ID: 1124640036

View in Genome Browser
Species Human (GRCh38)
Location 15:31391613-31391635
Sequence CCTCCCGGAAGCGTCGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 107}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124640036_1124640047 0 Left 1124640036 15:31391613-31391635 CCGCCCCCGACGCTTCCGGGAGG 0: 1
1: 1
2: 0
3: 7
4: 107
Right 1124640047 15:31391636-31391658 TCTAGGCGGCTGCCGTGGGCCGG 0: 1
1: 1
2: 1
3: 10
4: 152
1124640036_1124640048 10 Left 1124640036 15:31391613-31391635 CCGCCCCCGACGCTTCCGGGAGG 0: 1
1: 1
2: 0
3: 7
4: 107
Right 1124640048 15:31391646-31391668 TGCCGTGGGCCGGTCCGAAACGG 0: 1
1: 1
2: 0
3: 0
4: 16
1124640036_1124640050 17 Left 1124640036 15:31391613-31391635 CCGCCCCCGACGCTTCCGGGAGG 0: 1
1: 1
2: 0
3: 7
4: 107
Right 1124640050 15:31391653-31391675 GGCCGGTCCGAAACGGCTCTAGG 0: 1
1: 1
2: 0
3: 0
4: 22
1124640036_1124640053 28 Left 1124640036 15:31391613-31391635 CCGCCCCCGACGCTTCCGGGAGG 0: 1
1: 1
2: 0
3: 7
4: 107
Right 1124640053 15:31391664-31391686 AACGGCTCTAGGTGCACTGTTGG 0: 1
1: 0
2: 0
3: 11
4: 44
1124640036_1124640054 29 Left 1124640036 15:31391613-31391635 CCGCCCCCGACGCTTCCGGGAGG 0: 1
1: 1
2: 0
3: 7
4: 107
Right 1124640054 15:31391665-31391687 ACGGCTCTAGGTGCACTGTTGGG 0: 1
1: 1
2: 1
3: 0
4: 47
1124640036_1124640045 -5 Left 1124640036 15:31391613-31391635 CCGCCCCCGACGCTTCCGGGAGG 0: 1
1: 1
2: 0
3: 7
4: 107
Right 1124640045 15:31391631-31391653 GGAGGTCTAGGCGGCTGCCGTGG 0: 1
1: 0
2: 0
3: 11
4: 306
1124640036_1124640046 -4 Left 1124640036 15:31391613-31391635 CCGCCCCCGACGCTTCCGGGAGG 0: 1
1: 1
2: 0
3: 7
4: 107
Right 1124640046 15:31391632-31391654 GAGGTCTAGGCGGCTGCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 69
1124640036_1124640055 30 Left 1124640036 15:31391613-31391635 CCGCCCCCGACGCTTCCGGGAGG 0: 1
1: 1
2: 0
3: 7
4: 107
Right 1124640055 15:31391666-31391688 CGGCTCTAGGTGCACTGTTGGGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124640036 Original CRISPR CCTCCCGGAAGCGTCGGGGG CGG (reversed) Intronic