ID: 1124632909

View in Genome Browser
Species Human (GRCh38)
Location 15:31347454-31347476
Sequence GCGTCAAAGGGCACCCTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 70}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124632902_1124632909 0 Left 1124632902 15:31347431-31347453 CCCGCTAGAACCTGTGTGTGCTA 0: 1
1: 0
2: 1
3: 10
4: 111
Right 1124632909 15:31347454-31347476 GCGTCAAAGGGCACCCTCAGGGG 0: 1
1: 0
2: 1
3: 10
4: 70
1124632904_1124632909 -10 Left 1124632904 15:31347441-31347463 CCTGTGTGTGCTAGCGTCAAAGG 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1124632909 15:31347454-31347476 GCGTCAAAGGGCACCCTCAGGGG 0: 1
1: 0
2: 1
3: 10
4: 70
1124632903_1124632909 -1 Left 1124632903 15:31347432-31347454 CCGCTAGAACCTGTGTGTGCTAG 0: 1
1: 0
2: 2
3: 8
4: 98
Right 1124632909 15:31347454-31347476 GCGTCAAAGGGCACCCTCAGGGG 0: 1
1: 0
2: 1
3: 10
4: 70
1124632901_1124632909 18 Left 1124632901 15:31347413-31347435 CCGCACGTGGGTGGCAAGCCCGC 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1124632909 15:31347454-31347476 GCGTCAAAGGGCACCCTCAGGGG 0: 1
1: 0
2: 1
3: 10
4: 70
1124632899_1124632909 28 Left 1124632899 15:31347403-31347425 CCAGGCTTTGCCGCACGTGGGTG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1124632909 15:31347454-31347476 GCGTCAAAGGGCACCCTCAGGGG 0: 1
1: 0
2: 1
3: 10
4: 70
1124632898_1124632909 29 Left 1124632898 15:31347402-31347424 CCCAGGCTTTGCCGCACGTGGGT 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1124632909 15:31347454-31347476 GCGTCAAAGGGCACCCTCAGGGG 0: 1
1: 0
2: 1
3: 10
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124632909 Original CRISPR GCGTCAAAGGGCACCCTCAG GGG Intronic
900197999 1:1387141-1387163 GGGTCAAAGGGCAGCCACCGGGG + Exonic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
903721112 1:25406180-25406202 GTGACAAAGGGCACCCTGGGGGG - Intronic
904006187 1:27364462-27364484 GCATCAAAGGTCAGCATCAGTGG + Intronic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
916572386 1:166039031-166039053 GCGTCTATGGGAACCCTAAGAGG - Intergenic
918168167 1:181970412-181970434 ATTTCAAAAGGCACCCTCAGGGG + Intergenic
923449477 1:234103355-234103377 GCCTTCAAGGCCACCCTCAGAGG + Intronic
1070060822 10:72981337-72981359 GCCTCACAGGACACCCTCAGTGG - Intergenic
1073355461 10:102850363-102850385 GGGTCAAAGGCTACCCTGAGCGG + Intergenic
1074105069 10:110383198-110383220 GGGTGAGAGGCCACCCTCAGTGG + Intergenic
1075588853 10:123677083-123677105 AGGTGAATGGGCACCCTCAGAGG + Intronic
1083619281 11:64040943-64040965 GGGTCAAAGGGCATCCTCATGGG + Intronic
1083700991 11:64477590-64477612 GCCTCAAAGGGCTCCCTCGATGG + Intergenic
1091196317 11:133733826-133733848 GTGTCACAGGGACCCCTCAGAGG - Intergenic
1091765369 12:3116870-3116892 GCGTCCAAGGGCGGCCACAGAGG - Intronic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1096257127 12:50070220-50070242 GTGTCAAAGGGCATACACAGAGG - Intronic
1098671125 12:73232304-73232326 GTGTATATGGGCACCCTCAGTGG - Intergenic
1099437189 12:82658978-82659000 GTGTGAAAGGGCACCCAAAGGGG + Intergenic
1104970720 12:132529477-132529499 AGGTGAAAGGGCAGCCTCAGGGG - Intronic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1108001893 13:45911464-45911486 GGGTCAAAGGAGCCCCTCAGTGG + Intergenic
1114055551 14:18964828-18964850 GTGTCCCAGGGCACCCTCAGTGG - Intergenic
1114106995 14:19436935-19436957 GTGTCCCAGGGCACCCTCAGTGG + Intergenic
1116996242 14:51328155-51328177 GCTTCAAAGGGCAGCTGCAGAGG - Intergenic
1118793496 14:69117655-69117677 GAGTCAAAGGGCACATTCAGAGG + Intronic
1121263657 14:92584579-92584601 GCCTCACTGGGGACCCTCAGAGG + Intronic
1121996478 14:98607200-98607222 GAGTCAAAGGCCACCCGGAGAGG + Intergenic
1122780329 14:104140763-104140785 GTGTCAAAGGCCAAGCTCAGGGG - Intronic
1124632909 15:31347454-31347476 GCGTCAAAGGGCACCCTCAGGGG + Intronic
1128336145 15:66786928-66786950 GCCTCACAGGCCACTCTCAGAGG - Intergenic
1134207232 16:12248155-12248177 GCCTTAAAGGGTTCCCTCAGAGG - Intronic
1134249041 16:12561658-12561680 GTGTGTGAGGGCACCCTCAGAGG - Intronic
1134443683 16:14314673-14314695 GGGTCTTAGGGGACCCTCAGGGG - Intergenic
1144790533 17:17856113-17856135 GCTGCCAAGGCCACCCTCAGGGG + Intronic
1146931818 17:36783125-36783147 GAGTTAAATGGCACCCTCTGGGG - Intergenic
1151676898 17:75603278-75603300 GCCTCAAAGGGCACACGCACGGG - Intergenic
1167385477 19:49160656-49160678 GTGTCAGAGGCCACCCTAAGGGG + Intronic
925913065 2:8585960-8585982 AAGCCAAAGGGCACCCTGAGGGG + Intergenic
926725130 2:15991855-15991877 GCGTCAGGGGGCACCCTGGGAGG - Intergenic
933162416 2:79040124-79040146 GCGGTAGAGGGCACCATCAGAGG - Intergenic
936400458 2:112160932-112160954 GCGTGAAAGTGCACCCTCCAGGG + Intronic
938473718 2:131589403-131589425 GCATCCCAGGGCACCCTCAGTGG - Intergenic
939517187 2:143183466-143183488 GCATCAGTGGGCACCATCAGAGG + Intronic
941042246 2:160635707-160635729 GAATCAAAGGGAACACTCAGAGG - Intergenic
942595572 2:177589016-177589038 GCTCCAAGGGGCACCCTCTGAGG + Intergenic
946118714 2:217489796-217489818 GAGGCAAAGAGCAACCTCAGAGG + Intronic
948139043 2:235659574-235659596 GCTTCAAATGGCACGTTCAGGGG - Intronic
948771035 2:240251371-240251393 GCCTCACAGAGCAGCCTCAGAGG + Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1173003582 20:39123103-39123125 GAGGCAAAGGGACCCCTCAGGGG + Intergenic
1180474028 22:15687380-15687402 GTGTCCCAGGGCACCCTCAGTGG - Intergenic
1183640772 22:39091044-39091066 TCCTCGAAGGGCATCCTCAGTGG + Intergenic
954577368 3:51684044-51684066 GGGTGGAAGGGCCCCCTCAGTGG + Intronic
954662766 3:52234858-52234880 GCCTCACAGGGCAGCATCAGAGG - Intronic
969548178 4:7845752-7845774 GCTTCACAGGGCAGCCACAGGGG + Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
979665717 4:123308877-123308899 GGGTCAAAGGGCAGCAACAGTGG - Intronic
985051793 4:185998738-185998760 GTGTCCAAGGACACGCTCAGGGG - Intergenic
991116032 5:62956159-62956181 GCATCAAAGGACACAATCAGAGG - Intergenic
997398296 5:133581959-133581981 GAGTAACAGGGCACCCTCATTGG - Intronic
997610642 5:135213375-135213397 GAGTCAAAGGGGAGCTTCAGAGG + Intronic
1001984575 5:176061961-176061983 GCCTCGGAGGGCACCCTCAGAGG + Exonic
1002232940 5:177782236-177782258 GCCTCAGAGGGCACCCTCAGAGG - Exonic
1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG + Intronic
1003012132 6:2435953-2435975 GGGTCAGAGGACACCCACAGAGG + Intergenic
1007063723 6:38968323-38968345 GCTTCAGAGGGCACCATCAGAGG + Intronic
1010566567 6:77422433-77422455 GCTTCAAAGGTCAACCTCATTGG - Intergenic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1012029751 6:94043497-94043519 GGGTAAAAGGGCATCCCCAGGGG - Intergenic
1013936645 6:115604493-115604515 GCTTCAAATTGCACCCTCATGGG - Intergenic
1017470530 6:154733717-154733739 GCGGGGAAGGGCTCCCTCAGCGG - Intronic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1035253590 7:157612817-157612839 CGGTCAAAGGGCATCCACAGAGG + Intronic
1037828710 8:22176176-22176198 GCACCAACGGGCAGCCTCAGAGG + Exonic
1049256901 8:141618983-141619005 GCGTTAAAGGGCACCCGCCCTGG - Intergenic
1049541424 8:143210875-143210897 GTGTGAAAGGGGACCCGCAGTGG - Intergenic
1051151386 9:14083278-14083300 GGGTCAAAGGGCAAAATCAGTGG + Intronic
1062284864 9:135768373-135768395 GAGTCACAGTGCCCCCTCAGTGG - Intronic
1190317274 X:49159096-49159118 GGGTCCAAGGACATCCTCAGGGG + Intergenic