ID: 1124640374

View in Genome Browser
Species Human (GRCh38)
Location 15:31392835-31392857
Sequence CCTCCCGGAAGCGTCGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 47}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124640374_1124640384 17 Left 1124640374 15:31392835-31392857 CCGCCCGCGACGCTTCCGGGAGG 0: 1
1: 1
2: 0
3: 4
4: 47
Right 1124640384 15:31392875-31392897 AGCCGGTCCGAAACGGCTCTAGG 0: 1
1: 1
2: 0
3: 1
4: 22
1124640374_1124640382 10 Left 1124640374 15:31392835-31392857 CCGCCCGCGACGCTTCCGGGAGG 0: 1
1: 1
2: 0
3: 4
4: 47
Right 1124640382 15:31392868-31392890 TGCCGTGAGCCGGTCCGAAACGG 0: 1
1: 1
2: 0
3: 1
4: 29
1124640374_1124640387 29 Left 1124640374 15:31392835-31392857 CCGCCCGCGACGCTTCCGGGAGG 0: 1
1: 1
2: 0
3: 4
4: 47
Right 1124640387 15:31392887-31392909 ACGGCTCTAGGTGCACTGTCCGG 0: 1
1: 1
2: 0
3: 3
4: 67
1124640374_1124640381 0 Left 1124640374 15:31392835-31392857 CCGCCCGCGACGCTTCCGGGAGG 0: 1
1: 1
2: 0
3: 4
4: 47
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124640374 Original CRISPR CCTCCCGGAAGCGTCGCGGG CGG (reversed) Intronic