ID: 1124640374

View in Genome Browser
Species Human (GRCh38)
Location 15:31392835-31392857
Sequence CCTCCCGGAAGCGTCGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 47}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124640374_1124640387 29 Left 1124640374 15:31392835-31392857 CCGCCCGCGACGCTTCCGGGAGG 0: 1
1: 1
2: 0
3: 4
4: 47
Right 1124640387 15:31392887-31392909 ACGGCTCTAGGTGCACTGTCCGG 0: 1
1: 1
2: 0
3: 3
4: 67
1124640374_1124640381 0 Left 1124640374 15:31392835-31392857 CCGCCCGCGACGCTTCCGGGAGG 0: 1
1: 1
2: 0
3: 4
4: 47
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81
1124640374_1124640384 17 Left 1124640374 15:31392835-31392857 CCGCCCGCGACGCTTCCGGGAGG 0: 1
1: 1
2: 0
3: 4
4: 47
Right 1124640384 15:31392875-31392897 AGCCGGTCCGAAACGGCTCTAGG 0: 1
1: 1
2: 0
3: 1
4: 22
1124640374_1124640382 10 Left 1124640374 15:31392835-31392857 CCGCCCGCGACGCTTCCGGGAGG 0: 1
1: 1
2: 0
3: 4
4: 47
Right 1124640382 15:31392868-31392890 TGCCGTGAGCCGGTCCGAAACGG 0: 1
1: 1
2: 0
3: 1
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124640374 Original CRISPR CCTCCCGGAAGCGTCGCGGG CGG (reversed) Intronic
904190313 1:28737745-28737767 TCTCCGGGAAGCGCCCCGGGCGG + Intronic
904237237 1:29123514-29123536 CCTCGCGGCAGCGACGCGCGGGG - Intronic
907541028 1:55215408-55215430 GCTCCCGGAAGCGGCACGGGAGG + Intergenic
908474184 1:64471549-64471571 CCTCCCGGGAGCATGGGGGGAGG + Intronic
923490413 1:234478914-234478936 GCTCCCGGAGGCGGCGCGCGAGG - Exonic
923882921 1:238123334-238123356 CCTCCCAGGAGCTTCGCTGGAGG + Intergenic
1072713948 10:97737134-97737156 CGTCCCGGAAGCGGCGGTGGCGG + Exonic
1072730345 10:97841770-97841792 CCTCCCGGAAGGGGTGTGGGCGG - Intergenic
1076637604 10:131892390-131892412 CCTCCCGGGATCGTCGTGCGTGG - Intergenic
1077549232 11:3192693-3192715 CCTCCCTGAAGCCTCGGGGTGGG + Intergenic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1084111143 11:67014854-67014876 CCTCCAGGGAGCGTCGAGAGTGG - Intronic
1084734794 11:71097673-71097695 GCTCCCGGAAGCGCAGCAGGAGG + Intronic
1094132133 12:27085578-27085600 CCTCCAGGAATCTTCCCGGGAGG - Intergenic
1102468253 12:113143000-113143022 CCACCCCGAAGCATGGCGGGAGG + Intergenic
1103209156 12:119154225-119154247 GCTCCCTGAAGGGGCGCGGGGGG - Exonic
1104019263 12:124980760-124980782 CCCACCGGAAGCGTCGCCGCTGG - Exonic
1106269431 13:28138952-28138974 CCGCCGGGAGCCGTCGCGGGCGG + Exonic
1108648051 13:52450208-52450230 GCTCCCGGAAGCATTCCGGGCGG + Intronic
1112344313 13:98577197-98577219 CCTCCCGGAAGCGCGGGGCGGGG - Intronic
1112506740 13:99980479-99980501 GCTCCCGGGAGCGCCGCGGTCGG + Intergenic
1124640036 15:31391613-31391635 CCTCCCGGAAGCGTCGGGGGCGG - Intronic
1124640374 15:31392835-31392857 CCTCCCGGAAGCGTCGCGGGCGG - Intronic
1126023879 15:44427540-44427562 CCTCGCGGAATTGTGGCGGGAGG + Exonic
1129691076 15:77713945-77713967 CCACCAGGAAGCGACGTGGGTGG - Intronic
1138445691 16:57061708-57061730 CCTCCCGGAGGCAGCGGGGGAGG - Intronic
1150250275 17:63700771-63700793 CCTCCCCGCAGCCTCGCGGCCGG - Intronic
1151975264 17:77480728-77480750 CCTCCCGGAGGACTGGCGGGAGG + Intronic
1152177384 17:78796762-78796784 CCTCCCGGAGTCGTCGCAGGTGG - Exonic
1156367978 18:36447152-36447174 CCTCCAGGAAGAGTTGAGGGAGG + Intronic
1163008463 19:14410578-14410600 CCTCCCTGAAGCGTGGCTCGAGG - Intronic
1165791869 19:38497283-38497305 CAACCCGGAAGCGTAGCGTGCGG - Intronic
930703929 2:54485874-54485896 CCTCCCAGACGGGTCGCGGCCGG - Intronic
946432240 2:219632019-219632041 CCTCCCGGACGCAGGGCGGGAGG + Exonic
1169214878 20:3786930-3786952 CGACCCGGCAGCGACGCGGGCGG + Intronic
1172474522 20:35226873-35226895 CCTCCCGGGCGCCGCGCGGGCGG + Exonic
1173979287 20:47210778-47210800 CCTCCCGAAAGAGTCTCGGCTGG - Exonic
953464344 3:43105866-43105888 CCTCCTGGACGCGTCGGCGGAGG - Exonic
955971984 3:64445410-64445432 CCTCCCGGCCGCGGCGCGGACGG - Intronic
962714525 3:138115269-138115291 CGTCCCGGGAGCGGGGCGGGTGG - Intronic
965757374 3:172040156-172040178 CCTCCCGGAATCTCCGCGGCAGG + Intronic
966745329 3:183269535-183269557 CCTTCAGGAAGCGTGGTGGGCGG - Exonic
966860796 3:184230114-184230136 GCTGTCGGAAGCGGCGCGGGTGG - Intronic
969259156 4:6022727-6022749 CCTCCGGGAGGCGGCGCAGGAGG - Intergenic
984705521 4:182844773-182844795 CCTCCCTGAAGCCTCTCAGGTGG - Intergenic
985749843 5:1667636-1667658 CCTCCGGGCAGCCTCGTGGGCGG + Intergenic
990382518 5:55231485-55231507 CCACCCGGAGGCGGCGCTGGAGG - Exonic
998391557 5:141790103-141790125 CCTCCTGGAAGCTTCCAGGGTGG - Intergenic
1016272047 6:142301442-142301464 CAGCCCGGGAGCGTGGCGGGGGG + Intergenic
1017124247 6:151051006-151051028 CCTCCAGGAAGGGTGGAGGGCGG - Intronic
1022472557 7:30690770-30690792 CCTCCCGGAAGCCTAGGGTGAGG + Intronic
1024323090 7:48089036-48089058 CCTCCCGGGACCTTCGCGGGAGG + Intronic
1188188412 X:27144868-27144890 CCTCCTGGCAGCGTCTCGGGGGG - Intergenic