ID: 1124640381

View in Genome Browser
Species Human (GRCh38)
Location 15:31392858-31392880
Sequence TCTAGGCGGCTGCCGTGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 81}

Found 22 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124640373_1124640381 1 Left 1124640373 15:31392834-31392856 CCCGCCCGCGACGCTTCCGGGAG 0: 1
1: 1
2: 1
3: 5
4: 70
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81
1124640370_1124640381 3 Left 1124640370 15:31392832-31392854 CCCCCGCCCGCGACGCTTCCGGG 0: 1
1: 1
2: 0
3: 16
4: 127
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81
1124640377_1124640381 -4 Left 1124640377 15:31392839-31392861 CCGCGACGCTTCCGGGAGGTCTA 0: 2
1: 0
2: 0
3: 1
4: 11
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81
1124640355_1124640381 25 Left 1124640355 15:31392810-31392832 CCCCACCCCGCCCCCGCCCCCGC 0: 5
1: 40
2: 241
3: 1261
4: 7755
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81
1124640359_1124640381 19 Left 1124640359 15:31392816-31392838 CCCGCCCCCGCCCCCGCCCCCGC 0: 75
1: 157
2: 514
3: 2492
4: 10549
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81
1124640365_1124640381 9 Left 1124640365 15:31392826-31392848 CCCCCGCCCCCGCCCGCGACGCT 0: 1
1: 2
2: 8
3: 96
4: 1041
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81
1124640354_1124640381 26 Left 1124640354 15:31392809-31392831 CCCCCACCCCGCCCCCGCCCCCG 0: 6
1: 21
2: 244
3: 1126
4: 6238
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81
1124640361_1124640381 15 Left 1124640361 15:31392820-31392842 CCCCCGCCCCCGCCCCCGCCCGC 0: 3
1: 130
2: 372
3: 1720
4: 8928
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81
1124640376_1124640381 -3 Left 1124640376 15:31392838-31392860 CCCGCGACGCTTCCGGGAGGTCT 0: 1
1: 1
2: 0
3: 2
4: 56
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81
1124640364_1124640381 12 Left 1124640364 15:31392823-31392845 CCGCCCCCGCCCCCGCCCGCGAC 0: 1
1: 2
2: 155
3: 547
4: 2943
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81
1124640368_1124640381 6 Left 1124640368 15:31392829-31392851 CCGCCCCCGCCCGCGACGCTTCC 0: 1
1: 1
2: 0
3: 33
4: 421
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81
1124640353_1124640381 27 Left 1124640353 15:31392808-31392830 CCCCCCACCCCGCCCCCGCCCCC 0: 7
1: 15
2: 325
3: 2095
4: 10530
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81
1124640374_1124640381 0 Left 1124640374 15:31392835-31392857 CCGCCCGCGACGCTTCCGGGAGG 0: 1
1: 1
2: 0
3: 4
4: 47
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81
1124640372_1124640381 2 Left 1124640372 15:31392833-31392855 CCCCGCCCGCGACGCTTCCGGGA 0: 1
1: 1
2: 0
3: 11
4: 54
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81
1124640358_1124640381 20 Left 1124640358 15:31392815-31392837 CCCCGCCCCCGCCCCCGCCCCCG 0: 79
1: 135
2: 508
3: 1876
4: 8520
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81
1124640362_1124640381 14 Left 1124640362 15:31392821-31392843 CCCCGCCCCCGCCCCCGCCCGCG 0: 1
1: 102
2: 232
3: 1004
4: 4184
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81
1124640366_1124640381 8 Left 1124640366 15:31392827-31392849 CCCCGCCCCCGCCCGCGACGCTT 0: 1
1: 1
2: 2
3: 29
4: 310
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81
1124640363_1124640381 13 Left 1124640363 15:31392822-31392844 CCCGCCCCCGCCCCCGCCCGCGA 0: 1
1: 8
2: 132
3: 469
4: 2261
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81
1124640367_1124640381 7 Left 1124640367 15:31392828-31392850 CCCGCCCCCGCCCGCGACGCTTC 0: 1
1: 1
2: 1
3: 27
4: 349
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81
1124640360_1124640381 18 Left 1124640360 15:31392817-31392839 CCGCCCCCGCCCCCGCCCCCGCC 0: 97
1: 169
2: 637
3: 4863
4: 13574
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81
1124640356_1124640381 24 Left 1124640356 15:31392811-31392833 CCCACCCCGCCCCCGCCCCCGCC 0: 5
1: 124
2: 287
3: 1361
4: 8545
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81
1124640357_1124640381 23 Left 1124640357 15:31392812-31392834 CCACCCCGCCCCCGCCCCCGCCC 0: 16
1: 77
2: 387
3: 2411
4: 9893
Right 1124640381 15:31392858-31392880 TCTAGGCGGCTGCCGTGAGCCGG 0: 1
1: 1
2: 0
3: 9
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124640381 Original CRISPR TCTAGGCGGCTGCCGTGAGC CGG Intronic