ID: 1124636027

View in Genome Browser
Species Human (GRCh38)
Location 15:31365789-31365811
Sequence GCATTTGCATGTGGCTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 342}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124636021_1124636027 30 Left 1124636021 15:31365736-31365758 CCCGAGTCTGAGCTCAGGCTTTG 0: 1
1: 0
2: 3
3: 25
4: 296
Right 1124636027 15:31365789-31365811 GCATTTGCATGTGGCTGCTGTGG 0: 1
1: 0
2: 0
3: 29
4: 342
1124636022_1124636027 29 Left 1124636022 15:31365737-31365759 CCGAGTCTGAGCTCAGGCTTTGA 0: 1
1: 0
2: 0
3: 22
4: 193
Right 1124636027 15:31365789-31365811 GCATTTGCATGTGGCTGCTGTGG 0: 1
1: 0
2: 0
3: 29
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124636027 Original CRISPR GCATTTGCATGTGGCTGCTG TGG Intronic
900000968 1:14721-14743 TCCTCTGCCTGTGGCTGCTGCGG + Intergenic
900020683 1:185242-185264 TCCTCTGCCTGTGGCTGCTGCGG + Intergenic
900378519 1:2372375-2372397 GATGTTGCATGTGGCTCCTGAGG - Intronic
900383346 1:2396649-2396671 ACATGTGGGTGTGGCTGCTGGGG + Intronic
900743621 1:4345374-4345396 GCATCTGCGTCTGGCTGCAGTGG - Intergenic
901332720 1:8423594-8423616 GCGCTTACCTGTGGCTGCTGGGG - Intronic
902248368 1:15136884-15136906 TCTTCTGAATGTGGCTGCTGCGG + Intergenic
904049095 1:27627313-27627335 GCCTGTGCATGAGGCAGCTGAGG - Intronic
904533605 1:31184535-31184557 GCAACTTCATGTGGTTGCTGAGG - Intronic
906097792 1:43235977-43235999 GCGTCAGCATGAGGCTGCTGGGG + Intronic
906249987 1:44303645-44303667 GCTCATGCATGTGGCTGGTGGGG + Intronic
907782738 1:57582221-57582243 ACAGTTCCATGTGGCTGCGGAGG + Intronic
911422017 1:97654844-97654866 GCAGTTCCATGTGGCTGGGGAGG + Intronic
912557856 1:110529202-110529224 GCATTTGCCTGTGGTGGGTGGGG + Intergenic
913511810 1:119569128-119569150 GCTTGTGCATGTGCCTGCTAGGG + Intergenic
913708314 1:121450986-121451008 GCATTTGTAGGTTGCTGCTAGGG + Intergenic
915575254 1:156771554-156771576 GCATTTGCCTCAGGCAGCTGGGG + Intronic
916322967 1:163525544-163525566 GCATTTGCCTGGGGCTGGAGGGG - Intergenic
916477215 1:165181470-165181492 GCATTTGCTTGTGCCAGCTTAGG - Intergenic
917568787 1:176241124-176241146 GCAGTTTCATGTATCTGCTGAGG - Intergenic
921508816 1:216007166-216007188 ACAGTTGCATGTGGCTGGGGAGG - Intronic
922467410 1:225853704-225853726 GCAATGGCATGGAGCTGCTGCGG - Exonic
924219423 1:241857236-241857258 ATATTAGCATGTGCCTGCTGAGG + Intronic
924596908 1:245454397-245454419 GCATTTGGAAGGGGCTGCTCAGG - Intronic
924943389 1:248827701-248827723 GCATTTTCATGGGGGAGCTGGGG + Intergenic
1063360118 10:5446637-5446659 GCATGGGCACGTGGCTGCCGAGG + Intronic
1064053091 10:12074993-12075015 GCATGTGCCTGTGGAGGCTGAGG + Intronic
1064920757 10:20515373-20515395 GCAGTTCCACGTGGCTGCGGAGG + Intergenic
1064936359 10:20683123-20683145 GCTTTTGCATTAGTCTGCTGGGG - Intergenic
1067319631 10:45205625-45205647 GCATTTGAAGGTGGCAGCAGCGG - Intergenic
1067664884 10:48269405-48269427 GCATGTGGATGTTGCTGGTGGGG + Intronic
1071086815 10:81875194-81875216 GGATTTGCATGCGGCCGCCGCGG + Intergenic
1073205264 10:101765882-101765904 GGATTTGGATGTGGCTTGTGCGG - Intergenic
1073254061 10:102139832-102139854 GCATTGGCAGGTGGGTTCTGAGG - Exonic
1074192356 10:111149014-111149036 GGATTTGCATTTGGCTGCATGGG + Intergenic
1074192517 10:111150147-111150169 GGATTTGCATTTGGCTGCATGGG + Intergenic
1074496940 10:113987581-113987603 TCATTTCCATGTGGCTGAGGAGG - Intergenic
1074925008 10:118059766-118059788 GCTTTTTCATTTGGCTGCTCTGG - Intergenic
1075167752 10:120084579-120084601 GCATTTCCACGTGGCTGGGGAGG - Intergenic
1075621041 10:123928644-123928666 GCATCTCCGTGTGGCTGCTTGGG - Intronic
1076155536 10:128202319-128202341 ACAGTTCCATGTGGCTGGTGAGG + Intergenic
1076303885 10:129449684-129449706 ACAATTGCATGTGGTTGCTGAGG - Intergenic
1076805926 10:132858716-132858738 GCGTGTGCCTGTGGCTGGTGGGG + Intronic
1077117404 11:891374-891396 CCATTTGCATGGCGCTGGTGGGG - Intronic
1077896420 11:6456845-6456867 GCATTCTCATGTGGCCGCTCCGG + Exonic
1078826230 11:14933207-14933229 ACAGTTGCATGTGGCTGGGGAGG + Intronic
1079110225 11:17601265-17601287 ACATTTGCATGTGGCAGGAGAGG + Intronic
1079272792 11:19004366-19004388 ACATTTCCATGTGGCTGGGGAGG + Intergenic
1080865690 11:36192832-36192854 GCATGTGCATTTGGCCCCTGAGG - Intronic
1080933053 11:36833629-36833651 GCAGTTCCATGTGGCTGGGGAGG + Intergenic
1080952870 11:37056417-37056439 ACAGTTCCATGTGGCTGCGGAGG - Intergenic
1081659436 11:44878942-44878964 GCATTTCCATCGTGCTGCTGAGG - Intronic
1082022218 11:47544122-47544144 GCATTTTCTTGTGTCTGTTGTGG - Intronic
1084479955 11:69414258-69414280 ACAGTTGCACGTGGCTGCAGAGG - Intergenic
1084594469 11:70108776-70108798 GCATCTCCATGTGGCTGTTCCGG + Intronic
1086620549 11:88883021-88883043 ACAGTTGCATGTGGCTGGGGAGG - Intronic
1086764458 11:90676849-90676871 ACAGTTCCATGTGGCTGGTGAGG - Intergenic
1087374739 11:97326697-97326719 GCTTTTGCATAGGGCTGCTGTGG + Intergenic
1087969975 11:104468493-104468515 GCGTTTGCAGGTGGGTGGTGAGG + Intergenic
1088367879 11:109058117-109058139 GCAGTTGCATGTGGCTGCCCAGG + Intergenic
1088589905 11:111394523-111394545 ACAGTTCCATGTGGCTGGTGGGG - Intronic
1088860807 11:113797536-113797558 GCAATTGCCGGTGTCTGCTGAGG + Intergenic
1088895726 11:114076948-114076970 GCCGTTGAATCTGGCTGCTGGGG - Intronic
1089387666 11:118078853-118078875 GCATGTGCGTGGGGCTGTTGTGG - Intronic
1090106223 11:123855457-123855479 GCATCTGCAGGAGGCAGCTGGGG - Intergenic
1091147588 11:133293189-133293211 TCCTTTGCATGTGTCTGCTCAGG - Intronic
1091395817 12:153720-153742 GCTTTTGCATGGGGGTGGTGAGG - Intronic
1091932268 12:4405463-4405485 ACATTTCCATGTGGCTGAGGAGG - Intergenic
1091982849 12:4880441-4880463 GCAGTTCCATGTGGCTGGGGCGG + Intergenic
1092526784 12:9314428-9314450 TCCTCTGCCTGTGGCTGCTGGGG + Intergenic
1092540487 12:9417351-9417373 TCCTCTGCCTGTGGCTGCTGGGG - Intergenic
1092892011 12:12978114-12978136 GCCTTCGCATCTGGCTGCAGTGG - Intronic
1094512557 12:31105128-31105150 TCCTCTGCCTGTGGCTGCTGGGG + Intergenic
1094527022 12:31238103-31238125 GCAGGTGCATGTGGCTGCAGGGG + Intergenic
1094628577 12:32149959-32149981 GCAGTTCCAGGTGGCTGCGGAGG + Intronic
1095783803 12:46088321-46088343 GCATTTACATTTTGCTGATGAGG + Intergenic
1096800825 12:54109416-54109438 GCATGTGCCTGAGGCTGATGTGG - Intergenic
1097996811 12:65896894-65896916 TCAACTTCATGTGGCTGCTGTGG + Intronic
1099785111 12:87252350-87252372 GCATTTGCATCAGGAAGCTGAGG - Intergenic
1099888965 12:88566203-88566225 GCAGTTTCATGTGTCTGCTGAGG + Intronic
1100156498 12:91805356-91805378 GCTCTTCCATGGGGCTGCTGTGG - Intergenic
1100294464 12:93247960-93247982 GCACATGCTTGTGCCTGCTGGGG - Intergenic
1101637368 12:106555717-106555739 ACAGTTCCATGTGGCTGCGGAGG + Intronic
1102042935 12:109812169-109812191 GCATCTGCATGTGGTTTGTGTGG - Intronic
1103007450 12:117432884-117432906 CCATCTTCATATGGCTGCTGAGG + Intronic
1103402552 12:120653163-120653185 GCATTTACTTCTGGCTGCAGAGG - Intronic
1104380339 12:128301839-128301861 GCAGTTCCATGTGGCTGGGGAGG + Intronic
1105708529 13:22983358-22983380 CCATTTCCAGGTGGCAGCTGTGG - Intergenic
1105836202 13:24214196-24214218 ACATGTGCAGGTGGCTGCTTTGG - Intronic
1105881042 13:24606919-24606941 GCCTTTCCATATGGCAGCTGTGG + Intergenic
1107451950 13:40517718-40517740 GTATCTGCATGTGTCTCCTGGGG - Intergenic
1107731873 13:43356897-43356919 GCTCTTGCACGGGGCTGCTGTGG - Intronic
1107803427 13:44131871-44131893 TCATGTGCATGTGGCAGGTGAGG + Intergenic
1108454169 13:50596669-50596691 TCATTTTCATATGGCTGCGGAGG + Intronic
1110045277 13:70820804-70820826 CCATATGCATGTAGATGCTGTGG - Intergenic
1110924476 13:81132649-81132671 GCAGTTGCATGTGGTTGGGGAGG - Intergenic
1111874199 13:93872809-93872831 TCATTTCTAAGTGGCTGCTGCGG - Intronic
1112339849 13:98544061-98544083 GCATTTACGTTAGGCTGCTGTGG + Intronic
1112571474 13:100597416-100597438 GCCTCTCCATGTGGCTGCTTAGG - Intergenic
1112750886 13:102582356-102582378 CCATTTCCATGTGGCTGGGGAGG + Intergenic
1113671762 13:112180403-112180425 GCATATGCATGAGTCTACTGAGG + Intergenic
1114007747 14:18332767-18332789 GCATTTGAAGGTGGCAGCAGCGG + Intergenic
1115158045 14:30362491-30362513 GCATCTGCACGTGGCCACTGGGG + Intergenic
1115974581 14:38982206-38982228 TCATATGCATGTGCCTGCTTTGG + Intergenic
1117438902 14:55742394-55742416 GGATCTCCATGTGGCTGATGTGG + Intergenic
1119493949 14:75062778-75062800 GCATTTGTGTGTGCCTGTTGAGG + Intronic
1120248190 14:82030281-82030303 GCAAGTGCATGTTGCTGCTCAGG - Intergenic
1120541969 14:85761990-85762012 GCCTTTCGATGTGGCTACTGAGG + Intergenic
1121386175 14:93528353-93528375 GGATTTAAATGTGGCTGCCGTGG - Intronic
1121654167 14:95583214-95583236 ACAGTTGCATGTGGCTGGAGAGG + Intergenic
1121811556 14:96895704-96895726 GCAGTTCCATGTGGCTGGGGAGG + Intronic
1121840879 14:97132802-97132824 GCAGTTCCATGTGGCTGCGGAGG + Intergenic
1122910172 14:104823895-104823917 GCAGTTCCATGTGGCTGGGGAGG + Intergenic
1124636027 15:31365789-31365811 GCATTTGCATGTGGCTGCTGTGG + Intronic
1126398841 15:48248270-48248292 GCATTTGTATGAGGCTGAAGAGG + Intronic
1128710492 15:69867814-69867836 ACAGTTCCATGTGGCTGCAGAGG - Intergenic
1128810522 15:70568432-70568454 ACACTTGCATATGGATGCTGAGG - Intergenic
1130265444 15:82397739-82397761 GCATTTTCAGGTGGCTTTTGAGG + Intergenic
1130506566 15:84549132-84549154 GCATTTTCAGGTGGCTTTTGAGG - Intergenic
1131476287 15:92742946-92742968 GCATTTGAATGTGGCTCTTAGGG + Intronic
1132307618 15:100827680-100827702 GATTTTGCATGTGGCTTGTGTGG - Intergenic
1132452541 15:101976219-101976241 TCCTCTGCCTGTGGCTGCTGCGG - Intergenic
1132454357 16:14403-14425 TCCTCTGCCTGTGGCTGCTGCGG + Exonic
1133021539 16:2969121-2969143 TCATTTGCATGGGGTGGCTGTGG - Intronic
1133891716 16:9885509-9885531 GCCTTTGTAGGTGGCTGGTGTGG - Intronic
1135345307 16:21684249-21684271 GGATTTGCATGTGGCTTGTCTGG + Intronic
1135421534 16:22308556-22308578 GCACTTCCATGTGGCTGGAGGGG - Intronic
1137704207 16:50522869-50522891 TCATCTGCAGGTGGCTCCTGGGG - Intergenic
1138076603 16:54049032-54049054 TCAGTGGCATCTGGCTGCTGGGG - Intronic
1138197481 16:55062122-55062144 GCATGGGCATGAGGCAGCTGAGG - Intergenic
1139129593 16:64125410-64125432 GCATTTGCATTTTGCAGATGAGG + Intergenic
1139823267 16:69737583-69737605 GCATTAGCAGGTGGCTCATGAGG - Intergenic
1140331216 16:74058743-74058765 GCAGTTCCATGTGGCTGGGGAGG - Intergenic
1140890898 16:79284334-79284356 GCATTTGCCTTTGGATGGTGTGG - Intergenic
1141951797 16:87344435-87344457 TTATAAGCATGTGGCTGCTGTGG - Intronic
1142764654 17:2058448-2058470 GCATCTTCATGTGGCTGATGAGG - Exonic
1143997264 17:11017583-11017605 GGATTTGCAGGTGGATGCAGTGG + Intergenic
1144017694 17:11212067-11212089 GCCTTTCCATGTGGCTGCTTGGG - Intergenic
1144614575 17:16757366-16757388 GCCTTTGCCAGTGGCTGGTGAGG + Intronic
1144898131 17:18558308-18558330 GCCTTTGCCAGTGGCTGGTGAGG - Intergenic
1145442598 17:23127869-23127891 GCATCTGCAAGTGGATGCTTGGG + Intergenic
1146831996 17:36077606-36077628 GCATTTGCATTGGGCTCTTGTGG - Intergenic
1147034697 17:37671352-37671374 GCATTAGAATGTGGCTGATAGGG - Intergenic
1149343892 17:55715234-55715256 GTATGTGCATGTTTCTGCTGAGG - Intergenic
1149435300 17:56628841-56628863 GCACCTGGATGAGGCTGCTGAGG + Intergenic
1149438659 17:56656188-56656210 GCCTTTCCATGTGGCTGCTTGGG + Intergenic
1149699533 17:58643978-58644000 GCATTTTCAAATGGCTGCTCTGG - Intronic
1149828677 17:59852044-59852066 GGCTTTCCATGTGGCTGCTTTGG + Intergenic
1150000779 17:61438148-61438170 GGATTTGCATGTGTCCTCTGTGG + Intergenic
1151556095 17:74847488-74847510 GCAAGTCCGTGTGGCTGCTGTGG - Exonic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1153262765 18:3240532-3240554 ACATTTCCATGTGGCTGAGGAGG - Intergenic
1153519669 18:5939918-5939940 GCAAGATCATGTGGCTGCTGAGG - Intergenic
1154093637 18:11388893-11388915 GCATATGCATGTCTGTGCTGAGG + Intergenic
1154324511 18:13380207-13380229 CCTTGTGCATGTGGGTGCTGTGG + Intronic
1154529714 18:15331196-15331218 GCATTTGAAGGTGGCAGCAGCGG - Intergenic
1155224762 18:23719596-23719618 GTATTTGCATCTGGCTCCTGGGG - Intronic
1158859557 18:61579017-61579039 GCATAAGCAGGAGGCTGCTGGGG + Intergenic
1158889230 18:61858078-61858100 GGGTTTGCATGTGGCTGCAGAGG - Intronic
1160322992 18:77913968-77913990 GCAGGTGCACCTGGCTGCTGGGG + Intergenic
1160893268 19:1390672-1390694 GTATTTGAATGTGGCTGGTGGGG + Intronic
1161685494 19:5700741-5700763 GGATTTGCATGTGGGTGCCCGGG - Intronic
1162587584 19:11570215-11570237 GCAGTTGCAAGTGGCGGTTGAGG + Intronic
1163754059 19:19096154-19096176 GCGATTGCATGAGGATGCTGAGG + Exonic
1164696092 19:30245420-30245442 CCATTTGCAAGTCGCTGCTCTGG - Intronic
1164888836 19:31805712-31805734 GCATTGACAAGTGGCTTCTGGGG + Intergenic
1165088256 19:33366659-33366681 GCACTTTCATTTGGCTCCTGTGG + Intergenic
925879340 2:8338946-8338968 GCATTTCCACGTGGTTGCTTTGG - Intergenic
926607936 2:14915969-14915991 GCAGTTCCATGTGGCTGGGGAGG - Intergenic
926700691 2:15801265-15801287 TCATTTGCATGTGGCCCCAGTGG - Intergenic
926767130 2:16331211-16331233 GCATTTGCATCTGCATCCTGTGG - Intergenic
926809565 2:16744485-16744507 GCATTTCCAAGTGGCTGACGAGG + Intergenic
928126364 2:28619389-28619411 GTATTTGCATGTGGGTGAGGAGG + Intronic
928834143 2:35522819-35522841 GCATGTGCCTGCGGCTGTTGGGG + Intergenic
931994328 2:67825170-67825192 TCATTTGAATGTGCCGGCTGAGG + Intergenic
932144386 2:69305630-69305652 ATATTAGCAGGTGGCTGCTGAGG + Intergenic
932905071 2:75740197-75740219 GCAGTTCCATGTGGCTGGGGAGG + Intergenic
935825910 2:106949180-106949202 GCAGTTGCATGAGGAGGCTGAGG + Intergenic
936568753 2:113598693-113598715 TCCTCTGCCTGTGGCTGCTGCGG - Intergenic
937079817 2:119132871-119132893 GGATTTGGATTTGGCTGATGAGG - Intergenic
937273310 2:120669154-120669176 GCAAAGGCATGTGGCTGCTGAGG - Intergenic
938093121 2:128446227-128446249 GGATTTGAATGTGGGTGGTGTGG + Intergenic
938528808 2:132162636-132162658 GCATTTGAAGGTGGCAGCAGCGG - Intronic
938959896 2:136331519-136331541 GCATTGGCGTGTTGGTGCTGAGG + Intergenic
938961791 2:136350637-136350659 GCAGTTCCATGTGGCTGAGGAGG - Intergenic
939425906 2:142036031-142036053 ACATTTCCATGTGGCTGGGGAGG - Intronic
940543109 2:155046800-155046822 ACAGTTCCATGTGGCTGCAGAGG + Intergenic
942036546 2:172015828-172015850 GCATGTGCATGTAGCTACTCGGG + Intronic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
942740775 2:179175045-179175067 CCAGTGGCATGTGTCTGCTGAGG - Intronic
943980166 2:194539546-194539568 GCATGTTTATGTGGCTGCTTAGG - Intergenic
945095790 2:206217821-206217843 GCCGGTGCCTGTGGCTGCTGCGG + Exonic
946130114 2:217600160-217600182 GCATCTGCATGAGGCTGCGGGGG - Intronic
946807376 2:223484712-223484734 GTGTTTGCATGTGGCAGCTGAGG - Intergenic
948310634 2:236983197-236983219 GCATTTCCAGATGGCTGCTTGGG + Intergenic
948647597 2:239416979-239417001 ACAGTTGCATGTGGCTGGGGAGG - Intergenic
1171852601 20:30319212-30319234 GCATGTGCCTGAGGCTGATGTGG - Intergenic
1172583570 20:36066485-36066507 GCCATTGCATGTGGTTGGTGTGG - Intergenic
1173062526 20:39675892-39675914 ACATCTGAATGAGGCTGCTGGGG + Intergenic
1173177778 20:40777467-40777489 GCATTTGGAGTTGGCTGCAGTGG - Intergenic
1173221507 20:41136575-41136597 GCATTTGCAGGAGGGCGCTGCGG + Intergenic
1174102520 20:48138344-48138366 GCTTCTGGGTGTGGCTGCTGGGG + Intergenic
1174175963 20:48645081-48645103 GCGTCTGTATCTGGCTGCTGCGG - Intronic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1176060546 20:63170670-63170692 GCAGCTGAATGTGTCTGCTGGGG - Intergenic
1176767698 21:13037276-13037298 GCATTTGAAGGTGGCAGCAGCGG + Intergenic
1176860851 21:14010982-14011004 CCAGTTGCATGAGGGTGCTGAGG + Intergenic
1180432252 22:15263577-15263599 GCATTTGAAGGTGGCAGCAGCGG + Intergenic
1180514818 22:16131514-16131536 GCATTTGAAGGTGGCAGCAGCGG + Intergenic
1181235709 22:21446704-21446726 GCATGCGCAGGTGGCTGATGAGG - Exonic
1181769288 22:25113640-25113662 GCATTTGCAACTGCCTGCTCTGG - Intronic
1182182232 22:28362372-28362394 GCAGTTCCATGTGGCTGGGGAGG - Intronic
1183693118 22:39402454-39402476 GCATTTGCAAGGGTATGCTGGGG + Intronic
1184924686 22:47629105-47629127 GCATGTGCATGTGTGTGATGTGG + Intergenic
949476093 3:4447040-4447062 GCACCTGGATGGGGCTGCTGGGG + Intronic
949526033 3:4904966-4904988 TCATTTTCATGTGGCTGCTTAGG - Intergenic
949812487 3:8020797-8020819 GCACATGCCTGTGGCTGTTGGGG + Intergenic
950709003 3:14801973-14801995 CCATTGCCCTGTGGCTGCTGGGG - Intergenic
950798702 3:15532007-15532029 CCATTTCCATTTGGCTGCTAAGG - Intergenic
951003209 3:17589585-17589607 GCAGTTCCATGTGGCTGGGGAGG - Intronic
951469860 3:23044445-23044467 GCTTTTCCACGGGGCTGCTGTGG - Intergenic
951868031 3:27329235-27329257 ACATTTCCATGTGGCTGGGGAGG - Intronic
952501083 3:33962590-33962612 GCCTTTCCATATGGCTGCTTGGG + Intergenic
952819978 3:37478096-37478118 GCATTGGGAAGGGGCTGCTGGGG - Intronic
953619195 3:44518217-44518239 GCATTTGCAGCTGGGTGCGGTGG - Intergenic
954369639 3:50163471-50163493 TCATTTGCATGTGGCATCAGAGG + Intronic
954534603 3:51350038-51350060 GCAGCTGCACGTGGCTGCAGTGG + Intronic
954555859 3:51517329-51517351 GCCTTTCCATTAGGCTGCTGAGG - Intergenic
954787264 3:53102995-53103017 GTATTTCCATCTGGCAGCTGTGG - Intronic
956493019 3:69794251-69794273 ACATTTGCAGGTGGCTATTGTGG + Intronic
956675801 3:71730852-71730874 GCATGTGCTTGTAGCTACTGGGG - Intronic
958646065 3:96876064-96876086 GCATTTGTATGTGCTTGCTCTGG - Intronic
963005354 3:140722025-140722047 GCATTGCCATGTGACTCCTGAGG + Intergenic
963011792 3:140776846-140776868 ACAGTTTCATGTGGCTGATGAGG + Intergenic
967417098 3:189231083-189231105 CCCTTTGCAGGTGACTGCTGTGG - Intronic
970273601 4:14372864-14372886 GCAGTTCCATGTGGCTGAGGAGG - Intergenic
972629092 4:40828079-40828101 ACAGTTCCATGTGGCTGGTGAGG - Intronic
973710423 4:53624472-53624494 ACAGTTGCATGTGGCTGGGGAGG - Intronic
976051424 4:81015617-81015639 ACAGTTCCATGTGGCTGGTGAGG + Intergenic
976531083 4:86152582-86152604 GGATTTGAATGTGGGGGCTGAGG - Intronic
977189278 4:93978861-93978883 ACAGTTCCATGTGGCTGGTGAGG - Intergenic
980727726 4:136786988-136787010 ACATTTCCATGTGGCTGGGGAGG - Intergenic
981359508 4:143830641-143830663 ACAATTGCATGTGGCTGGGGAGG - Intergenic
981380032 4:144061660-144061682 ACAATTGCATGTGGCTGGGGAGG - Intergenic
981716987 4:147761428-147761450 ACATTTGTATGTGGCTTCTTTGG + Intronic
981761694 4:148201972-148201994 GTATTTGTAGGTGTCTGCTGTGG - Intronic
982174187 4:152689969-152689991 CTATTTCCCTGTGGCTGCTGAGG + Intronic
983219021 4:165026776-165026798 GCAATTGCATGTTGCTCTTGAGG + Intergenic
983611731 4:169653707-169653729 GCATTTGCTTCTGTCTGGTGAGG + Intronic
984026672 4:174551132-174551154 CCAGTTCCATGTGGCTGCGGAGG - Intergenic
984841419 4:184071431-184071453 GCAGTTCCATGTGGCTGGGGAGG + Intergenic
985429309 4:189863065-189863087 GCATTTTCATTTGGGTGCGGTGG - Intergenic
988817561 5:34849915-34849937 GCAATTGGAAGGGGCTGCTGTGG + Intronic
988964632 5:36403768-36403790 GCTTTTTTATGTTGCTGCTGGGG - Intergenic
989156819 5:38352219-38352241 ACAATGACATGTGGCTGCTGGGG - Exonic
989279611 5:39625992-39626014 ACAGTTCCATGTGGCTGGTGAGG + Intergenic
990594762 5:57301581-57301603 GCATTTGCATGTGGTGGTGGTGG + Intergenic
991337352 5:65563797-65563819 CCAACTTCATGTGGCTGCTGTGG - Intronic
992488251 5:77216340-77216362 ACATTTCCATGTGGCTGGGGAGG + Intronic
992629487 5:78666740-78666762 GCCTTTGCTTGTGGATGCTAAGG + Intronic
994400961 5:99277974-99277996 GTATTTGCATTTTGCAGCTGGGG + Intergenic
994536330 5:101034566-101034588 ACAGTTGCATGTGGCTGAGGAGG - Intergenic
995692209 5:114839612-114839634 GCACTTGCATGTGTCTTCAGAGG + Intergenic
998183537 5:139961926-139961948 GCATTTGCATGGGGCTGCCTCGG - Intronic
998856960 5:146403118-146403140 GCATTTCAATGTGCCTGGTGGGG - Intergenic
998869377 5:146537171-146537193 GCATTTGGAGGTGGCGACTGTGG + Intergenic
999052041 5:148533400-148533422 ACATTTGCACATGGCTGCAGTGG - Intronic
999473568 5:151877802-151877824 ACAGTTGCATGTGGCTGGGGAGG - Intronic
1000891524 5:166808072-166808094 TCATTTGTATGTGACTGCTGAGG + Intergenic
1002103550 5:176869016-176869038 GCAGTGACATGTGGCTGGTGGGG + Intronic
1002666928 5:180831771-180831793 GCATGTGCACGTGGCAACTGAGG - Intergenic
1003454089 6:6264749-6264771 GCATTTGCAACTGGTTGATGGGG - Intronic
1004324679 6:14664359-14664381 GCCTGTGCAGGTGGCTGCTGAGG + Intergenic
1004703450 6:18101003-18101025 TCAATTCCATGTGGCTGCGGAGG + Intergenic
1005044527 6:21629202-21629224 GCATGCGCCTGTAGCTGCTGGGG - Intergenic
1006154586 6:32007370-32007392 GCACTTGCACATGGCTGCAGTGG + Intergenic
1006805381 6:36785132-36785154 GCATGTTAATGGGGCTGCTGGGG + Intronic
1007349578 6:41259168-41259190 GCAGTTCCATGTGGCTGAGGAGG - Intergenic
1007380411 6:41486828-41486850 GCAAGTGCATGTGTGTGCTGGGG + Intergenic
1007784507 6:44271992-44272014 CAATTAGGATGTGGCTGCTGGGG + Intronic
1007911373 6:45518165-45518187 TTATTTGCCTGTGGCTGCTGTGG - Intronic
1009045840 6:58237053-58237075 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1009221655 6:60991366-60991388 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1011526742 6:88273653-88273675 TCATTTGCATATGTCTGCTCTGG + Intergenic
1012388813 6:98713090-98713112 GCATATGAATGTGGGTGCTTAGG - Intergenic
1015712185 6:136154195-136154217 GCATTTCCAGGTGGCTGAGGAGG - Intronic
1017441215 6:154465986-154466008 TCAGTTGCATATGGCTGCTTAGG - Intronic
1017536025 6:155348959-155348981 ACTTTTGCATAGGGCTGCTGTGG + Intergenic
1018025588 6:159803358-159803380 GAATTTGAAGGTGGCAGCTGTGG - Intronic
1018380818 6:163256604-163256626 GCCTTTGCATGTGCTTTCTGTGG - Intronic
1018608748 6:165625767-165625789 ACAGTTCCATGTGGCTGCGGAGG - Intronic
1018938963 6:168295394-168295416 GAATTTGCCTGTGGGTTCTGTGG - Intronic
1022865853 7:34419233-34419255 ACATTTGCATGTACTTGCTGAGG + Intergenic
1022883923 7:34622199-34622221 GCACTGGCATGGGGCTGCAGGGG - Intergenic
1022957663 7:35396269-35396291 TCATTTCCTTGTGACTGCTGGGG - Intergenic
1023238346 7:38114732-38114754 ACATTTCCATGTGGCTGGGGAGG - Intergenic
1024281170 7:47721101-47721123 GGATTGGCTTGTGGCTGCTCTGG - Intronic
1024416145 7:49108792-49108814 ACATTTCCATGTGGCTGGGGAGG - Intergenic
1024611017 7:51064201-51064223 GAACTCGCATGTGGCTGATGTGG + Intronic
1025157432 7:56620975-56620997 GCATGTGCCTGGGGCTGTTGGGG - Intergenic
1025758335 7:64367140-64367162 GCATATGCCTGGGGCTGTTGGGG + Intergenic
1026561397 7:71453371-71453393 ACAGTTGCATGTGGCTGGAGAGG + Intronic
1027840887 7:83309342-83309364 GCAGTTGCAATTGGCAGCTGAGG + Intergenic
1030455423 7:109766855-109766877 TCTTTTCCATGGGGCTGCTGTGG - Intergenic
1030666273 7:112282119-112282141 GTATTTTCATGTAGCTGGTGTGG - Intronic
1031908159 7:127484358-127484380 ACAGTTGCATGTGGCTGGGGAGG - Intergenic
1032259237 7:130321617-130321639 GCAGTTCCACGTGGCTGGTGAGG + Intronic
1032416816 7:131741857-131741879 GCTGTTGCCTGTTGCTGCTGTGG + Intergenic
1032802979 7:135331255-135331277 ACAGTTCCATGTGGCTGGTGAGG - Intergenic
1034496788 7:151427876-151427898 GCTCTTGGCTGTGGCTGCTGGGG - Intergenic
1034876848 7:154732400-154732422 GCATATGCATGTGACTGCTTTGG - Intronic
1036406409 8:8459420-8459442 GCAGTTCCATGTGGCTGGGGAGG + Intergenic
1037142212 8:15533200-15533222 ACAGTTCCATGTGGCTGCGGAGG - Intronic
1039921323 8:41896296-41896318 GCACCTGCAAGTGGCTGCTGGGG - Intronic
1040028742 8:42805092-42805114 GCATGTGCATGGGGGTGCAGTGG - Intergenic
1041255715 8:55978368-55978390 GAATGTGCATGGGGCAGCTGAGG + Intronic
1041828376 8:62124309-62124331 GGCTTTGCAGGTGACTGCTGTGG - Intergenic
1041889948 8:62858098-62858120 GCTGTTGCATAGGGCTGCTGTGG + Intronic
1042023966 8:64402905-64402927 GCTTTTGAATGTGTTTGCTGTGG + Intergenic
1042080724 8:65047912-65047934 GCAGTTCCATGTGGCTGGGGAGG + Intergenic
1042866108 8:73357897-73357919 GCAATTTCATGAGGCTGCAGGGG - Intergenic
1043818138 8:84829059-84829081 GCAGTTCCATGTGGCTGGGGAGG + Intronic
1043860900 8:85316011-85316033 GCAGTTGCATATGGCAGCTGAGG - Intergenic
1043880675 8:85539187-85539209 GCATCTGTATGTGGGAGCTGTGG - Intergenic
1043991183 8:86757030-86757052 TCAGTTGCATGGGGCTACTGAGG + Intergenic
1048247997 8:132830447-132830469 CCATTTGAAGGTGGCAGCTGTGG - Intronic
1048293566 8:133198364-133198386 TCAGTTGTATGAGGCTGCTGTGG - Intronic
1048375157 8:133816817-133816839 GGATTTGCATGTCACTGCTCAGG - Intergenic
1049618759 8:143588461-143588483 GCATGGGCATGTGGCTGGTCAGG - Intronic
1049883775 9:14832-14854 TCCTCTGCCTGTGGCTGCTGCGG + Intergenic
1049947800 9:614671-614693 GCATTTCCGTGTGCCTCCTGGGG + Intronic
1050069796 9:1798673-1798695 TCAATTGCCTGTGGCTTCTGAGG - Intergenic
1050832637 9:10032569-10032591 GCTTGTACATGTGGCTGATGTGG - Intronic
1051726764 9:20095787-20095809 ACATTTCCATGTGGCTGGGGAGG + Intergenic
1053383169 9:37665829-37665851 GCCCTCACATGTGGCTGCTGGGG - Intronic
1053410685 9:37914470-37914492 GCACGTGCATGTGTATGCTGGGG + Intronic
1053565670 9:39248221-39248243 ACATTTCCATGTGGCTGAGGAGG + Intronic
1053790393 9:41682496-41682518 GCATGTGCCTGAGGCTGATGTGG - Intergenic
1053831435 9:42086075-42086097 ACATTTCCATGTGGCTGAGGAGG + Intronic
1054131478 9:61370815-61370837 ACATTTCCATGTGGCTGAGGAGG - Intergenic
1054154754 9:61632250-61632272 GCATGTGCCTGAGGCTGATGTGG + Intergenic
1054178738 9:61894195-61894217 GCATGTGCCTGAGGCTGATGTGG - Intergenic
1054599112 9:67101363-67101385 ACATTTCCATGTGGCTGAGGAGG - Intergenic
1054658796 9:67686634-67686656 GCATGTGCCTGAGGCTGATGTGG + Intergenic
1054866215 9:70004879-70004901 GCAGTTGCATGTGGCACCTAAGG + Intergenic
1057386744 9:94611626-94611648 GCATGTGCCTGTGGCTACTAAGG + Intronic
1057569260 9:96191525-96191547 GCATTTGCATTTTGTTCCTGGGG - Intergenic
1057598280 9:96435319-96435341 GCCTTTCCATGTGGCTGCTTGGG + Intergenic
1058485895 9:105443246-105443268 ACAGTTCCATGTGGCTGCAGAGG + Intergenic
1062011413 9:134268951-134268973 GCAAGTGAATGTGACTGCTGTGG - Intergenic
1186095359 X:6095684-6095706 GCATTGCCAAGTGGCTCCTGAGG - Intronic
1186170377 X:6870533-6870555 ACAGTTCCATGTGGCTGGTGAGG - Intergenic
1186853117 X:13600054-13600076 GCATGAGCATGTGGCCACTGAGG - Exonic
1191049398 X:56175138-56175160 GCTTTTGAATGTGTTTGCTGTGG + Intergenic
1192192210 X:68998050-68998072 TCATCTGCATGAGGCCGCTGAGG + Intergenic
1192432993 X:71125257-71125279 GCTTTAGCATGTGGATGCTGAGG + Intronic
1192676689 X:73203854-73203876 GCAGTTCCATGTGGCTGGGGAGG + Intergenic
1193905545 X:87239205-87239227 ACATTTCCATGTGGCTGGGGAGG + Intergenic
1194389749 X:93301073-93301095 ACAGTTGCATGTGGCTGGAGAGG - Intergenic
1195067015 X:101246819-101246841 GCATTTGCAAGTCACTGCTCTGG + Intronic
1196983526 X:121242098-121242120 ACAGTTGCATGTGGCTGGAGAGG - Intergenic
1197547187 X:127839311-127839333 ACAGTTCCATGTGGCTGGTGAGG + Intergenic
1197639622 X:128953815-128953837 ACATTTCCATGTGGCTGGGGAGG + Intergenic
1198316691 X:135474536-135474558 GTAATTGAATGTGGCTGCTAGGG + Intergenic
1198768964 X:140108053-140108075 CAATTTGCATGTTGCTGTTGTGG - Intergenic
1199139517 X:144293446-144293468 GCAGATGCATATTGCTGCTGGGG + Intergenic
1200055016 X:153455733-153455755 GCATGAGCAAGGGGCTGCTGCGG - Exonic
1200310003 X:155068539-155068561 GCCTTTGCATTTCTCTGCTGAGG - Intronic