergenic
1011067970 6:83349556-83349578 AGGGATGAAGACAGGACACATGG - Intronic
1015588382 6:134799499-134799521 AAGGGTGAACACAGGGTCCAGGG + Intergenic
1016962423 6:149686806-149686828 CAGGATGAAGGCAGGGCTTAGGG - Intronic
1018066919 6:160131066-160131088 CAGGAAGAAGACAGGGGCCAGGG + Intronic
1018517040 6:164594624-164594646 CAGGCTGCCCACAGGACACAAGG + Intergenic
1019140079 6:169937459-169937481 ACGTTTGAACACAGGGCACATGG - Intergenic
1019162742 6:170080159-170080181 GAGGAGGAACACAGGACACTTGG - Intergenic
1019191062 6:170251231-170251253 CAAGCTGAACACAGGGCATGTGG - Intergenic
1019665046 7:2247623-2247645 CAGGCGGAACACGGGGAACAGGG - Intronic
1021773086 7:24024757-24024779 CAGGCTGAACAGATGGAACACGG - Intergenic
1022032304 7:26503658-26503680 CAGGAGGGACCAAGGGCACAGGG - Intergenic
1022832988 7:34086914-34086936 CAAGATGAACACAGCCCAAAAGG + Intronic
1024663094 7:51518371-51518393 GAGGATGAAGGCAGGGCTCAGGG + Intergenic
1030084015 7:105802090-105802112 GAGGATGACCACAGAGCACAAGG - Intronic
1033791452 7:144796509-144796531 CAGGAACTGCACAGGGCACAGGG + Intronic
1035042120 7:155936515-155936537 CAGGATGACCACTGGGCAGAGGG - Intergenic
1035311474 7:157972354-157972376 AAGGATGAAACCAGAGCACATGG + Intronic
1036014847 8:4771688-4771710 CATGCTGGACACAGGGGACACGG - Intronic
1036100764 8:5781827-5781849 CAGTAAGAACACAGGATACAAGG - Intergenic
1037301478 8:17456148-17456170 CTGGAAGAACACAGGACCCAAGG - Intergenic
1039194866 8:35019799-35019821 CAGGATGAAAACTGAGCGCAGGG - Intergenic
1042577927 8:70241561-70241583 CAGGATGAACATAATGGACAAGG - Intronic
1043652546 8:82614501-82614523 CAGCATGTACACAGATCACATGG - Intergenic
1043728519 8:83644625-83644647 CAGGATGATCAGATGTCACATGG + Intergenic
1044927732 8:97223809-97223831 CAGGTTTAACACAGGGAAGAGGG - Intergenic
1044933929 8:97276121-97276143 CAGAATGAAGCCAGTGCACATGG - Exonic
1047806555 8:128367036-128367058 CAGGATGAACCCAAGGCACATGG - Intergenic
1048157135 8:131967412-131967434 CAGCCTGAAAACAGGGCAGAGGG + Intronic
1048330026 8:133464938-133464960 CAGGATGAACAAGGCGCCCACGG - Exonic
1049212325 8:141392400-141392422 CAGGATGAACTCAGGGTAGGAGG - Intronic
1051073564 9:13203216-13203238 AAGGATGAACACAGACTACAGGG + Intronic
1053201049 9:36151760-36151782 CAGGGGGAGCCCAGGGCACAGGG - Intronic
1055111382 9:72563440-72563462 CAGAATGAACACAGTGACCATGG + Intronic
1055712403 9:79077445-79077467 CAGGAAGAACACTGGGCTGAGGG - Intergenic
1056733334 9:89184122-89184144 CAGGATGAAGAGAGAGCAAAGGG - Intergenic
1057064398 9:92035102-92035124 CAGCAGGCACACAGGGCTCATGG - Intronic
1058091852 9:100814143-100814165 CTGGATGTACACACGGCTCAGGG + Intergenic
1059756496 9:117298400-117298422 CAGGTTGAACACATGGGACCTGG - Intronic
1061838872 9:133346419-133346441 CAGGAAGCACCCAGTGCACAGGG - Intronic
1062053200 9:134457760-134457782 CAGGATGACCCCAGGGCAGGAGG - Intergenic
1062204875 9:135330465-135330487 CAGGATCAGCTCAGGGGACAAGG - Intergenic
1062722346 9:138050971-138050993 CAGGAAGAGCACAGGGGGCAGGG + Intronic
1185655296 X:1679549-1679571 GAAGATGAACACAGAGCAAAGGG - Intergenic
1187057474 X:15754449-15754471 TATGATGAGCACAGAGCACAGGG - Intronic
1190070249 X:47273527-47273549 CAGGTTGCTCACAGGGCACTGGG + Intergenic
1190823708 X:53997679-53997701 CAGGATGGACCCAGGGACCAAGG - Intronic
1193634467 X:83931217-83931239 CAGGAGGAAAACAGAGAACAGGG - Intergenic
1193800407 X:85928779-85928801 TAAGATAAACACTGGGCACAAGG + Intronic
1199596223 X:149508183-149508205 CAGAATGATGACAGGACACAGGG + Intronic
1201343410 Y:12957542-12957564 CAGCATGAGCACAGAGCACCAGG - Intergenic
1201725948 Y:17152397-17152419 CAGGAAGAATCCAGGTCACATGG + Intergenic