ID: 1124640384

View in Genome Browser
Species Human (GRCh38)
Location 15:31392875-31392897
Sequence AGCCGGTCCGAAACGGCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 1, 2: 0, 3: 1, 4: 22}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124640370_1124640384 20 Left 1124640370 15:31392832-31392854 CCCCCGCCCGCGACGCTTCCGGG 0: 1
1: 1
2: 0
3: 16
4: 127
Right 1124640384 15:31392875-31392897 AGCCGGTCCGAAACGGCTCTAGG 0: 1
1: 1
2: 0
3: 1
4: 22
1124640368_1124640384 23 Left 1124640368 15:31392829-31392851 CCGCCCCCGCCCGCGACGCTTCC 0: 1
1: 1
2: 0
3: 33
4: 421
Right 1124640384 15:31392875-31392897 AGCCGGTCCGAAACGGCTCTAGG 0: 1
1: 1
2: 0
3: 1
4: 22
1124640365_1124640384 26 Left 1124640365 15:31392826-31392848 CCCCCGCCCCCGCCCGCGACGCT 0: 1
1: 2
2: 8
3: 96
4: 1041
Right 1124640384 15:31392875-31392897 AGCCGGTCCGAAACGGCTCTAGG 0: 1
1: 1
2: 0
3: 1
4: 22
1124640366_1124640384 25 Left 1124640366 15:31392827-31392849 CCCCGCCCCCGCCCGCGACGCTT 0: 1
1: 1
2: 2
3: 29
4: 310
Right 1124640384 15:31392875-31392897 AGCCGGTCCGAAACGGCTCTAGG 0: 1
1: 1
2: 0
3: 1
4: 22
1124640363_1124640384 30 Left 1124640363 15:31392822-31392844 CCCGCCCCCGCCCCCGCCCGCGA 0: 1
1: 8
2: 132
3: 469
4: 2261
Right 1124640384 15:31392875-31392897 AGCCGGTCCGAAACGGCTCTAGG 0: 1
1: 1
2: 0
3: 1
4: 22
1124640364_1124640384 29 Left 1124640364 15:31392823-31392845 CCGCCCCCGCCCCCGCCCGCGAC 0: 1
1: 2
2: 155
3: 547
4: 2943
Right 1124640384 15:31392875-31392897 AGCCGGTCCGAAACGGCTCTAGG 0: 1
1: 1
2: 0
3: 1
4: 22
1124640373_1124640384 18 Left 1124640373 15:31392834-31392856 CCCGCCCGCGACGCTTCCGGGAG 0: 1
1: 1
2: 1
3: 5
4: 70
Right 1124640384 15:31392875-31392897 AGCCGGTCCGAAACGGCTCTAGG 0: 1
1: 1
2: 0
3: 1
4: 22
1124640367_1124640384 24 Left 1124640367 15:31392828-31392850 CCCGCCCCCGCCCGCGACGCTTC 0: 1
1: 1
2: 1
3: 27
4: 349
Right 1124640384 15:31392875-31392897 AGCCGGTCCGAAACGGCTCTAGG 0: 1
1: 1
2: 0
3: 1
4: 22
1124640374_1124640384 17 Left 1124640374 15:31392835-31392857 CCGCCCGCGACGCTTCCGGGAGG 0: 1
1: 1
2: 0
3: 4
4: 47
Right 1124640384 15:31392875-31392897 AGCCGGTCCGAAACGGCTCTAGG 0: 1
1: 1
2: 0
3: 1
4: 22
1124640372_1124640384 19 Left 1124640372 15:31392833-31392855 CCCCGCCCGCGACGCTTCCGGGA 0: 1
1: 1
2: 0
3: 11
4: 54
Right 1124640384 15:31392875-31392897 AGCCGGTCCGAAACGGCTCTAGG 0: 1
1: 1
2: 0
3: 1
4: 22
1124640380_1124640384 2 Left 1124640380 15:31392850-31392872 CCGGGAGGTCTAGGCGGCTGCCG 0: 2
1: 0
2: 0
3: 15
4: 191
Right 1124640384 15:31392875-31392897 AGCCGGTCCGAAACGGCTCTAGG 0: 1
1: 1
2: 0
3: 1
4: 22
1124640376_1124640384 14 Left 1124640376 15:31392838-31392860 CCCGCGACGCTTCCGGGAGGTCT 0: 1
1: 1
2: 0
3: 2
4: 56
Right 1124640384 15:31392875-31392897 AGCCGGTCCGAAACGGCTCTAGG 0: 1
1: 1
2: 0
3: 1
4: 22
1124640377_1124640384 13 Left 1124640377 15:31392839-31392861 CCGCGACGCTTCCGGGAGGTCTA 0: 2
1: 0
2: 0
3: 1
4: 11
Right 1124640384 15:31392875-31392897 AGCCGGTCCGAAACGGCTCTAGG 0: 1
1: 1
2: 0
3: 1
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124640384 Original CRISPR AGCCGGTCCGAAACGGCTCT AGG Intronic