ID: 1124640387

View in Genome Browser
Species Human (GRCh38)
Location 15:31392887-31392909
Sequence ACGGCTCTAGGTGCACTGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 67}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124640377_1124640387 25 Left 1124640377 15:31392839-31392861 CCGCGACGCTTCCGGGAGGTCTA 0: 2
1: 0
2: 0
3: 1
4: 11
Right 1124640387 15:31392887-31392909 ACGGCTCTAGGTGCACTGTCCGG 0: 1
1: 1
2: 0
3: 3
4: 67
1124640383_1124640387 -6 Left 1124640383 15:31392870-31392892 CCGTGAGCCGGTCCGAAACGGCT 0: 1
1: 1
2: 0
3: 0
4: 13
Right 1124640387 15:31392887-31392909 ACGGCTCTAGGTGCACTGTCCGG 0: 1
1: 1
2: 0
3: 3
4: 67
1124640380_1124640387 14 Left 1124640380 15:31392850-31392872 CCGGGAGGTCTAGGCGGCTGCCG 0: 2
1: 0
2: 0
3: 15
4: 191
Right 1124640387 15:31392887-31392909 ACGGCTCTAGGTGCACTGTCCGG 0: 1
1: 1
2: 0
3: 3
4: 67
1124640373_1124640387 30 Left 1124640373 15:31392834-31392856 CCCGCCCGCGACGCTTCCGGGAG 0: 1
1: 1
2: 1
3: 5
4: 70
Right 1124640387 15:31392887-31392909 ACGGCTCTAGGTGCACTGTCCGG 0: 1
1: 1
2: 0
3: 3
4: 67
1124640376_1124640387 26 Left 1124640376 15:31392838-31392860 CCCGCGACGCTTCCGGGAGGTCT 0: 1
1: 1
2: 0
3: 2
4: 56
Right 1124640387 15:31392887-31392909 ACGGCTCTAGGTGCACTGTCCGG 0: 1
1: 1
2: 0
3: 3
4: 67
1124640374_1124640387 29 Left 1124640374 15:31392835-31392857 CCGCCCGCGACGCTTCCGGGAGG 0: 1
1: 1
2: 0
3: 4
4: 47
Right 1124640387 15:31392887-31392909 ACGGCTCTAGGTGCACTGTCCGG 0: 1
1: 1
2: 0
3: 3
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124640387 Original CRISPR ACGGCTCTAGGTGCACTGTC CGG Intronic