ID: 1124639638

View in Genome Browser
Species Human (GRCh38)
Location 15:31389498-31389520
Sequence ATGTAAACACAGGGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 356}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124639638 Original CRISPR ATGTAAACACAGGGGGAGGA GGG (reversed) Intronic
900279835 1:1859629-1859651 ATGTAAAGAAAGGGGGAGCAGGG + Intronic
901246259 1:7733850-7733872 ATATGAAAACACGGGGAGGAAGG - Intronic
901494583 1:9613798-9613820 CTGGAAACACAGGGCGAGGTGGG - Exonic
902249223 1:15142422-15142444 ATGTTACCACTGGGGGAGGCTGG - Intergenic
902733867 1:18387233-18387255 ATGGGAACACAGGGGGATGGTGG + Intergenic
903986794 1:27234664-27234686 AGATAAACAGAGGAGGAGGAGGG + Exonic
904420098 1:30385685-30385707 TTATAAACACTGGGGGAGGTGGG - Intergenic
905313580 1:37066894-37066916 ATGTCAAAACAAAGGGAGGAAGG - Intergenic
905691990 1:39950202-39950224 AAGTAATCACTGTGGGAGGAGGG - Intergenic
905716502 1:40155877-40155899 CTGAAAAAACAGGGGGAGGGAGG - Intergenic
906464433 1:46063701-46063723 ATGTAAATAAAGGGAGGGGAAGG - Intronic
906542707 1:46600150-46600172 ATGTAAACAAAGTGGGAGTTTGG - Intronic
906776331 1:48533119-48533141 ATTAGAACACAGGGAGAGGAAGG - Exonic
908128965 1:61055523-61055545 ATGTAAACACAGGGAAAGCAAGG - Intronic
908490127 1:64635145-64635167 ATCTAAATAAAGGGGCAGGAAGG - Intronic
909704718 1:78568139-78568161 ATGTGAACACAGGGTGACGACGG + Intergenic
910691562 1:89970684-89970706 ATGTAAAGACAGAGAGAAGATGG + Intergenic
911355157 1:96808379-96808401 ATGAGGACACAGGGGGAAGATGG - Intronic
912042358 1:105408411-105408433 ATGAAAACAGAGGTAGAGGATGG + Intergenic
912209971 1:107546597-107546619 AGGTAAACACAGAAGGTGGATGG - Intergenic
912797998 1:112704588-112704610 ATGTCACCTCAGGGGCAGGAGGG + Intronic
914910750 1:151784142-151784164 ATTTAGGCACAGGTGGAGGAAGG - Intronic
916521818 1:165570176-165570198 AGGTTAACAAAAGGGGAGGAGGG + Intergenic
917152787 1:171962724-171962746 ATGTAATCATATTGGGAGGAGGG - Intronic
917337515 1:173940712-173940734 ATTTAAAAACAAGGGGAAGATGG + Intronic
917869786 1:179230646-179230668 AAGTAAACACAGTGGGAGAGGGG - Intergenic
918474192 1:184905550-184905572 ATGTATGCACAGGGGCAAGAAGG - Intronic
919836306 1:201576016-201576038 ATGTTAACACTGGGGGAAGCTGG - Intergenic
920100549 1:203514497-203514519 ATTTAGCCACAGGGGGAGAAAGG - Intergenic
920365098 1:205444125-205444147 ATGGAAAAGGAGGGGGAGGATGG - Intronic
920388885 1:205586547-205586569 AGGTAAACACAGGAGGACCAGGG - Intronic
920841891 1:209562144-209562166 CTGGAAACACAGGGGGTGCAGGG + Intergenic
921607740 1:217175237-217175259 ATGTAAACAAAGGCCTAGGAAGG - Intergenic
922318740 1:224465686-224465708 ATGTCAACATTGAGGGAGGAGGG - Intronic
922936349 1:229425987-229426009 ATTGAAACACACGGGGAAGAAGG + Intergenic
924676592 1:246184711-246184733 ATGCAAGCACACAGGGAGGAAGG - Intronic
1063481804 10:6382937-6382959 ATATAAACACAGGTGTGGGAGGG + Intergenic
1064086058 10:12347805-12347827 AAGGAAACACAGTGGGAGGAAGG + Intergenic
1064184177 10:13146473-13146495 ATGCACACAGAGAGGGAGGAAGG - Intergenic
1064267543 10:13837098-13837120 ATGGGAACACATGGTGAGGATGG + Intronic
1064448851 10:15423356-15423378 CTGTAAAAACAGTGGGAGGGAGG + Intergenic
1064515619 10:16144586-16144608 CTGTTAACATAGGGGGAGGGAGG - Intergenic
1067116865 10:43441881-43441903 ATGTAAAGACAGGGGAAGGCTGG - Intronic
1067528113 10:47050436-47050458 ATGCAAGGAAAGGGGGAGGAAGG + Intergenic
1070085921 10:73237007-73237029 ATGTAAAGACAGAGGCAGGCTGG - Intronic
1072270163 10:93768534-93768556 TTATAAACACATGGGGAGGGTGG + Intronic
1073024439 10:100476833-100476855 ATGTTCACACTGGGGGAGGTTGG - Intronic
1074828036 10:117228631-117228653 AGGGAAAGACAGAGGGAGGAAGG - Intergenic
1076210262 10:128635028-128635050 AAGTAAGGAAAGGGGGAGGAAGG + Intergenic
1076290062 10:129339301-129339323 ACCCAAACCCAGGGGGAGGAAGG + Intergenic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1077556840 11:3230122-3230144 AGGTAACCACAGGGGCAGCATGG - Intronic
1078968304 11:16373790-16373812 ATGAAAAGAAAGGGGGAGGGAGG + Intronic
1080649976 11:34214396-34214418 ATGTAATCAGAGGCAGAGGAGGG + Intronic
1081716839 11:45256464-45256486 ATGCAAAAACAGGTGGAGGTAGG - Intronic
1084122731 11:67078603-67078625 GTCTAGACACAGGGAGAGGATGG + Intergenic
1085031514 11:73273758-73273780 ATGGAAAAACAGGTGGTGGATGG - Intronic
1085750472 11:79156592-79156614 ATCTAGACAGAGGGTGAGGAAGG - Intronic
1087120602 11:94570365-94570387 ATGTGAACACAAGGAGAAGACGG - Intronic
1087542553 11:99538978-99539000 ATGTAAACCCAGGTGGAGTAGGG + Intronic
1088763459 11:112953786-112953808 ATGTAAATACTGAGGGATGAGGG - Intergenic
1089427157 11:118387799-118387821 AAGTAAACCTAGGAGGAGGAAGG + Intronic
1090477056 11:127032688-127032710 ATGTAAGCAGTGGGGGAGGGAGG - Intergenic
1090599811 11:128358562-128358584 ATGTAGATGCAGGGAGAGGATGG - Intergenic
1091099527 11:132858012-132858034 ATGTGAACACAGAGAGAGGGAGG + Intronic
1091915910 12:4271861-4271883 ATGTAAAGAAAGGGGAGGGAAGG - Intergenic
1092629267 12:10361072-10361094 TTGTAGAGACAGAGGGAGGAGGG + Intergenic
1092931479 12:13319912-13319934 ATGGAAAGAAAGGAGGAGGAAGG + Intergenic
1096316073 12:50567227-50567249 ATGTTAACACTGGGAGAGGCTGG - Intronic
1096828409 12:54296550-54296572 ATGAAGATACAGGGGCAGGAGGG - Intronic
1097253593 12:57655526-57655548 AATTAAAAATAGGGGGAGGAAGG - Intergenic
1097950810 12:65426342-65426364 ATATAAGTGCAGGGGGAGGACGG - Intronic
1098029789 12:66242138-66242160 ATTTCAGCACAGGGGGAGGGTGG - Intronic
1098922615 12:76316147-76316169 ATGAAAAGACAAGGGGAGGAAGG + Intergenic
1099136462 12:78909982-78910004 ATGTGAACAGAGGAGGAAGAAGG - Intronic
1100002827 12:89858038-89858060 GAATAAATACAGGGGGAGGATGG + Intergenic
1100787049 12:98089787-98089809 AAGAAAAGACAGAGGGAGGATGG + Intergenic
1101353141 12:103951793-103951815 ATATAAACACAGGGTTAGAAAGG - Intronic
1102290618 12:111696510-111696532 ATGTAAACAAATGGGCAAGATGG - Intronic
1102913717 12:116737725-116737747 AAGTAAAGTAAGGGGGAGGAAGG + Intronic
1103098393 12:118150797-118150819 AAGTTGACACGGGGGGAGGAAGG + Exonic
1103409057 12:120697846-120697868 ATGAAAGGACAGGGGAAGGAGGG - Exonic
1104300556 12:127560907-127560929 GTGTAAACACAGGGAGAGGCAGG + Intergenic
1104791760 12:131487201-131487223 ATCTGAATACAGGGGGAGGAGGG - Intergenic
1105295168 13:19082604-19082626 ATGTATACATGGGGGGAGGGGGG - Intergenic
1105701050 13:22935885-22935907 ATGAAAGCACACGGGGAGGGAGG - Intergenic
1106082367 13:26511055-26511077 GTGAAAACACAGGGAGAGGCTGG + Intergenic
1106302624 13:28483286-28483308 ATGTAAACAGATGGGGAGGCAGG - Intronic
1106321465 13:28643483-28643505 ATATTAACAGAGGGCGAGGAAGG - Intergenic
1106356888 13:28991770-28991792 CTTTAAACAAAGGGGAAGGAGGG - Intronic
1107170716 13:37339805-37339827 ATATAAACAGAGGAGAAGGATGG - Intergenic
1107281842 13:38745568-38745590 AGGTCAACAGAGGGGGAGAAAGG - Intronic
1107612022 13:42124754-42124776 ATAAAAACAAAGGCGGAGGAGGG + Intronic
1108328163 13:49355795-49355817 ATATAAAGGCAGGGGGAGGGAGG + Intronic
1109661810 13:65469420-65469442 AGGTAAAGACATGGGGTGGAGGG - Intergenic
1112248258 13:97754171-97754193 GTGGAAAGACTGGGGGAGGAAGG - Intergenic
1112369750 13:98784395-98784417 GTGAAGACACAGGGGGAGGATGG - Intergenic
1112465129 13:99637290-99637312 TTTTCAACACAGGGAGAGGAGGG - Intronic
1112521219 13:100097095-100097117 ATGTACAAACAGGGAAAGGAAGG + Intronic
1113077120 13:106477948-106477970 GTGAAGACACAGGGAGAGGACGG - Intergenic
1113166602 13:107450177-107450199 ATGAAAACACAGGGGAAGAGTGG + Intronic
1113360777 13:109629380-109629402 ACGTAATCACAGGGGGAGAAAGG + Intergenic
1113696841 13:112352929-112352951 ATGTAAACACCTGGGCATGACGG - Intergenic
1114244377 14:20899247-20899269 ATGTACACACAGGGAGATAATGG + Intergenic
1114690075 14:24573343-24573365 ATGTGGACACAGGGAGAGGATGG + Intergenic
1115118675 14:29913497-29913519 AAGTAAACATAGAGTGAGGATGG - Intronic
1116607414 14:47018913-47018935 ATGTGAACACAGAGGACGGACGG - Intronic
1116764498 14:49053597-49053619 ATGTATACACAGTGGGAATATGG - Intergenic
1117187453 14:53254978-53255000 ATGAGAAAATAGGGGGAGGAAGG + Intergenic
1118448346 14:65872757-65872779 ATGTAATCACAAGGGGAAGAAGG - Intergenic
1118671594 14:68133892-68133914 ATGTCAACACTGGGGAAGGCTGG - Intronic
1119600378 14:75971972-75971994 ATGTCAAGGCAGTGGGAGGAGGG - Intronic
1120599270 14:86480838-86480860 ATGTAAACAAAAAGGGAAGATGG - Intergenic
1120653861 14:87166377-87166399 ATGAAATGACTGGGGGAGGATGG - Intergenic
1120873756 14:89360413-89360435 AGGTAAAAAGAGAGGGAGGAAGG + Intronic
1121995804 14:98602083-98602105 ATGGAAATGCTGGGGGAGGAGGG - Intergenic
1122667351 14:103340560-103340582 AGGTAAACATTGGGGGAGGAGGG + Exonic
1122725640 14:103749535-103749557 ACAGAAACACATGGGGAGGAAGG + Intronic
1123049646 14:105534785-105534807 AGGTCAAGACAGGGGGAGGTGGG + Intergenic
1124639638 15:31389498-31389520 ATGTAAACACAGGGGGAGGAGGG - Intronic
1124651247 15:31475953-31475975 AAGCAAACACAGGGTGAGGATGG + Exonic
1126410454 15:48368124-48368146 ATGTAGAGAAAGGGGGAGAAAGG - Intergenic
1128076557 15:64830047-64830069 ATGTAATCACAGGGGAAAGAAGG + Intergenic
1128598308 15:68973811-68973833 ATGTCAACATTGGGGGAGGTTGG - Intronic
1129355113 15:74985607-74985629 ATGTGAGCTCAGGGGCAGGAAGG - Intronic
1129988413 15:79939643-79939665 AAGAAAAGACAGAGGGAGGAAGG + Intergenic
1130235944 15:82133565-82133587 ATGTTAACATTGGGGAAGGAGGG + Intronic
1131235013 15:90688706-90688728 ATGTAGACAAAGGGAGAAGATGG + Intergenic
1131935118 15:97495459-97495481 GTGTAAAATCAGGGAGAGGAAGG - Intergenic
1132249624 15:100325446-100325468 GTGAAGACACAGGGAGAGGACGG + Intronic
1132519256 16:379864-379886 AGGTGACCACAGGGTGAGGAGGG + Intronic
1133418666 16:5626314-5626336 ATGAAGACACAGGGAGAAGACGG - Intergenic
1133437921 16:5795788-5795810 ATGTAAACAGAAGGGGAGAATGG - Intergenic
1133698284 16:8285873-8285895 AGGTAAAAAGAGAGGGAGGATGG - Intergenic
1133778132 16:8914032-8914054 ATTTAAAATAAGGGGGAGGATGG - Intronic
1133922090 16:10162547-10162569 GTGAAGACACAGGGAGAGGATGG - Intronic
1135760291 16:25132542-25132564 ATCTAAACACTTGGGGAGGGAGG - Intronic
1136013346 16:27379143-27379165 CTGCACACACAGGCGGAGGATGG - Intergenic
1138501811 16:57450585-57450607 ATATAAACACTGGGGGAGTAGGG + Intronic
1138913905 16:61439401-61439423 ATGTAAAAAGAGATGGAGGATGG + Intergenic
1140015435 16:71177753-71177775 AAGTAATCAGATGGGGAGGAAGG - Intronic
1140872889 16:79123016-79123038 ATGTGAACGCAAGGTGAGGATGG + Intronic
1141909159 16:87046781-87046803 ATGAGAACACAGGGAGAAGATGG - Intergenic
1142288953 16:89183987-89184009 ATGTGAGTACAGGGTGAGGATGG - Intronic
1142352014 16:89584872-89584894 ATGGGAACACAGGGAGGGGAAGG + Intronic
1142593746 17:1019620-1019642 ATTTAAACACAGAGGAGGGAGGG + Intronic
1143019953 17:3912202-3912224 ATGAAGACACAGGAGGAGTAAGG - Intronic
1143893923 17:10122233-10122255 ATGAAAACACAGGGGCTGGCTGG - Intronic
1143974192 17:10818102-10818124 ATGGACACACAGGGAGAAGACGG + Intergenic
1144059521 17:11570171-11570193 TGGTGAACACAGGAGGAGGAAGG + Intergenic
1144260143 17:13510672-13510694 ATATTCACACAGGGTGAGGATGG - Intronic
1145908459 17:28529014-28529036 ATGTATATAAATGGGGAGGAGGG + Intronic
1145991378 17:29081108-29081130 ATAAAGACACAGGGGGAGGGAGG + Intronic
1147962977 17:44178932-44178954 ACTTAAACACAGGAGGAGAAGGG - Exonic
1149462076 17:56836988-56837010 AAGGAAAAACTGGGGGAGGAGGG - Intronic
1150737940 17:67756096-67756118 ATGAAATCACAGGGGGTTGAAGG - Intergenic
1152985386 18:316112-316134 AAGAAAACCCAGGGGGAGTATGG + Intergenic
1153186121 18:2488419-2488441 AGAACAACACAGGGGGAGGAAGG - Intergenic
1153296382 18:3550640-3550662 ATGAAGACACAGGGAGAAGATGG + Intronic
1153512804 18:5873834-5873856 ATGAAGACACAGGGAGAAGATGG + Intergenic
1154328561 18:13410398-13410420 ATGTAAACACTGGAGAAGGTGGG + Intronic
1156617415 18:38803835-38803857 ATGAAAAGATAGGGAGAGGATGG - Intergenic
1156730140 18:40183904-40183926 ATTTAAACACATGTGGAGCATGG - Intergenic
1157460815 18:47891421-47891443 ATGAAAAAACAGGGGTGGGAGGG + Intronic
1157893224 18:51438677-51438699 GAGTAAACACTGGGTGAGGAGGG + Intergenic
1159018607 18:63123942-63123964 ATGGGAACACTGGTGGAGGATGG - Exonic
1159597935 18:70401324-70401346 ATGTTAACACTGGGAGAGGCTGG - Intergenic
1161504683 19:4637497-4637519 ATGGAACCCCAGAGGGAGGAAGG - Intergenic
1162315905 19:9937699-9937721 ATGTAGGCAGAGGTGGAGGAGGG + Intergenic
1162473166 19:10884552-10884574 AGGCAAGCACAGGGGGAGGGGGG - Intronic
1162897801 19:13775868-13775890 AAGTGATCACAGGGGGAGGAGGG - Intronic
1163053316 19:14701052-14701074 GTGTAAACCAAGGGCGAGGAGGG - Intronic
1165274309 19:34734487-34734509 ATGTAAACGCGGGGTGATGACGG + Intronic
1166715193 19:44962505-44962527 ATGAAGACACAGGGAGAAGACGG - Intronic
926931849 2:18048854-18048876 ATGAAGACACAGGGGAAGGCTGG - Intronic
927010279 2:18896990-18897012 ATGCAAACAGAGGGGCAGCATGG - Intergenic
927372161 2:22368803-22368825 ATGTAAACAAAGAGAGAGAATGG + Intergenic
930817721 2:55616797-55616819 AAGTAAATAAAGGGGGAGGAAGG + Intronic
932697436 2:73968535-73968557 ATGTAAACACAAGCAGAGGAGGG - Intergenic
933229606 2:79791228-79791250 ATGTTAACAGAGTGGGAGGTTGG + Intronic
934051274 2:88213198-88213220 ATGTTAACATTGGGGGAGGCTGG - Intergenic
934632647 2:95945885-95945907 TTTTAAACAAAGGGGAAGGAGGG + Intronic
934684021 2:96307164-96307186 ATTTAATCACAATGGGAGGAAGG - Intergenic
934800859 2:97157377-97157399 TTTTAAACAAAGGGGAAGGAGGG - Intronic
935040077 2:99417584-99417606 GTGAAGACACAGGGAGAGGAGGG + Intronic
935201603 2:100861471-100861493 AAAGAAACACAAGGGGAGGAGGG + Intronic
936816055 2:116462268-116462290 TTGGAAAGGCAGGGGGAGGAGGG + Intergenic
937219013 2:120330809-120330831 GTGAAGACACAGGGAGAGGACGG + Intergenic
937666138 2:124489342-124489364 ATGTGAAGACAGGGAGAAGAGGG - Intronic
937715979 2:125033092-125033114 ATGTAAAAACAAAGTGAGGAAGG - Intergenic
937727163 2:125180878-125180900 ATGCACACACAGAGAGAGGAAGG - Intergenic
939173960 2:138728229-138728251 ATGAAGACACAGGGAGAAGATGG + Intronic
939219167 2:139280216-139280238 CTGTGAAGACAGGGAGAGGATGG + Intergenic
939972951 2:148682671-148682693 ATGAAAATACAGTGAGAGGAGGG - Intronic
942068925 2:172297839-172297861 AGGTAAGCAGAGGGGGAGGAGGG - Intergenic
942199736 2:173559138-173559160 AATTTACCACAGGGGGAGGATGG - Intergenic
946307006 2:218861724-218861746 ATTTAGACAGAGGGGGAGGGAGG - Intronic
946458191 2:219846578-219846600 GTGAAAACACAGGGAGATGATGG + Intergenic
946695577 2:222355149-222355171 GTGAAGACAGAGGGGGAGGACGG - Intergenic
946980844 2:225213417-225213439 ATGTAAAGACAGGGGGATGATGG - Intergenic
948880029 2:240851937-240851959 GTGGAAACACAGGGAGAAGACGG - Intergenic
1169099334 20:2932440-2932462 TTGTAAACAAAGGGGTATGAGGG + Intronic
1169245241 20:4019719-4019741 ATCTCAACAGATGGGGAGGATGG - Intergenic
1173759275 20:45545587-45545609 AGGTGAGGACAGGGGGAGGAGGG + Intronic
1174151878 20:48491772-48491794 AGGCAAACAGAGGGAGAGGAAGG - Intergenic
1174168209 20:48599724-48599746 ATTCCAACACTGGGGGAGGAGGG + Intergenic
1175141644 20:56865060-56865082 ATGGAAAAGCAGGGGGAGGCTGG + Intergenic
1175238433 20:57528520-57528542 ATATAAAGCCAGTGGGAGGAGGG + Intergenic
1176911122 21:14566479-14566501 AGGTAAAGGCAGGGGGAGGTTGG + Intronic
1178039043 21:28619092-28619114 ATGAAGACACAGGGAGAAGACGG + Intergenic
1178472234 21:32903980-32904002 ACATAAACACTGGGGGATGAAGG - Intergenic
1178792334 21:35712022-35712044 GTGAAAACACAGGGAGAGGATGG - Intronic
1179367687 21:40773401-40773423 ATGAAGACACAGGGAGAAGAAGG - Intronic
1180657232 22:17432837-17432859 CTGTAATCACAGGGTGAGGTGGG - Intronic
1181134954 22:20758744-20758766 ATGTAGACACAGGGCGGGGTGGG - Intronic
1181360008 22:22327206-22327228 ATGAAAACACAGGCATAGGAAGG - Intergenic
1181370029 22:22408654-22408676 ATGAAAACACAGGCATAGGAAGG - Intergenic
1183227031 22:36557481-36557503 ATGCCACCACAGGGGGAGGAGGG - Intergenic
1184024886 22:41848246-41848268 AAAAAAATACAGGGGGAGGAGGG - Intronic
1185226043 22:49653361-49653383 ATGCAGACACTGGGGAAGGAGGG + Intronic
950030260 3:9847328-9847350 ATGTGACCACAGTGGGAAGATGG + Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950674321 3:14545411-14545433 ATGTGAACACAGAGTCAGGAGGG + Intergenic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
951630558 3:24715589-24715611 ATGTTAACACTGGGGGAGGCTGG - Intergenic
951803755 3:26624055-26624077 ATGTAAATACAGATGGGGGAGGG + Intronic
952893865 3:38063811-38063833 ATGAAAAAAGAGGGGGAGAAAGG - Intronic
952954662 3:38549575-38549597 GTGAAAACACAGGGGGAAAATGG + Exonic
953983773 3:47426261-47426283 CTTTCAACACAGGGGCAGGAGGG - Intronic
954390553 3:50266053-50266075 GAGTGAACACAGGTGGAGGAAGG + Intergenic
954743739 3:52774886-52774908 ATGTTTGCACAGGGGGAGGGTGG - Intergenic
954788778 3:53115073-53115095 GAGTAAGGACAGGGGGAGGATGG - Intronic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
955534719 3:59910645-59910667 AAGAAAAAATAGGGGGAGGAAGG + Intronic
955751154 3:62186460-62186482 ATGGGCACACAGGGTGAGGAGGG + Intronic
956791064 3:72680479-72680501 ATGTACTCACAGTGGGAGGATGG - Intergenic
956975148 3:74570206-74570228 ATGTATATGGAGGGGGAGGAGGG + Intergenic
957034631 3:75282321-75282343 ATGTAAACAGAAGGGTGGGAGGG + Intergenic
958822800 3:98995044-98995066 ATGTAAATACAGGGAGAAAAAGG + Intergenic
960999818 3:123366661-123366683 ATTTAAAACCATGGGGAGGAGGG + Intronic
961078499 3:124003906-124003928 ATGTAAACAGAAGGGTGGGAGGG + Intergenic
961190068 3:124952658-124952680 ATGTGTTCACAGGGGGAGTAGGG + Intronic
961304976 3:125952541-125952563 ATGTAAACAGAAGGGTGGGAGGG - Intergenic
961971993 3:130977791-130977813 CGGTAATCTCAGGGGGAGGATGG - Intronic
961975050 3:131015284-131015306 ATGTAAACTCTGTGGGGGGAGGG - Intronic
963097107 3:141555322-141555344 ATGTTAACACTGGGAGAGGCTGG + Intronic
963939321 3:151084768-151084790 ATTTAAGCAAAGGGGGAAGAAGG - Intergenic
964704247 3:159601518-159601540 AGGTATGCAGAGGGGGAGGAGGG + Intronic
965095272 3:164217544-164217566 ACTTACACACAGTGGGAGGATGG + Intergenic
965678965 3:171230843-171230865 ATGGAGCCACAGGGGAAGGAAGG - Intronic
967157379 3:186705835-186705857 ATGTACTCACAGGTGTAGGAAGG - Intergenic
967693207 3:192501152-192501174 ATGTAAACACATGGACTGGAGGG + Intronic
969854610 4:9989175-9989197 ATGTAATGAAAGGGGGTGGATGG - Intronic
969903241 4:10369442-10369464 ATGTGAAGATAGGAGGAGGAGGG + Intergenic
970131390 4:12875593-12875615 ATGAAGACACAGGGGGAAGGTGG + Intergenic
970690598 4:18615730-18615752 ATGTACACAGAGGGAGAGAAAGG + Intergenic
971031569 4:22642911-22642933 ATGTTAATACTGGGGGAGAAAGG + Intergenic
971163633 4:24159711-24159733 ATGTAAACTCACAGAGAGGAAGG - Intergenic
971797337 4:31244604-31244626 ATGTAGACAAAGGGGGAGGTGGG + Intergenic
972351936 4:38244187-38244209 ATGGAAACACAGCAGGATGAAGG - Intergenic
973173037 4:47168904-47168926 GTGGAGACACAGGGGGAAGATGG - Intronic
975318770 4:72985346-72985368 AAAGAAACACAGGTGGAGGATGG - Intergenic
975766947 4:77678441-77678463 ATGAAAATATTGGGGGAGGAGGG + Intergenic
977888664 4:102281330-102281352 ATGAGAAAACAGGGGTAGGATGG + Intronic
980130734 4:128813185-128813207 ATTTAATCACAGGTGGAGAAAGG + Intronic
981330546 4:143503548-143503570 TTGTAAAGACAAGGGAAGGATGG - Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984856995 4:184204061-184204083 ATATAGACACAGGGGGAAGGCGG - Intronic
985024153 4:185722907-185722929 ATGTCATCACAGTGGGAAGAAGG + Intronic
986076551 5:4343885-4343907 ATGAACACACAGAGGGAAGAAGG + Intergenic
987501435 5:18715037-18715059 ATGAAAACATAGGGGTAGGTGGG + Intergenic
988422815 5:31026889-31026911 ATGAAGACACAGGGAGAAGATGG + Intergenic
988653807 5:33184514-33184536 ATGTAAACACTGGGCTAGGTGGG + Intergenic
989120801 5:38002695-38002717 ATGTAAACCCAGAGGGTGGCAGG + Intergenic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
990549424 5:56858898-56858920 GTGAAAGCACAGGAGGAGGAAGG + Intronic
990763967 5:59161758-59161780 AAGTAAATACAGGGGGAAAACGG - Intronic
994012840 5:94926905-94926927 ATGTAATCTCAGTGAGAGGATGG - Intronic
994780523 5:104083837-104083859 ATGTAAAAAAAGGGGGACAAAGG + Intergenic
995469968 5:112490955-112490977 ATAGAGACACAGAGGGAGGAAGG + Intergenic
995610782 5:113908465-113908487 ATGTGAAGACAGGGAGAAGATGG + Intergenic
997615278 5:135241986-135242008 GTGGAAGCACAGGGAGAGGAAGG - Intronic
998268069 5:140681366-140681388 ATGTAAAGACAAAGGGAGGCTGG + Intronic
1000217408 5:159174700-159174722 ATAAAAACACAGTAGGAGGAAGG - Intronic
1000272283 5:159697449-159697471 AGGTGAAAACAGGGGCAGGAGGG - Intergenic
1000763749 5:165258754-165258776 ATGTAAACCAAGGAGGAGAATGG + Intergenic
1001053740 5:168432743-168432765 ATGTAAACAAACTGTGAGGAGGG + Intronic
1003265615 6:4562773-4562795 GTGAAAACACAGGGAGAAGATGG + Intergenic
1004023407 6:11795623-11795645 AGGTAAACACAGGAAGAGAAAGG - Intronic
1007577377 6:42934461-42934483 ATTTACACACTGGGGGAGGGAGG - Exonic
1007850534 6:44798637-44798659 ATGTGAACCTAGGTGGAGGAGGG + Intergenic
1008050862 6:46899190-46899212 AGATAAACAAAGGGGGATGATGG + Intronic
1008452195 6:51665923-51665945 GTGTAAGCACAGGTGGAGGTGGG + Intronic
1010843465 6:80676613-80676635 ATGAAAAAACAGGGGGAAAAGGG + Intergenic
1011898555 6:92262701-92262723 ATGGATTCACACGGGGAGGATGG + Intergenic
1013168450 6:107615225-107615247 ACATAAACACAGAGGAAGGAAGG + Intronic
1014964359 6:127728682-127728704 ATGTAAACACAAGGAGGGCAGGG - Intronic
1016314381 6:142770461-142770483 AGGTAAACACAAGGGGATGGAGG + Exonic
1016379174 6:143456176-143456198 ATTTAGACACAGAGGGAGGAAGG + Intronic
1016389547 6:143561237-143561259 CTGTCATCACAGGGTGAGGAGGG - Intronic
1016852634 6:148636561-148636583 GTGAAGACACAGGGGGAAGATGG + Intergenic
1018638291 6:165884046-165884068 ATGTCAAAGCAGGTGGAGGAAGG + Intronic
1019862189 7:3669588-3669610 GTTTAAAGACAGGTGGAGGAAGG - Intronic
1019903654 7:4043975-4043997 AAGAAAACACAAGAGGAGGAAGG - Intronic
1019985511 7:4652546-4652568 ATGAAAAGACAGGGAGAAGATGG - Intergenic
1020116703 7:5480203-5480225 ACGGAAACCCAGGAGGAGGAAGG + Intronic
1022296469 7:29059814-29059836 ATGGAAACAAATGGTGAGGAAGG - Intronic
1024212278 7:47216268-47216290 ATGAGAACACAGGGAGAAGATGG - Intergenic
1025908292 7:65806901-65806923 ATGGGAACACAGGGGGATGAGGG - Intergenic
1028540840 7:91940849-91940871 ACGTAAACACACGGCGAGGCGGG - Exonic
1029690519 7:102178286-102178308 AGCTAACCACAGGGGGAGGAAGG + Intronic
1031079965 7:117248870-117248892 ATGTAAACACAGTGTGTGGAAGG - Intergenic
1031835251 7:126673552-126673574 CTATAAAGACAGTGGGAGGATGG - Intronic
1031912645 7:127533956-127533978 GTGTAAACCGAGGGGGAGCAGGG + Intergenic
1032062632 7:128737720-128737742 TTGTAGAGATAGGGGGAGGAAGG + Intergenic
1032123877 7:129176831-129176853 ATGTTAACACTGGGTGAGGTTGG - Intergenic
1032187338 7:129738203-129738225 TTTTAAATAGAGGGGGAGGAGGG + Intronic
1032509038 7:132457131-132457153 ATGTTAACACAAGGGGAAGCTGG - Intronic
1032727264 7:134602295-134602317 ATCTAAAGACAGGGTGAGCAAGG - Intergenic
1033476422 7:141697445-141697467 GTGGAAATACAGGGGAAGGATGG + Intronic
1034534745 7:151719790-151719812 TGGCAAACTCAGGGGGAGGAGGG - Intronic
1034634207 7:152554337-152554359 ATGTAAGCTCAGGGGAAGAAAGG - Intergenic
1034675838 7:152891912-152891934 ATGAAGACACAGGGAGAAGACGG + Intergenic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035526244 8:315507-315529 GTGAAGACACAGGGAGAGGATGG - Intergenic
1035749610 8:1987167-1987189 GTGTAAAAACAGAGAGAGGAAGG - Intronic
1035921212 8:3678033-3678055 ATTTAAAGACAGTGGGAGGGTGG + Intronic
1037691722 8:21186440-21186462 ATGTAAGCAGAGGGAGATGAGGG - Intergenic
1037701129 8:21274697-21274719 CTGTTAACACAGGGAGTGGAGGG - Intergenic
1038146767 8:24904558-24904580 GTGAAGACACAGGGAGAGGACGG + Intergenic
1039397704 8:37241150-37241172 ATGCCAACACAGAGGGATGATGG + Intergenic
1040575927 8:48651485-48651507 ATGTAACAACAGTTGGAGGAAGG - Intergenic
1041420364 8:57661118-57661140 AGGAAGACAGAGGGGGAGGAGGG + Intergenic
1041453375 8:58031864-58031886 ATGAAAAGGAAGGGGGAGGAAGG - Intronic
1042473167 8:69214177-69214199 ATGAAGACACAGGGAGAAGATGG + Intergenic
1043959997 8:86406548-86406570 ATGTTAACACTGGAGGAGGCTGG - Intronic
1044953906 8:97459979-97460001 ATGTAAACACAGGAGGCTTAAGG + Intergenic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045429046 8:102096278-102096300 GTGAAGACACAGGGAGAGGAAGG - Intronic
1046230350 8:111347745-111347767 ATGTTAACATTGGGGGAGGCTGG - Intergenic
1047193544 8:122700495-122700517 CTGAAGACACAGGGAGAGGATGG + Intergenic
1048646035 8:136420796-136420818 CTGTAAACACCGAGGGAGAATGG + Intergenic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049079426 8:140430289-140430311 ATTTAAACTGAGGGGGAAGATGG + Intronic
1050301132 9:4260010-4260032 ATGGAAACACAGAGGGAGAAAGG + Intronic
1051909695 9:22139134-22139156 ATTTGAACACAGTGGGAAGATGG + Intergenic
1052562397 9:30102655-30102677 ATGTAAACAATGGGAGAAGAAGG - Intergenic
1052764444 9:32626456-32626478 ATGTGAAGAATGGGGGAGGAGGG - Intergenic
1055262138 9:74449476-74449498 ATGAAGACACAGGGAGAAGATGG - Intergenic
1056912400 9:90714275-90714297 AAATAAACACAGGGGGAAAATGG + Intergenic
1057151650 9:92801202-92801224 GTGAAGACACAGGGGGAAGATGG - Intergenic
1057625515 9:96672985-96673007 ATGTGAACACTGGGGAAGGATGG + Intergenic
1057822006 9:98339777-98339799 ATGAGAATACAGGGGGAGGGAGG - Intronic
1057907959 9:98996976-98996998 ATGTCTTCAAAGGGGGAGGATGG - Exonic
1058745242 9:107983966-107983988 CTGGAAACACAGTGGGAGGGAGG - Intergenic
1059910148 9:119034362-119034384 GTGAAGACACAGGGAGAGGATGG - Intergenic
1060082149 9:120659269-120659291 GTTTAAACAAAGGGGGATGAGGG - Intronic
1060115957 9:120940912-120940934 ATGCAGACACTGGGAGAGGACGG - Intergenic
1060445280 9:123681444-123681466 CTGTAAAAACAGGGTGAGGAGGG + Intronic
1060772348 9:126341751-126341773 TTGTCACCACTGGGGGAGGAGGG - Intronic
1061727718 9:132590482-132590504 ATGGAGACAGAGGAGGAGGAGGG - Intergenic
1185528796 X:800657-800679 GTGTAAACACTGAGGGATGATGG + Intergenic
1185773885 X:2786827-2786849 ATGAAGACACAGGGAGAAGACGG + Intronic
1186129250 X:6448581-6448603 ATGAAGACACAGGGAGAAGATGG - Intergenic
1187666687 X:21619873-21619895 AAGAAAACACACGGGGAGGAGGG + Intronic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188664994 X:32808158-32808180 AGCTAAAAACAGGGGTAGGAGGG + Intronic
1189332980 X:40154419-40154441 AGGAGAACAAAGGGGGAGGAGGG - Intronic
1191894625 X:65979028-65979050 CTGTAAACAAAAGGGCAGGATGG - Intergenic
1192002738 X:67172907-67172929 ATGTATACATGGGGGGAGGGGGG - Intergenic
1192588188 X:72337466-72337488 TTGTAAACAAAGGAGGAGTAAGG - Intronic
1192601298 X:72467310-72467332 ATGTCAACATTGGGGGAGGCTGG + Intronic
1193222398 X:78941839-78941861 ATATAAACAGAGTCGGAGGAGGG - Intergenic
1193403825 X:81078451-81078473 ATTTAAAAAAAGGGGGGGGAAGG + Intergenic
1193988161 X:88272876-88272898 ATGAAGACACAGGGAGAAGATGG - Intergenic
1196402823 X:115333896-115333918 ATCTCATCCCAGGGGGAGGAGGG - Intergenic
1196802385 X:119555376-119555398 ATGAAATCAGATGGGGAGGAAGG + Intronic
1196831297 X:119777548-119777570 ATGTAAGGAGAGGGAGAGGAAGG + Intergenic
1197203248 X:123767418-123767440 ATGTAAAAATAGGTAGAGGAAGG - Intergenic
1198229371 X:134674805-134674827 CTGTAAAGACAGGAAGAGGAAGG - Intronic
1199321172 X:146440990-146441012 AAGAGAAAACAGGGGGAGGAAGG + Intergenic
1199423997 X:147680252-147680274 ATGTAATCACTGTGGGAGGCAGG + Intergenic
1199511897 X:148631678-148631700 ATTGAAAGGCAGGGGGAGGAGGG + Intronic
1199513306 X:148647670-148647692 ATGGAAACACAGGAGGCAGAAGG + Intronic
1199526260 X:148795208-148795230 ATGAAAACAAAGGGGAATGAGGG - Intronic
1199995370 X:153021418-153021440 ATGTAAACAGCGGGGAAGAAAGG - Intergenic
1200358289 X:155575169-155575191 ATGTGAAGACAGGGAGAAGATGG - Intronic
1200419717 Y:2951800-2951822 ATATAAACAAAGAGGTAGGAGGG + Intronic
1200806120 Y:7435375-7435397 GTGTAAACCCAGGGGGACGGGGG + Intergenic
1201295812 Y:12462325-12462347 ATGAAGACACAGGGAGAAGACGG - Intergenic
1201299893 Y:12496444-12496466 CTGTAAAGACAGGGAGAAGACGG - Intergenic
1201442246 Y:14020992-14021014 CTGTAAAAAAAGGGAGAGGAAGG - Intergenic
1201920260 Y:19226345-19226367 ATGAAAACACAGTGGGAGCCTGG - Intergenic
1202316484 Y:23584353-23584375 ATGCACACACAGGAGGAGCAAGG + Intergenic
1202554280 Y:26085705-26085727 ATGCACACACAGGAGGAGCAAGG - Intergenic