ID: 1124642788

View in Genome Browser
Species Human (GRCh38)
Location 15:31407001-31407023
Sequence ATGTTATCTCACATGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1808
Summary {0: 1, 1: 4, 2: 65, 3: 369, 4: 1369}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124642788_1124642793 0 Left 1124642788 15:31407001-31407023 CCTTTTTCCATGTGAGATAACAT 0: 1
1: 4
2: 65
3: 369
4: 1369
Right 1124642793 15:31407024-31407046 ATTCGTAGGTTCCAGGGATTAGG 0: 2
1: 25
2: 234
3: 717
4: 1677
1124642788_1124642795 15 Left 1124642788 15:31407001-31407023 CCTTTTTCCATGTGAGATAACAT 0: 1
1: 4
2: 65
3: 369
4: 1369
Right 1124642795 15:31407039-31407061 GGATTAGGATGTGACATCTTTGG 0: 1
1: 2
2: 18
3: 70
4: 287
1124642788_1124642792 -6 Left 1124642788 15:31407001-31407023 CCTTTTTCCATGTGAGATAACAT 0: 1
1: 4
2: 65
3: 369
4: 1369
Right 1124642792 15:31407018-31407040 TAACATATTCGTAGGTTCCAGGG 0: 3
1: 15
2: 135
3: 390
4: 780
1124642788_1124642791 -7 Left 1124642788 15:31407001-31407023 CCTTTTTCCATGTGAGATAACAT 0: 1
1: 4
2: 65
3: 369
4: 1369
Right 1124642791 15:31407017-31407039 ATAACATATTCGTAGGTTCCAGG 0: 2
1: 5
2: 74
3: 299
4: 788

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124642788 Original CRISPR ATGTTATCTCACATGGAAAA AGG (reversed) Intronic
900636186 1:3666931-3666953 ATGTTATTTCCCATGGCAAAGGG + Intronic
901568970 1:10143595-10143617 ATGTGATCTCCCATGGCGAAAGG - Intronic
901955326 1:12780172-12780194 ATTTGATATCACATGGAAAGAGG - Intergenic
901978690 1:13016224-13016246 ATTTGATATCACATGGAAACAGG - Intronic
902003391 1:13212714-13212736 ATTTGATATCACATGGAAACAGG + Intergenic
902022618 1:13358467-13358489 ATTTGATATCACATGGAAACAGG + Intergenic
902113685 1:14103802-14103824 ATGATACCTTACATGGCAAAGGG - Intergenic
902114805 1:14112617-14112639 ATGTTCCCTTACATGGAAAAAGG + Intergenic
902702930 1:18184932-18184954 CTGTTTTCTCACCTGGAAAATGG + Intronic
902934831 1:19757511-19757533 ATGTTACCCTACATGGCAAAAGG - Intronic
903316981 1:22515730-22515752 ATGTTACCATACATGGCAAAAGG - Intronic
903376921 1:22872431-22872453 ATGTTACCTTACATGACAAAAGG - Intronic
903489831 1:23719925-23719947 ATGTTATCTTACATGGCAAGGGG - Intergenic
903655175 1:24944496-24944518 ATGTTACCTTATATGGCAAAAGG + Intronic
903935124 1:26890118-26890140 AGGTCAACTCACAGGGAAAACGG + Exonic
904114517 1:28151745-28151767 CTGTGACCTCACATGGCAAAAGG - Intronic
904389766 1:30174637-30174659 ATGTTATCTTACGTGGCAAAAGG + Intergenic
904638385 1:31902551-31902573 ATGTTATCCTACATGTCAAAGGG - Intergenic
904979259 1:34483271-34483293 ATCTCATCTCTCAAGGAAAAGGG + Intergenic
905012424 1:34756393-34756415 ATGTTATGTCAGGAGGAAAAGGG + Intronic
906484778 1:46225932-46225954 ATTTTATCTTAAATGGTAAAAGG - Intergenic
906646235 1:47477486-47477508 ATGTTACCTTACATGGTGAAAGG - Intergenic
906857787 1:49327193-49327215 ATGTTACCTTACATGGCAAAGGG - Intronic
906884000 1:49624802-49624824 TTATTTTCTCACATGGAGAAAGG - Intronic
907084301 1:51655548-51655570 ATGTTACATTACATGGCAAAAGG - Intronic
907115859 1:51967898-51967920 ATGTTACCTTACATGGCAAAAGG + Intronic
907323829 1:53622501-53622523 ATGTTATCTTATTTGGAAAAAGG + Intronic
907562063 1:55400012-55400034 CTGTTTTCTCACCTGTAAAATGG + Intergenic
907619576 1:55962825-55962847 ATGTTACCTTATATGGCAAAAGG - Intergenic
907799833 1:57753513-57753535 CTGTTTTCTCATATGTAAAATGG + Intronic
908096806 1:60747794-60747816 ATGTTACCTTACATGGCAAAAGG - Intergenic
908124499 1:61016766-61016788 ATGTTACCTTACGTGGCAAAGGG - Intronic
908268093 1:62397809-62397831 ATGTTATCCCACATGGCAAAAGG + Intergenic
908364624 1:63407457-63407479 ATGTTATCTGACGTGAAAAAAGG + Intronic
908592852 1:65652134-65652156 CTGTTCACTCCCATGGAAAAGGG + Intergenic
908897980 1:68922817-68922839 ATGTTACCTTACATGGCAAAGGG + Intergenic
909026255 1:70485714-70485736 ATGTTATCTTACATGGTGAAAGG + Intergenic
909252782 1:73380160-73380182 CTGTTATCCTACATGGCAAAAGG - Intergenic
909381350 1:75002483-75002505 ATGTTATGTTGCATGGCAAAGGG - Intergenic
909420635 1:75461322-75461344 ATATTATCTTACAGGGAGAAAGG - Intronic
909580617 1:77229502-77229524 ATGTTACCTTATATGGCAAAAGG + Intergenic
909602286 1:77473044-77473066 ATGTTACCTTACATGGCCAAAGG - Intronic
909716848 1:78718463-78718485 ATGTTAGCTGAAAGGGAAAAGGG - Intergenic
909780929 1:79546085-79546107 ATGTTATCTTACATGGCAAAAGG + Intergenic
909924531 1:81423727-81423749 ATGTTAACTGAGATGTAAAAAGG + Intronic
910093525 1:83493474-83493496 ATGTTATCTTACATGGAAAAGGG + Intergenic
910113062 1:83702382-83702404 AAGTTACCTTACATGGCAAAGGG - Intergenic
910113200 1:83703552-83703574 AAGTTACCTTACATGGCAAAGGG + Intergenic
910207821 1:84765359-84765381 ATGTTACCTTACATGACAAAAGG - Intergenic
910282684 1:85518727-85518749 AGTTTATCTTACATGGCAAAAGG - Intronic
910556703 1:88542476-88542498 ATATTACATCACATGGCAAAAGG + Intergenic
911154874 1:94627553-94627575 ATGTTAGGTTGCATGGAAAAGGG - Intergenic
911345595 1:96693036-96693058 ATGTTACCTTACATAGCAAAAGG + Intergenic
911500939 1:98683571-98683593 CTATAATCTCACATGGTAAAAGG - Intronic
911712788 1:101094950-101094972 CTGTGCTCTCACATGGCAAAAGG + Intergenic
911716833 1:101142807-101142829 ATGTCATCTTACATGGCAAAAGG - Intergenic
911758428 1:101588127-101588149 ATGTTACCTTTCATGGCAAAAGG - Intergenic
912148906 1:106831877-106831899 ATGTTATTTTACATGGCAAAAGG - Intergenic
912254924 1:108048671-108048693 ATGTTATCTTACACGGCAAAAGG + Intergenic
912961485 1:114199500-114199522 TTGTGTTCCCACATGGAAAAAGG + Intergenic
913674854 1:121131032-121131054 ATGTTACCTTATATGGCAAAGGG - Intergenic
914026693 1:143918664-143918686 ATGTTACCTTATATGGCAAAGGG - Intergenic
914207328 1:145544256-145544278 TTGTTATCTTACATGGCAAAAGG + Intergenic
914334444 1:146701644-146701666 ATGTTACCTTATATGGCAAAAGG - Intergenic
914665075 1:149826099-149826121 ATGTTACCTTATATGGCAAAGGG - Intergenic
914670690 1:149867722-149867744 ATGTTACCTTATATGGCAAAGGG + Intronic
914765455 1:150633683-150633705 ATTTGATGTCACATGGAAACAGG - Intergenic
914931119 1:151934386-151934408 ACGTTACCACACATGGCAAAAGG - Intergenic
915402105 1:155630119-155630141 ATTTGATGTCACATGGAAACAGG - Intergenic
915466189 1:156099453-156099475 TTGTTTTCTCACCTGTAAAATGG + Intronic
916034802 1:160912355-160912377 ATGTTATCTTAGATGGCAAAAGG - Intergenic
916189075 1:162161220-162161242 GTGTTACCTCACATGACAAAGGG - Intronic
916191685 1:162185260-162185282 ATGTTACTTTACATGGCAAAAGG - Intronic
916285611 1:163101675-163101697 ATCTTATGTCACATGATAAAGGG - Intergenic
916476820 1:165177498-165177520 ATGTTACATCATATGGCAAAAGG + Intergenic
916630684 1:166609062-166609084 ATTTGATATCACATGGAAACAGG - Intergenic
916700067 1:167282916-167282938 CTGTTTTCTCATATGTAAAATGG + Intronic
916822910 1:168417115-168417137 AGGTTGTCTCACAGGGCAAAAGG + Intergenic
917135117 1:171781912-171781934 ATGGTATCTCACAGGGAATAGGG + Exonic
917268023 1:173242542-173242564 ATGTCACCTCACATGGTCAAGGG + Intergenic
917794635 1:178524070-178524092 ATGTTATGTTACCTGGAAAAGGG - Intronic
918009015 1:180569226-180569248 ATGTTACCTTATTTGGAAAAAGG + Intergenic
918191394 1:182178299-182178321 ATGTCACCTTACATGGCAAAAGG + Intergenic
918317405 1:183333356-183333378 ATGTTATCTTACATGGCAGAAGG + Intronic
918553593 1:185772836-185772858 CTGTTTTCTCACATGGTAGAAGG + Intronic
918768979 1:188528677-188528699 ATGTTTCCTTACAAGGAAAAAGG - Intergenic
918896621 1:190356723-190356745 ATGTTACCTTACATGGCAAGAGG - Intronic
918948933 1:191109394-191109416 ATAATATCTCACACTGAAAATGG - Intergenic
919327799 1:196131295-196131317 ATGTTACCTTCCATGGCAAAAGG + Intergenic
919482668 1:198108708-198108730 ATGATATTTCACATGTAAGAAGG + Intergenic
919569755 1:199232884-199232906 ATGTTAACTTATTTGGAAAAAGG - Intergenic
920535782 1:206735796-206735818 ATGTTCCCTTACATGGCAAAGGG - Intergenic
921228014 1:213039658-213039680 CTGTTAATTAACATGGAAAATGG - Intergenic
921275283 1:213513013-213513035 ACGTTATGTTACATGGCAAAAGG + Intergenic
921309770 1:213831215-213831237 GTGTCACCTCACATGGAAAAAGG + Intergenic
921329152 1:214018148-214018170 ATGTTATCTGCCATGTGAAAAGG - Intronic
921493430 1:215807044-215807066 ATGTTATGTTACATGGCAAAGGG + Intronic
921526269 1:216222467-216222489 ATGTTACCTTACTTGGTAAAAGG + Intronic
922375676 1:224962257-224962279 ATGTTATTTTATATGGCAAAGGG + Intronic
922601817 1:226861780-226861802 ATGTTATTTTACGTGGCAAAAGG - Intergenic
922858374 1:228794643-228794665 ATGTGAGCTTATATGGAAAAAGG - Intergenic
922871428 1:228905048-228905070 ATGTTATGTTACATGGCAAAGGG + Intergenic
923699162 1:236283242-236283264 ATGTTATCCTATATGGCAAAAGG - Intergenic
923788393 1:237090294-237090316 ATGTTACTTTACATGGCAAAAGG + Intronic
923991998 1:239448581-239448603 ATTTTATCTCATATGAGAAAAGG + Intronic
924327685 1:242912055-242912077 ATGTTATCTTACATGGCAAAGGG - Intergenic
924439392 1:244073893-244073915 ATGTGACCTCATTTGGAAAAAGG - Intergenic
924444512 1:244116751-244116773 ATGTTGCTTCACATGGAAAAAGG + Intergenic
924587761 1:245375009-245375031 GTGTTACCTTACATGGTAAAAGG + Intronic
924846116 1:247773974-247773996 ATATTACCTTACATGGTAAAAGG + Intergenic
1063530652 10:6827922-6827944 ATTTGATGTCACATGGAAACAGG - Intergenic
1063740383 10:8811598-8811620 ATGTTACATTACATGGCAAAAGG - Intergenic
1063803157 10:9604756-9604778 AAGTTGTCTCACATTGAAAATGG + Intergenic
1063817140 10:9788312-9788334 ATGTAATCTCATTTGGAAACAGG - Intergenic
1063835341 10:10005707-10005729 ATGTGACCTCAAATGGTAAAAGG + Intergenic
1064561120 10:16596218-16596240 ATGTTACCTTACATGACAAAAGG + Intronic
1064687134 10:17874502-17874524 ATGTTAGCTTACATGGAAAATGG - Intronic
1065037384 10:21653628-21653650 ATGTTATATTACATGGCAAAAGG - Intronic
1065223937 10:23523822-23523844 ATGTTATCTCAAGAGGAGAAGGG - Intergenic
1065231717 10:23605492-23605514 GTCTTATTTTACATGGAAAATGG + Intergenic
1065434220 10:25690648-25690670 ATGTTATTTTACTTGGCAAATGG - Intergenic
1065659254 10:27988824-27988846 ATGTCACCTTACATGGCAAAAGG + Intronic
1065675051 10:28165188-28165210 ATGTTACCTCACATGGTAAAGGG + Intronic
1065737682 10:28769294-28769316 ATGTTATTTCAAGAGGAAAAAGG + Intergenic
1065862990 10:29886998-29887020 ATGTGAGTTCACATGGAAAAGGG - Intergenic
1066011700 10:31200453-31200475 ATGTTACATTACATGGCAAAGGG + Intergenic
1066054572 10:31668493-31668515 CTGTTACCTCACATGGAAGAAGG + Intergenic
1066228189 10:33405028-33405050 ATGTCACCTTACATGGTAAAAGG - Intergenic
1066444338 10:35468186-35468208 GTGTAACCTCACATGGCAAAAGG + Intronic
1067075047 10:43173542-43173564 ATATTATCAGACTTGGAAAAAGG - Intronic
1067099714 10:43325756-43325778 ATGTGACCTTACTTGGAAAAAGG - Intergenic
1067125209 10:43510077-43510099 ATCTTATGTCACATGATAAAGGG + Intergenic
1067235592 10:44445853-44445875 ATCTTATCTTACATGGAATAAGG + Intergenic
1067235688 10:44447079-44447101 ATCTTATCTTACATGGAATAAGG - Intergenic
1067698740 10:48553688-48553710 ATGTTACCTTATATGGCAAAGGG + Intronic
1067932923 10:50581510-50581532 TTGTTTTCTCAGATGTAAAATGG + Intronic
1067983986 10:51121224-51121246 ATATTACCTTATATGGAAAAAGG - Intronic
1068243083 10:54330476-54330498 ATGATATATCACATAGCAAATGG - Intronic
1068391404 10:56401927-56401949 ATGTTTCCTTACATGGCAAAAGG + Intergenic
1068415790 10:56720462-56720484 ATGTTACCTTATATGGCAAAAGG - Intergenic
1068643318 10:59436128-59436150 TAGTTTTCTCACATAGAAAATGG + Intergenic
1068833429 10:61523980-61524002 ATATTACCTTACATGGCAAAAGG + Intergenic
1068839431 10:61593462-61593484 ATGTCATCTCACATGGCAAAAGG + Intergenic
1068926447 10:62544465-62544487 CTGTTTTCTCACATGTAAAATGG + Intronic
1068988681 10:63129884-63129906 ATGTTACCTCATATGGCAAAGGG + Intergenic
1069084160 10:64120225-64120247 ATGTTACCTTATTTGGAAAAAGG + Intergenic
1069132098 10:64718493-64718515 ATGTTAGCTTACAGGGTAAAGGG - Intergenic
1069321442 10:67176618-67176640 ATGTTACCTGACATGGCAAGAGG + Intronic
1069808181 10:71138924-71138946 GTGTTACTTCACATGGCAAAAGG + Intergenic
1069869508 10:71524616-71524638 GTGTGACCCCACATGGAAAAGGG + Intronic
1069882800 10:71604092-71604114 CTGTTTTCTCACCTGTAAAATGG + Intronic
1070039633 10:72763213-72763235 ATGTTACCTTACGTGGCAAAAGG - Intronic
1070252772 10:74787502-74787524 ATGTTTGCTCACTTGTAAAATGG - Intergenic
1070342888 10:75513858-75513880 ATGTGACCTTACATGGCAAATGG - Intronic
1070362009 10:75699746-75699768 ATGTTACCTTATATGGAAAAAGG + Intronic
1070448230 10:76529813-76529835 TTGTCTTCTTACATGGAAAAAGG + Intronic
1070525941 10:77296085-77296107 ATGTGACCTTACATGGCAAAAGG + Intronic
1070629426 10:78074366-78074388 ATGTTAACTTACGTGGCAAAAGG + Intergenic
1070633277 10:78103821-78103843 ATGTTACCCTACATGGCAAAAGG + Intergenic
1070686646 10:78489713-78489735 ATGTTATCTTACATGGCAAAGGG - Intergenic
1070990663 10:80729478-80729500 ATGTTACCTTACAGGGTAAAAGG + Intergenic
1071114024 10:82195650-82195672 ATGTTATTTGACATGGCAAGAGG + Intronic
1071370738 10:84949006-84949028 ATGTTACCTTACATGCAAAAGGG - Intergenic
1071713189 10:88069887-88069909 GTATTATCTTACTTGGAAAAAGG - Intergenic
1071776033 10:88789122-88789144 ATGTTACCTTATATGGCAAAAGG + Intergenic
1072031626 10:91527275-91527297 ATGTTACCTTACATGGCAAGTGG - Intergenic
1072366661 10:94717977-94717999 ATGTTATCTCTCTTAGAAATAGG - Intronic
1072863581 10:99033007-99033029 ATGTTAACTTACATGGCAAAGGG - Intronic
1072947498 10:99823204-99823226 ATTTGATGTCACATGGAAACAGG - Intronic
1072979328 10:100086688-100086710 ATGTTATGTTACATGGCAAAGGG + Intergenic
1073353590 10:102836663-102836685 ATGTTACTTTTCATGGAAAATGG - Intronic
1073837538 10:107462251-107462273 ATGTTATATTTCATGGCAAAAGG - Intergenic
1074153190 10:110776727-110776749 ATGTTATCTTACATGGTAAAGGG - Intronic
1074249185 10:111726868-111726890 CTGTTTTCTCATATGTAAAATGG - Intergenic
1074249996 10:111735522-111735544 ATGTTACCTTACATGGCAAAGGG - Intergenic
1074425086 10:113343564-113343586 ATGTTACCTTATATGGTAAAAGG + Intergenic
1074494066 10:113963639-113963661 ATGTTACCTCACATGGCAAAAGG - Intergenic
1074670731 10:115787748-115787770 ATGTTACCTTACTTGGTAAAAGG + Intronic
1074745735 10:116530054-116530076 ATGTCATGCTACATGGAAAAAGG + Intergenic
1074762721 10:116679334-116679356 AGTTTTTTTCACATGGAAAATGG - Intronic
1074771328 10:116736467-116736489 ATGTTATCTCCTATGGGAAAAGG + Intronic
1074851834 10:117445307-117445329 ATATTACCTTACATGGCAAAGGG - Intergenic
1074863501 10:117531449-117531471 CCGTTTTCTCATATGGAAAATGG + Intergenic
1074882007 10:117666877-117666899 CAGTTTTCTCACCTGGAAAATGG + Intergenic
1074942454 10:118248542-118248564 ATGTGATCTTACTTGGAAATAGG - Intergenic
1074972288 10:118548970-118548992 TTGTGTTCTCACATGGTAAAAGG - Intergenic
1075029089 10:119009131-119009153 ACGTTACCTTACATGGTAAAGGG + Intergenic
1075245459 10:120818309-120818331 ATGTTACCTTACATGGCAAAGGG + Intergenic
1075667792 10:124243438-124243460 ATGTTCCCTTACATGGCAAAAGG + Intergenic
1075699463 10:124459825-124459847 ATATTACCTGACATGGCAAAAGG - Intergenic
1075840368 10:125496934-125496956 ATGTTTTCTCATCTGTAAAATGG - Intergenic
1075903395 10:126061481-126061503 ATGTTATCTGACATGGCAAAAGG + Intronic
1075930369 10:126289938-126289960 ATGTTACCTTACTTGGCAAAAGG + Intronic
1076346227 10:129780561-129780583 ATGTGATCTTATTTGGAAAAAGG + Intergenic
1076541172 10:131215837-131215859 ATGTAATTTTCCATGGAAAATGG - Intronic
1077022207 11:422371-422393 ATTTTATCTCACAAGGCAGATGG + Intronic
1077470354 11:2755662-2755684 ATGTTACGTTATATGGAAAAGGG - Intronic
1077788419 11:5411636-5411658 ATGTTGGTTTACATGGAAAAGGG + Intronic
1078001540 11:7500574-7500596 ATGTTTCCTCATTTGGAAAATGG + Intronic
1078206372 11:9233511-9233533 ATGTTATCTTACTTGGAAAAAGG + Intronic
1078267927 11:9768851-9768873 ATGTCATCTTACATGGCAAAGGG - Intergenic
1078360165 11:10661807-10661829 ATGTTACCTTAAATGGCAAAAGG - Intronic
1078388605 11:10915258-10915280 ATGTTACCTTACATGGTAAAAGG - Intergenic
1078415349 11:11160384-11160406 ATGTTACCTTATATGGCAAAAGG - Intergenic
1078453882 11:11460184-11460206 ATGTTACCTTACATGGCAAAAGG - Intronic
1078485636 11:11720860-11720882 ATGTCACCCTACATGGAAAAAGG - Intergenic
1078578604 11:12521605-12521627 GTGTTATCTTACATGGCAAAAGG + Intronic
1078893140 11:15575567-15575589 ATGTTTTCTCATATGTAAAGTGG - Intergenic
1079022125 11:16917705-16917727 ATGTTACCTTATATGGGAAAAGG - Intronic
1079417412 11:20252447-20252469 ATGTTACCTAATTTGGAAAAGGG - Intergenic
1079689203 11:23400962-23400984 ATGTTTTCTTACCTAGAAAAGGG - Intergenic
1079929020 11:26534214-26534236 TTCTTATTTCACATGGAACAAGG - Intronic
1079986554 11:27206261-27206283 ATGTTATCTTACATGGCAAAAGG + Intergenic
1080109076 11:28545322-28545344 TTGTTACCTTACATGGCAAAAGG + Intergenic
1080185736 11:29483113-29483135 ATGTTACCTTACTTAGAAAAAGG - Intergenic
1080420570 11:32106486-32106508 ATGTGATCTTACTTGGAAAAAGG - Intergenic
1080490471 11:32757891-32757913 ATGTTACCTTATATGGCAAAAGG - Intronic
1080698858 11:34626894-34626916 AAGTTTTCTCATCTGGAAAATGG + Intronic
1080708803 11:34725595-34725617 ATGTTACCTTACATGGCAAAAGG + Intergenic
1080717830 11:34821100-34821122 CTGTTTTCTCACCTTGAAAATGG - Intergenic
1080799228 11:35594081-35594103 ATGTTATGTTATATGGCAAAGGG - Intergenic
1080928947 11:36787354-36787376 ATGTCTCCTCACATGGCAAAAGG - Intergenic
1081104862 11:39053778-39053800 ATGTTAACTTACATTGACAAGGG - Intergenic
1081276329 11:41153792-41153814 ATATTACCTCATTTGGAAAAAGG + Intronic
1081340902 11:41926317-41926339 ACGTTACCTTACATGGCAAAGGG + Intergenic
1081362190 11:42193692-42193714 ATGTTACCTTACATGGCATAAGG - Intergenic
1081375362 11:42351972-42351994 ATGTGACCTTACATGGTAAAAGG + Intergenic
1081597994 11:44472519-44472541 ATGTTACCTTATATGGCAAAGGG + Intergenic
1081601263 11:44496507-44496529 ATGTTGCCTTACATGGCAAAAGG - Intergenic
1081844825 11:46232775-46232797 ATGCTATGTTACATGGGAAAGGG + Intergenic
1082002289 11:47399992-47400014 CAGTTATCTCAGCTGGAAAATGG - Intergenic
1082738961 11:56889305-56889327 GTGTTTTCTCACCTGGAAAATGG + Intergenic
1082797991 11:57392184-57392206 GGGTTGTCTCACTTGGAAAATGG - Intronic
1083040181 11:59678552-59678574 ATATTATTTTACATGGTAAAAGG - Intergenic
1083580439 11:63821420-63821442 ATGTTTTGTTACATGGCAAAGGG - Intronic
1083606420 11:63981538-63981560 ATGTTATCTTACATGGCATGGGG + Intronic
1084583424 11:70038980-70039002 AGGTTATCTCTCAGGGAAAAAGG + Intergenic
1084591301 11:70092273-70092295 ATGTGATCTCACTTGGAAACAGG - Intronic
1084724182 11:70929746-70929768 ATGTTACTTTACATGGCAAAAGG - Intronic
1085196431 11:74674901-74674923 ATGTTAGGTCACATGGTAAAGGG - Intergenic
1085321075 11:75574451-75574473 CTGTTATCTCACCTGTAAGATGG - Intergenic
1085331768 11:75657936-75657958 ATGTTATCTTACATGGCAAAGGG - Intronic
1085407894 11:76274806-76274828 ATGTTATGTTAAATGGCAAAGGG + Intergenic
1085622580 11:78048604-78048626 ATGTTAGGTTACATGGCAAAGGG + Intronic
1085772940 11:79340887-79340909 ATGTTACCTTACATGGTAAAAGG + Intronic
1085851649 11:80127324-80127346 ATGTTTTCTCATCTGCAAAATGG + Intergenic
1085883868 11:80499562-80499584 ATGCCATCTCAGATGGAAATGGG + Intergenic
1086025636 11:82287359-82287381 ATGTAATCACAAGTGGAAAAGGG - Intergenic
1086055207 11:82638686-82638708 ATGTTATGTTACATGGTAAAGGG - Intergenic
1086121082 11:83304976-83304998 ATGTTACCTTACATGGTAAAAGG + Intergenic
1086145538 11:83547324-83547346 ATGTTATCTTATATAGCAAAAGG + Intronic
1086209738 11:84304955-84304977 ATTTTATTTCAGATGAAAAAAGG - Intronic
1086464060 11:87035924-87035946 AGGTTGTCTCCCTTGGAAAAGGG + Intergenic
1086538835 11:87883566-87883588 ATGTTGCCTTACATGGCAAAGGG + Intergenic
1086594460 11:88554376-88554398 ATGTTATCTTACATGGCAAAAGG - Intronic
1086729634 11:90231910-90231932 ATATTATGTTACATGGCAAAGGG + Intergenic
1086810274 11:91301325-91301347 ATGTTATGTTACACGGTAAAAGG + Intergenic
1086863286 11:91950053-91950075 ATGTTATTTTACATAGCAAAAGG + Intergenic
1086939380 11:92779689-92779711 ATGTTATGTTACATGGCAAATGG + Intronic
1086962042 11:92987769-92987791 TTGTAATCTCACATGGTGAAAGG - Intergenic
1086988221 11:93273174-93273196 ATATTATCTTATATGGCAAAAGG - Intergenic
1087009701 11:93501683-93501705 ATGTTACCTTAATTGGAAAAAGG - Intronic
1087009939 11:93503505-93503527 ATGTTATCTTAGGTGGAAAATGG + Intronic
1087369464 11:97264086-97264108 CTGTGCTCTCACATGGCAAAAGG + Intergenic
1087512463 11:99115009-99115031 GTGTAACCTCACATGGAAGAAGG - Intronic
1087566606 11:99867774-99867796 ATGTTAGGCTACATGGAAAAAGG - Intronic
1087662400 11:101002733-101002755 ATATTACCTTACATGGCAAAAGG - Intergenic
1087710085 11:101538534-101538556 ATGTTACGTTACATGGCAAAAGG + Intronic
1087724328 11:101700761-101700783 ATTTGATGTCACATGGAAACTGG + Intronic
1087871766 11:103303398-103303420 ATGTTATTTTCCATGGCAAAAGG + Intronic
1087984237 11:104657791-104657813 TTGTTAGTTCACATGGCAAAAGG - Intergenic
1088003482 11:104911260-104911282 AACTTATCTTACATGGAAATGGG + Intergenic
1088124352 11:106405437-106405459 ATGTTACATTACATGGCAAAGGG - Intergenic
1088205735 11:107390354-107390376 AAGTTTTTTCACATGGAAACTGG - Intronic
1088376265 11:109145204-109145226 ATGTTATATTACTTGGCAAAAGG - Intergenic
1088532615 11:110827199-110827221 GTGCTATCTAATATGGAAAATGG + Intergenic
1088717054 11:112558041-112558063 ATGTTACCTCATATGGCAGAAGG + Intergenic
1088962633 11:114684749-114684771 ATTTTAATTCATATGGAAAAAGG + Intronic
1088963484 11:114694256-114694278 ATGTTAAGTTACATGGCAAAAGG - Intronic
1089038975 11:115427577-115427599 AAGTTAGCTAACATGGATAAGGG + Intronic
1089154888 11:116394098-116394120 ATGTTACCTTACATGGCAACAGG + Intergenic
1089355253 11:117846255-117846277 ATGTCAACTCACTTGGAAAACGG - Intronic
1089413653 11:118268214-118268236 CAGTTATCTCACATGTAAAATGG + Intergenic
1089471510 11:118724461-118724483 ATTTGATGTCACATGGAAACAGG - Intergenic
1089631130 11:119784926-119784948 CTGTTATCTCATCTGTAAAATGG + Intergenic
1089825455 11:121271832-121271854 CTGTGTTCTCACATGGTAAAAGG + Intergenic
1089838357 11:121391901-121391923 ATGTTACTTTACATGGAAAAGGG - Intergenic
1090320465 11:125838752-125838774 ATGTTACCTTACATGGCAAAAGG + Exonic
1090452825 11:126821615-126821637 GTGTTATGTTACATGGCAAATGG + Intronic
1090596743 11:128328892-128328914 ATGATAACTCACTTGGAGAAAGG - Intergenic
1091179672 11:133592459-133592481 AAGTTGTTTCAAATGGAAAAAGG - Intergenic
1091946914 12:4554401-4554423 ATGTTACCTTACATGGCAAAGGG - Intronic
1092090909 12:5803030-5803052 ATGTTATCTGGCATTGCAAAGGG - Intronic
1092134626 12:6138056-6138078 ATGTGACCTTACTTGGAAAAAGG - Intergenic
1092134915 12:6140248-6140270 ATGCTACCTTACATGGCAAAAGG + Intergenic
1092702394 12:11246739-11246761 ATGTTAACTTACATGACAAAAGG + Intergenic
1092711972 12:11348447-11348469 ATGTTAACTTACATGACAAAGGG + Intergenic
1092870203 12:12799631-12799653 ATGTTATCTTACATGGCAATGGG - Intronic
1092928965 12:13297268-13297290 ATGTTACCTTACATGGCCAAAGG - Intergenic
1093002048 12:14008015-14008037 AAGACATCTGACATGGAAAATGG + Intergenic
1093378063 12:18455686-18455708 CTGTTTTCTCACATGGCCAAAGG + Intronic
1093404902 12:18792383-18792405 CTGTTACCTTACATGGCAAAAGG - Intergenic
1093636310 12:21473947-21473969 ATGTTACCTCACATGGCAAAAGG - Intronic
1093684255 12:22038451-22038473 GTGTTACCTTACATGGTAAAAGG - Intergenic
1093751284 12:22803365-22803387 ATGTTACTTTACATGGCAAAAGG - Intergenic
1094081820 12:26545211-26545233 ATGTTACCTCACATGCCAAAAGG + Intronic
1094255034 12:28413954-28413976 GTGTTATCTAACAGGCAAAAAGG - Intronic
1094383463 12:29868522-29868544 ATTTTACCTCACATGGCAAAGGG - Intergenic
1094585352 12:31772633-31772655 ATGTTAACTTACATGGCAAGAGG - Intergenic
1094874317 12:34623735-34623757 ATTTGATGTCACATGGAAACAGG - Intergenic
1095190499 12:39252293-39252315 ATCTTACGTCACATGAAAAAGGG - Intergenic
1095481414 12:42639948-42639970 ATGTTATTTCAAATAGAGAAAGG + Intergenic
1095622771 12:44278176-44278198 GTGTTACCTTACATGGCAAAGGG - Intronic
1095672738 12:44878913-44878935 ATGTTACCTCACATGGCAAAGGG + Intronic
1095685176 12:45025089-45025111 ATGTTATGTTACATGGCAAGGGG + Intronic
1095735142 12:45548059-45548081 ATGTTTACTTACATGGCAAATGG + Intergenic
1095772482 12:45976517-45976539 AATATATCCCACATGGAAAAGGG + Intronic
1096204727 12:49711539-49711561 ATGTTATCTTACATGGCAAAAGG + Intronic
1096339519 12:50785914-50785936 ATGTTTTATCACAAGGAAATGGG - Intronic
1097097118 12:56558425-56558447 ACATTATCTCACATTGAGAATGG + Intronic
1097330853 12:58331201-58331223 ATTTGATGTCACATGGAAACAGG - Intergenic
1097444722 12:59656262-59656284 ATGTTATGTTACATGGTAAAGGG + Intronic
1097610549 12:61814637-61814659 ATGTTACCTCACATGCCAAAAGG + Intronic
1097785906 12:63758624-63758646 ATATTATCTTACATGGCAAAGGG - Intergenic
1097792471 12:63829483-63829505 ATGTTTTCTTATATGGCAAAGGG - Intergenic
1098062119 12:66573969-66573991 ATTTCAGCTCATATGGAAAAGGG - Intronic
1098084733 12:66830244-66830266 ATGTTACCTTACATGGTAAAAGG + Intergenic
1098205573 12:68105831-68105853 ATGCTACCTTACATGGAAAAAGG + Intergenic
1098516811 12:71386935-71386957 ATGTTATATTACATGGCAAAAGG + Intronic
1098608439 12:72423643-72423665 ATGTTATATTAAATGGCAAAGGG + Intronic
1098754981 12:74351088-74351110 ATGTAATCTGCCATGAAAAATGG + Intergenic
1098770219 12:74541673-74541695 TTCTTACCTCATATGGAAAAGGG - Exonic
1098803687 12:74994354-74994376 ATGTTATGTTACATGACAAAGGG + Intergenic
1098827970 12:75322808-75322830 ATTTTGTCGCACATGGAAATTGG - Intronic
1098958586 12:76714273-76714295 ATATTATCTCACATAGCAAAAGG - Intergenic
1099092687 12:78333402-78333424 ATGTTATCTTATTTGGTAAAAGG + Intergenic
1099265249 12:80438148-80438170 ATGTTGTGTTACATGGCAAAAGG - Intronic
1099449088 12:82787296-82787318 AAGCTATCCCACATGTAAAATGG - Intronic
1099674298 12:85737929-85737951 ATGTTGTCTCAAATAGAAAAAGG + Intergenic
1099714624 12:86275507-86275529 ATGTTACCTTACTTGGCAAAAGG + Intronic
1099778417 12:87163895-87163917 GTGAAGTCTCACATGGAAAACGG - Intergenic
1099904086 12:88751278-88751300 ATGTTACCTTACATGGCAAAAGG - Intergenic
1099927482 12:89035299-89035321 ATGCTATCTCAGATGGCAAAGGG + Intergenic
1100159005 12:91835605-91835627 ATGTTACCTTACATGGAAACAGG - Intergenic
1100180774 12:92083781-92083803 ATGTTGCCTTACATGGCAAATGG - Intronic
1100580174 12:95931405-95931427 ACGTTACCTTACATGGCAAAAGG - Intronic
1100805409 12:98278062-98278084 ATGTTATGTAACATGACAAAAGG - Intergenic
1100822458 12:98444189-98444211 ATGTTACCTTACCTGGCAAAAGG - Intergenic
1100930153 12:99599184-99599206 ATGTTACCTTACTTGGAAAAAGG - Intronic
1100966601 12:100020309-100020331 ATGTTCTGTTACATGGCAAAAGG + Intergenic
1101062184 12:100983838-100983860 ATGTTATGTTACATGGCAAAAGG - Intronic
1101191258 12:102335858-102335880 ATATTACCTTACATGGCAAAAGG - Intergenic
1101191283 12:102336044-102336066 ATGTTATCTTACTTGGAAAACGG + Intergenic
1101790791 12:107925628-107925650 ATGTATTCCCTCATGGAAAAGGG + Intergenic
1102182614 12:110923764-110923786 CTGTTTCCTCACCTGGAAAAGGG + Intergenic
1102233275 12:111278107-111278129 GTGTTATGTTACATGGAACAGGG - Intronic
1102386776 12:112516665-112516687 ATGTTACTTTACATGGCAAAAGG - Intergenic
1102462467 12:113108387-113108409 CAGTTTTCTCACCTGGAAAATGG + Intronic
1102591931 12:113962854-113962876 ATGTTACCTTACAAGGCAAAAGG + Intronic
1103024902 12:117565629-117565651 AGTTTATCTCACATGGTAAAGGG - Intronic
1103137830 12:118523057-118523079 ATGTTACCTTTCATGGCAAAAGG + Intergenic
1103284020 12:119785245-119785267 ATATTACCACACATGGCAAAAGG + Intronic
1103799312 12:123526993-123527015 ATGTTACCTTACATGGCAAAAGG + Intronic
1103895288 12:124269164-124269186 ATGTTACCTTCCATGGCAAAGGG + Intronic
1103981582 12:124740253-124740275 ATGTTAGCTGACATGGCAAAAGG - Intergenic
1104063505 12:125287327-125287349 ATGTTACCTTACATGGTAAAAGG - Intronic
1104074760 12:125379188-125379210 ATGTTATGTTACATGGCAAGGGG + Intronic
1104111642 12:125710191-125710213 ATGTGACCTTACATGGCAAAAGG + Intergenic
1104244229 12:127022147-127022169 ATTTTACCTTACATAGAAAATGG + Intergenic
1104263991 12:127213250-127213272 ACGTTACCTTACATGGTAAAAGG - Intergenic
1104354724 12:128075363-128075385 ATGTTAAGTCACATGGAAAAGGG + Intergenic
1104368290 12:128198021-128198043 ATGTTATCTAACATAGTAAAAGG + Intergenic
1104409549 12:128546839-128546861 ATGTTACCTTACAAGGCAAAGGG - Intronic
1104425000 12:128668966-128668988 ATGTTACCTTACATGGTAAAAGG - Intronic
1104595511 12:130117649-130117671 ATGTCACCTGACATAGAAAAAGG + Intergenic
1104597016 12:130126828-130126850 ATGTCACCTTACATGGTAAAAGG + Intergenic
1104999854 12:132683172-132683194 ATGTTATCTTACAAGACAAAAGG + Intronic
1106139856 13:27003085-27003107 ATGTCACCTTACATGGCAAAGGG + Intergenic
1106548429 13:30750696-30750718 ATGTTATGTTACATGGCAAGGGG + Intronic
1106605026 13:31221147-31221169 CTGTTATCTCATTTGCAAAAGGG + Intronic
1106724893 13:32473897-32473919 ATCTTATCTTACATGGCAAAGGG - Intronic
1106735351 13:32583510-32583532 ATGTTATGTTACATGGCAAAGGG + Intergenic
1107148575 13:37086403-37086425 ATGTGTCCTCACAGGGAAAAAGG + Intergenic
1107323646 13:39216211-39216233 ATGTTATGTTACATGGCAACAGG - Intergenic
1107366273 13:39680943-39680965 ATGTTACCTTACATGGCAAAAGG - Intronic
1107639958 13:42431826-42431848 ATGTTACCTTACATTGCAAAAGG + Intergenic
1107710730 13:43147905-43147927 ATGTCACCTTACATGGAAAGAGG - Intergenic
1108033050 13:46256929-46256951 ATGTTATATTACATGGCAAAGGG + Intronic
1108036612 13:46296784-46296806 ATGTTATGTCACATGGCAATGGG - Intergenic
1108067247 13:46590768-46590790 ATGTTTTCTCAAATGGTGAATGG + Intronic
1108473532 13:50790739-50790761 CTATTGTCTCACCTGGAAAATGG - Intronic
1108477046 13:50830757-50830779 ATGTTACCCCACATGGCACAGGG + Intronic
1108510453 13:51151164-51151186 ATGTTACACCACATGGTAAAGGG + Intergenic
1108531213 13:51328932-51328954 TTCTTATCTCATAGGGAAAAAGG + Intergenic
1108617822 13:52151690-52151712 ATGTGTTCTCAGATGGAAAACGG - Intronic
1108681101 13:52781091-52781113 AGGTCGTCTCACCTGGAAAAAGG + Intergenic
1108697372 13:52914247-52914269 ATATTACCTTACATGGCAAAAGG + Intergenic
1109178307 13:59182536-59182558 ATGTTGTCTCACTTGAAAAAAGG + Intergenic
1109394271 13:61734685-61734707 TTGTGTTCTCACATGGCAAAAGG - Intergenic
1109411983 13:61982285-61982307 ATGTTATGTTACAGGCAAAATGG + Intergenic
1109494559 13:63151042-63151064 ATGTTAGGCTACATGGAAAAGGG + Intergenic
1110005474 13:70261164-70261186 ATGATTATTCACATGGAAAATGG - Intergenic
1110013588 13:70370465-70370487 ATGTTTTCTTTCATGGTAAATGG + Intergenic
1110131591 13:72018202-72018224 ATGCTACCTTACATGGAAAAAGG + Intergenic
1110165370 13:72436022-72436044 TTGTTATCCCACATCTAAAATGG + Intergenic
1110394091 13:75009865-75009887 CTGTTACCTTACTTGGAAAAGGG + Intergenic
1110471718 13:75867015-75867037 ATGTTACATCATATGGCAAAGGG - Intergenic
1110533616 13:76626004-76626026 ATGTTATCTTACATTGTCAAAGG - Intergenic
1110540484 13:76701693-76701715 GTGTTATCTTACATGGCAACAGG - Intergenic
1110574475 13:77039979-77040001 ATGTTGCCTTACATGGCAAATGG - Intergenic
1110593607 13:77293548-77293570 ATATTACCTTACATGGCAAAAGG + Intronic
1110614552 13:77526932-77526954 ATGTTATCTTACATGTTAAAAGG + Intergenic
1110652358 13:77956950-77956972 ATGTTTTCTTACATGGCTAAAGG - Intergenic
1110827585 13:79990614-79990636 ATGTTACATTACATGGAAACAGG + Intergenic
1110838282 13:80110210-80110232 ATGTTACCTTATGTGGAAAAGGG + Intergenic
1110873698 13:80483376-80483398 ATGTTATGTAACAGGGAAGACGG - Intergenic
1110996573 13:82117611-82117633 ATGTTACTTTACATGAAAAAAGG + Intergenic
1110997200 13:82126217-82126239 ATGTTATCTTACATGACAAAAGG + Intergenic
1111005883 13:82248246-82248268 ATGTTAACTCACATGACACAAGG - Intergenic
1111306905 13:86426477-86426499 ATGTTACCTTACATGGAAAAAGG + Intergenic
1111598478 13:90441498-90441520 ATGTTATGGTACATGGAAGAGGG + Intergenic
1111729561 13:92056405-92056427 ATGTTACCTCACATGGCAAAAGG - Intronic
1111948866 13:94693842-94693864 ATGTTATAGCATATGGCAAAAGG + Intergenic
1111978278 13:94990410-94990432 ATGTTACCTTATCTGGAAAAAGG - Intergenic
1112143600 13:96673310-96673332 ATGTTATCTTAATTGGGAAAAGG - Intronic
1112191787 13:97185429-97185451 ATGTTACCTTACATGGAAAAAGG + Intergenic
1112669592 13:101619260-101619282 ATGTTAGATTACATGGCAAAAGG + Intronic
1112715587 13:102181284-102181306 ATGTTACCTGACATGGTAAAAGG + Intronic
1112740408 13:102466835-102466857 ATGTTAGCTCAACTGGAAATGGG - Intergenic
1112797923 13:103077556-103077578 ATATTATCTCAAATGAAAAAAGG + Intergenic
1112805341 13:103158762-103158784 AGGTTATCTAAGATGGGAAAGGG + Intergenic
1112838521 13:103546833-103546855 AAGTTATGTTACATGGCAAAGGG + Intergenic
1113407900 13:110058614-110058636 ATATTTGCTGACATGGAAAATGG + Intergenic
1113501189 13:110775719-110775741 CTGTGACCTCACATGGCAAAAGG - Intergenic
1113833251 13:113313446-113313468 ATGTGATTCCAAATGGAAAAAGG + Intronic
1114662586 14:24357220-24357242 ATGTTATCTTACATGGCAAAAGG - Intergenic
1114880596 14:26780672-26780694 ATGTTTTCTTACATGGCTAAAGG - Intergenic
1115468588 14:33744292-33744314 TTGTTATGTCACAGGGAATAAGG + Intronic
1115495687 14:34002203-34002225 ATGTTAGGTTACATGGCAAAGGG + Intronic
1115570050 14:34657868-34657890 ATGTTACCTTACATGGCAAAAGG + Intergenic
1115901099 14:38149036-38149058 ATGTTACCTTACATGGCAAAAGG + Intergenic
1116179182 14:41514158-41514180 ATGTTATCTTACATGGCAAAAGG + Intergenic
1116221386 14:42092603-42092625 ATGTTGCCTTACATGGCAAAAGG - Intergenic
1116297583 14:43133188-43133210 GTGTTACCTCAGGTGGAAAAGGG + Intergenic
1116298693 14:43147309-43147331 ATGTTATTTTACATGGTGAAAGG + Intergenic
1116715518 14:48420650-48420672 ATGTTATATTACATGGCAAAGGG - Intergenic
1116778672 14:49211829-49211851 ATGTTACCTTACATGGCAAAAGG - Intergenic
1117291774 14:54341527-54341549 ATATTACCTTACATGGCAAAAGG + Intergenic
1117319687 14:54609077-54609099 ATGTTATGTTACATGGAGTAGGG + Intronic
1117484872 14:56185970-56185992 ATATTACCTTACATGGCAAAAGG + Intronic
1117656987 14:57965468-57965490 ATGTGATCTTACATGTAAAGGGG - Intronic
1117748333 14:58894246-58894268 ATGTTACCTAACATGACAAAAGG + Intergenic
1117750502 14:58917707-58917729 ATGTGATCTCACATGGGAATTGG + Intergenic
1117795856 14:59393876-59393898 ATGTTATTTTATATGGCAAAAGG - Intergenic
1117873557 14:60225722-60225744 ATGTTACCTTATATGGCAAAAGG - Intergenic
1118009253 14:61592587-61592609 ATGTTACCTTACATGGCAAAAGG - Intronic
1118236295 14:64008303-64008325 ATGTTACCTCACAAGGCAAAAGG - Intronic
1118451144 14:65903545-65903567 ATGTTACCTTACATGGCAAAGGG + Intergenic
1119148445 14:72337000-72337022 ATGTGATCTCATTTGGAAATAGG - Intronic
1119149288 14:72343510-72343532 ATGTGACTTCACATGGCAAAAGG - Intronic
1119158803 14:72435895-72435917 ATGATACCTTACATGGCAAAAGG - Intronic
1119201970 14:72760488-72760510 ATGTTACCTTACATGGCAAAAGG - Intronic
1119406108 14:74400804-74400826 GTGTTTTCTCATCTGGAAAACGG - Intergenic
1119505670 14:75171030-75171052 GTGTTATCTTACATGGCAAAAGG + Intronic
1119679295 14:76579949-76579971 ATGTTATGTTATATGAAAAAAGG - Intergenic
1119689618 14:76661374-76661396 ATGTTATCTCATAAAGAAAAGGG - Intergenic
1119726412 14:76924377-76924399 GTGTTATGTCACAGGGATAATGG + Intergenic
1120063753 14:80015501-80015523 ATGTTACCTTATATGGCAAAAGG - Intergenic
1120090299 14:80324164-80324186 ATGTTACCTTACAAGGCAAAGGG + Intronic
1120125389 14:80735990-80736012 ATGTTACCTTACATGGCAAAAGG - Intronic
1120150277 14:81024590-81024612 TTTTTATCTCATATTGAAAATGG - Intronic
1120249976 14:82051430-82051452 ATGTGATCTTATCTGGAAAAGGG - Intergenic
1120357976 14:83458642-83458664 ATGTCATCTCAGATGGAGATGGG + Intergenic
1120413719 14:84193365-84193387 AGGTGATCTCAAATGGAGAAGGG + Intergenic
1120720475 14:87885063-87885085 ATGTTGCCTCAAATGGCAAAAGG + Intronic
1120741368 14:88112177-88112199 ATGTTACATTACATGGTAAAGGG - Intergenic
1120758400 14:88265213-88265235 ATGTTATCTTACATGGCAAAAGG + Intronic
1120838470 14:89062200-89062222 ATACCATCTCACATGAAAAAAGG + Intergenic
1121047758 14:90800402-90800424 ATGTTGTTTTACATGGCAAAAGG + Intronic
1121251723 14:92504772-92504794 ATGTTTTCTTACATGGCAGAAGG + Intergenic
1121290807 14:92773446-92773468 ATGTTACCTTATATGCAAAAGGG - Intergenic
1121298173 14:92847158-92847180 ATGTCATCTTACAAGGCAAAGGG + Intergenic
1121424146 14:93836267-93836289 ATGTTCTCTCACCTGGAATCTGG - Intergenic
1121476586 14:94213498-94213520 ATGTTACCTTATTTGGAAAAGGG + Intronic
1121660431 14:95631298-95631320 ATATTAGCTCGCATGGCAAAGGG + Intergenic
1121846821 14:97179515-97179537 ATGTTACCTTAGATGGCAAAGGG - Intergenic
1121979403 14:98441549-98441571 CTGTTTTCTCACATGGCAGAAGG + Intergenic
1122120381 14:99550165-99550187 ATGCTATCTGACCTGGCAAATGG + Intronic
1122373153 14:101240434-101240456 ATGTCACCTTACATGGCAAAAGG + Intergenic
1123628482 15:22244359-22244381 ATGTGACCTCACATGGTAAAAGG + Intergenic
1124636522 15:31368130-31368152 ATGTGATCTTATCTGGAAAAAGG - Intronic
1124642788 15:31407001-31407023 ATGTTATCTCACATGGAAAAAGG - Intronic
1124857279 15:33401629-33401651 GTGTGATGTCATATGGAAAAAGG + Intronic
1125446198 15:39759925-39759947 ATGTTACCTTATTTGGAAAAAGG - Intronic
1125453451 15:39833025-39833047 ATGTTAAGTCTCATGGTAAATGG - Intronic
1126117394 15:45221023-45221045 ATGGCATCTAGCATGGAAAATGG + Intergenic
1126260809 15:46688490-46688512 ATGTTACCTTTCATGGCAAAAGG - Intergenic
1126405272 15:48316636-48316658 ATTTTACCTTACATGGAAAAAGG + Intergenic
1126497303 15:49306226-49306248 ATGCTATCTGGCATGTAAAATGG - Intronic
1126532059 15:49721474-49721496 ATGTTACCCTACATGGAAAAGGG + Intergenic
1126589014 15:50320608-50320630 ATGCTACCTTACATGGCAAAAGG + Intronic
1126974748 15:54163077-54163099 ATGTTACCTTACGTGGCAAAAGG + Intronic
1127299314 15:57637175-57637197 GTGTTATCTTACATGGAGAAAGG - Intronic
1127392224 15:58515225-58515247 ATGTTACCTTATATGGAAAAGGG - Intronic
1127395368 15:58540424-58540446 CAGTTTTCTCACCTGGAAAATGG - Intronic
1127686753 15:61353304-61353326 ATGTGTTCTCACATGGCAAAGGG - Intergenic
1127753218 15:62066742-62066764 CTGTTTCCTCACATGCAAAATGG - Intergenic
1127796537 15:62443132-62443154 ATGGTATCTTACATGGCAAAAGG - Intronic
1127833147 15:62768512-62768534 ATGTGATCTCATGTGGAAAAAGG - Intronic
1127992565 15:64131635-64131657 CTCTGATCTCACAAGGAAAAGGG - Intronic
1128625755 15:69201217-69201239 AAGTTACCTTACATGGCAAAAGG - Intronic
1128692679 15:69737184-69737206 ATGTTACCTTACATGGCAAGAGG + Intergenic
1129062112 15:72868459-72868481 ATGTTATGTTACATGGCAAAAGG - Intergenic
1129110232 15:73332877-73332899 ATGTTTTCTCATCTGGAAAATGG + Intronic
1129128548 15:73468115-73468137 ATGTTATCTTACATAGCAAAGGG - Intronic
1129505405 15:76077493-76077515 ATGTTACCTTATCTGGAAAAGGG + Intronic
1130426972 15:83811160-83811182 ATGTTATCTTACATGGCAAAAGG - Intronic
1130803954 15:87298870-87298892 TTGTTTTCTCCCATTGAAAATGG + Intergenic
1130838763 15:87677815-87677837 ATGTTACCTCACATGAAAGTAGG - Intergenic
1131297841 15:91167699-91167721 ATGTTACCTTGCATGGTAAAAGG - Intronic
1131421358 15:92308206-92308228 ATGTTATATTATATGGCAAAAGG + Intergenic
1131613937 15:93993883-93993905 ATGTTATCTCATCTGCAAGAAGG + Intergenic
1131640619 15:94288673-94288695 ATGTTAACTCACATGGGAAAAGG + Intronic
1131737176 15:95346236-95346258 GTGTTATGTTACATGGCAAAAGG + Intergenic
1131997457 15:98145976-98145998 ACGTTACCTTACATGGCAAAAGG + Intergenic
1132155044 15:99489695-99489717 ATGTTACCCCACATGGCAAAAGG - Intergenic
1132239086 15:100243917-100243939 CTGTTTTCTCATCTGGAAAATGG - Intronic
1132248006 15:100312126-100312148 ATGTGAACTTACATGGTAAACGG + Intronic
1132345703 15:101107497-101107519 ATGTGATCTCGGTTGGAAAAAGG - Intergenic
1133221886 16:4322440-4322462 AGGTTTCCCCACATGGAAAATGG + Intronic
1133481282 16:6173155-6173177 ATGTTACCGTACATGGCAAAGGG - Intronic
1133485653 16:6215786-6215808 CTGTTTTCTTACATGGAGAAAGG + Intronic
1133699619 16:8296786-8296808 ATGTTGTCTCACGTTTAAAAAGG + Intergenic
1133702577 16:8322844-8322866 ATGTTTCCTCACCTAGAAAATGG + Intergenic
1133782772 16:8952666-8952688 ATGTTACGTTACATGGCAAAGGG - Intronic
1133904093 16:10004831-10004853 ATGTTACCTTACATGACAAAAGG - Intronic
1133904825 16:10012598-10012620 ATGTTACCTTACATGGCAAAAGG + Intronic
1134020594 16:10918711-10918733 CTGTTTTCTTACCTGGAAAATGG + Intronic
1134284229 16:12846227-12846249 ATGTTATGACACATGGCAAAGGG - Intergenic
1134306903 16:13041237-13041259 ATGTTTTCTCTCTGGGAAAATGG + Intronic
1134362803 16:13547623-13547645 ATGCTAACTCACATTGATAAGGG + Intergenic
1134371827 16:13633124-13633146 ATGTTACCTCACTTGGCAAAAGG + Intergenic
1134742206 16:16557929-16557951 ATGTTAAGTGACATGGCAAAGGG + Intergenic
1134811994 16:17175622-17175644 CTGTCCTCTCTCATGGAAAATGG + Intronic
1134864088 16:17589502-17589524 CTGTTCTCTTATATGGAAAAGGG + Intergenic
1134925356 16:18154527-18154549 ATGTTAAGTGACATGGCAAAGGG - Intergenic
1135402656 16:22176986-22177008 TGGTTTCCTCACATGGAAAATGG - Intronic
1135408263 16:22213936-22213958 ATGTTACCTTATATGGCAAAAGG - Intronic
1135504501 16:23024715-23024737 ATGTTTTCTCACCTGATAAATGG + Intergenic
1135927325 16:26707025-26707047 CAGTTATCTCATCTGGAAAATGG - Intergenic
1136137729 16:28267487-28267509 ATGTTACCTTCCATGGCAAAAGG - Intergenic
1136231516 16:28888340-28888362 ATGTTACCTTACTTGGAAAAGGG - Intronic
1136292061 16:29280315-29280337 ATGGCAACTCACTTGGAAAAGGG - Intergenic
1137505156 16:49048298-49048320 ATGTGATCTCATTTGGAAATAGG + Intergenic
1137535720 16:49323352-49323374 CTGTTTTCTCACGTGTAAAAGGG + Intergenic
1137733822 16:50709727-50709749 ATGTTACCTTACGTGGCAAAAGG - Intronic
1137882286 16:52062584-52062606 ATGTTATCTTACATGGCAAAGGG - Intronic
1138210425 16:55158511-55158533 ATGTTACCTCACATGGCAAAGGG - Intergenic
1138409963 16:56831463-56831485 AGGTGATCTCACATGAATAAGGG + Intronic
1138778885 16:59758458-59758480 ATGTTACCACACATGATAAAAGG - Intergenic
1138843980 16:60542783-60542805 ATGTTATGTTACATGGCAAAGGG + Intergenic
1139044188 16:63036402-63036424 ATGTGATCTCATCTGTAAAATGG + Intergenic
1139353475 16:66352748-66352770 ATGTTATGCCACATGGCAAATGG - Intergenic
1140231328 16:73119592-73119614 CTGTTGGCTCACATGGAACATGG - Intergenic
1140565028 16:76031774-76031796 ATGTTAAATTACATGGCAAAGGG + Intergenic
1140631117 16:76853876-76853898 ATATTATGTTACATGAAAAAAGG + Intergenic
1140632079 16:76865179-76865201 ATGTTACCTTACATGGCAAAAGG - Intergenic
1140642368 16:76991100-76991122 GTGTTACCTTACATGGCAAAAGG - Intergenic
1140700532 16:77577359-77577381 GTGTTACCTTACATGGAAAAAGG - Intergenic
1140708728 16:77656547-77656569 ATGTTATCTTACATGGCAAAGGG - Intergenic
1140735613 16:77895359-77895381 ATGTTACCTCATATGGCAAAAGG + Intronic
1140743923 16:77964598-77964620 TTGTTACCTGACATGGCAAAGGG - Intronic
1141066159 16:80915754-80915776 GTGTTACCTTACATGGTAAAAGG - Intergenic
1141083392 16:81073536-81073558 ATGTTATATTACATGGTAAAAGG + Intronic
1141222062 16:82080263-82080285 CTGTTACCTCACGTGGCAAATGG + Intronic
1141244607 16:82294220-82294242 ATGTTACCTTACATGGCAAATGG + Intergenic
1141304385 16:82847630-82847652 ATGTTAGATTACATGGCAAAGGG - Intronic
1141372672 16:83502154-83502176 ATGTTACCTTACAGGGCAAATGG + Intronic
1141416252 16:83877631-83877653 ATGACACCTGACATGGAAAAAGG - Intergenic
1141444111 16:84047202-84047224 ATGTTACCCCACATGGCAAAAGG + Intergenic
1141588530 16:85051404-85051426 ATGTTATCTCAGAAGAGAAATGG + Intronic
1142097951 16:88254268-88254290 ATGGCAACTCACTTGGAAAAGGG - Intergenic
1142436212 16:90059435-90059457 ATTTTCTCTCACTTGGAAACTGG + Intronic
1143169505 17:4919613-4919635 ATGTTACCTTATTTGGAAAAAGG + Intergenic
1143250107 17:5517192-5517214 ATGTTCTCTCCCATGCACAATGG - Intronic
1143545019 17:7590563-7590585 AAGTTTTCTCACTTGGGAAAGGG - Intronic
1143674400 17:8421303-8421325 ATGTTACCTTATATGGCAAAAGG + Intronic
1143812483 17:9483460-9483482 ATGTTACCTTAAATGGCAAAAGG - Intronic
1143814009 17:9496621-9496643 ATGTTCCCTTACATGGCAAAAGG + Intronic
1143891638 17:10106827-10106849 ATGTTACCTTATATGGCAAAAGG + Intronic
1144360997 17:14492671-14492693 CTGTGATTTCACATGGCAAAAGG + Intergenic
1144583095 17:16471054-16471076 ATGTGACCTCATTTGGAAAAAGG + Intronic
1144602866 17:16633912-16633934 ATGATATCTCATTTGGAGAATGG - Exonic
1144824086 17:18095784-18095806 ATGTTAACTGCCAGGGAAAATGG - Intronic
1144832398 17:18139103-18139125 CAGTTCTCTCACTTGGAAAATGG + Intronic
1144845342 17:18215001-18215023 ATGTCACCTCATAAGGAAAAAGG - Intergenic
1145222709 17:21102599-21102621 ATGTTTTCTCACAGGGTAAAAGG + Intergenic
1146406126 17:32539746-32539768 ATATTATCTTATTTGGAAAAAGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1147307111 17:39571769-39571791 ATGTTACCTTAACTGGAAAATGG - Intergenic
1147496606 17:40922381-40922403 ATGCTATCTCACTTTTAAAAAGG - Intergenic
1148227957 17:45912293-45912315 ATGTGATCTTATTTGGAAAAGGG + Intronic
1149018203 17:51933195-51933217 ATGCTATCTTAGATGGTAAAGGG + Intronic
1149020016 17:51952334-51952356 ATATAACCTCACTTGGAAAAAGG - Intronic
1149028750 17:52060901-52060923 TTGTTTTCTCATCTGGAAAAAGG + Intronic
1149040644 17:52184470-52184492 AAGTTACCTTACATGGTAAAAGG + Intergenic
1149049021 17:52283006-52283028 ATGTTATTTCACCTGTAAAATGG - Intergenic
1149060471 17:52415379-52415401 CTGTCATCTCCTATGGAAAAAGG - Intergenic
1149063322 17:52450355-52450377 ATGTTACTTTACATGGTAAAAGG - Intergenic
1149093275 17:52810108-52810130 ATCTTATTTCACTTGGGAAAGGG + Intergenic
1149116612 17:53104933-53104955 GTGTTACCTTACATGGCAAAAGG + Intergenic
1149145367 17:53484847-53484869 ATGTCATTTCACATGTAAAGGGG + Intergenic
1149191233 17:54065515-54065537 ATGTTTTATAACTTGGAAAATGG + Intergenic
1149224275 17:54450689-54450711 GTGTTCTCTAACATGTAAAATGG + Intergenic
1149447367 17:56724063-56724085 CTGTAAAGTCACATGGAAAAAGG + Intergenic
1150097607 17:62391530-62391552 ATGCTATCTTACATGGCAAAAGG - Intronic
1150170891 17:62993189-62993211 ATGTTACCTTACATGGCAAAGGG - Intergenic
1150582156 17:66483858-66483880 ATGTGATCTGACTTGGAAAAAGG - Intronic
1150836503 17:68568842-68568864 ATGTTACCTTATATGGAAAAAGG - Intronic
1150850474 17:68699238-68699260 TAGTTATCTCACAAGGAAACAGG - Intergenic
1151105130 17:71604456-71604478 GTGTTATCTTACATGAAAAAAGG + Intergenic
1152028193 17:77825252-77825274 ATGCTGTGTCACACGGAAAACGG + Intergenic
1152211812 17:79006422-79006444 ATGTTACATTACATGGCAAAGGG - Intronic
1152373532 17:79905586-79905608 ATGTCACCTTACATGGCAAAGGG - Intergenic
1152607449 17:81299875-81299897 ATGTGACCTCACTTGGCAAAAGG - Intergenic
1153066761 18:1054036-1054058 ATATTACCTTACATGGCAAAAGG - Intergenic
1153553433 18:6285423-6285445 TTGAAATCTCACATGGAAATCGG - Intronic
1153711433 18:7803496-7803518 ATGTTAAATTACATGGAAAGAGG - Intronic
1153872110 18:9331065-9331087 ATGTTGTCTTATATGGCAAAAGG + Intergenic
1153933831 18:9902846-9902868 ATGTTACTTCATTTGGAAAAGGG + Intergenic
1154088078 18:11326956-11326978 ATGTTACCTTACATGGCACAGGG + Intergenic
1154151638 18:11910743-11910765 AAGTTACCTGACATGGCAAAAGG + Intergenic
1155236365 18:23823488-23823510 ATGTTATGTCCCATGGTAACTGG + Intronic
1155254135 18:23979808-23979830 ATGTTATCTTTTATGGTAAAGGG + Intergenic
1155369980 18:25088634-25088656 ATGTTACTTCACCTTGAAAATGG - Intronic
1155504735 18:26522158-26522180 ATGTGACCTCACTTGGAAATAGG + Intronic
1155517407 18:26637372-26637394 ATGTTCTCTCAAATGGCAAGAGG + Intronic
1155575268 18:27238829-27238851 ATGTTATCGTACATGACAAAAGG - Intergenic
1155624367 18:27817353-27817375 CTGTTTTCTCACCTGTAAAACGG + Intergenic
1156235648 18:35201578-35201600 ATTTTATCTGGCATGGAATATGG - Intergenic
1156259036 18:35427466-35427488 ATGTCATGTTACATGGCAAAAGG + Intergenic
1156515090 18:37672475-37672497 CTGTTTTCTCACCTGTAAAATGG + Intergenic
1156583615 18:38408336-38408358 ATGTTACCTTATTTGGAAAAAGG - Intergenic
1156742145 18:40344130-40344152 ATGTAATCTCACACTGAACATGG - Intergenic
1156757975 18:40551616-40551638 ATGTTACATTACATGGCAAAGGG - Intergenic
1156758047 18:40552549-40552571 ATGTTATATTATATAGAAAAAGG + Intergenic
1156773570 18:40759992-40760014 ATGTTTTCTCAGAGGTAAAATGG - Intergenic
1156890613 18:42185940-42185962 ATGTCAAATCACATGGGAAATGG + Intergenic
1157110777 18:44818238-44818260 ATGTTTTTTCACATGCAGAAAGG + Intronic
1157139861 18:45094910-45094932 ATGTCATGTTACATGGCAAAAGG - Intergenic
1157211181 18:45743300-45743322 ATGTGACCTCACATGGCAAAAGG - Intronic
1157434820 18:47659514-47659536 ATGTTACCTTATATGGCAAAAGG + Intergenic
1157659685 18:49429303-49429325 ATGTTACATTACATGGCAAAGGG - Intronic
1157876379 18:51277632-51277654 AAGTTATGTCATATTGAAAAGGG + Intergenic
1157900785 18:51514702-51514724 ATGTTAAGTTACATGGCAAAAGG + Intergenic
1158578879 18:58663912-58663934 ATGTTATTTCGAATGGAAAATGG - Intergenic
1158590467 18:58774673-58774695 ATGTTACCTTATATGGCAAAAGG + Intergenic
1158628380 18:59091092-59091114 GTGTCATCTCACATAGCAAAGGG - Intergenic
1158839435 18:61368218-61368240 ATGTTATGTCATATGGCAAAGGG - Intronic
1158868252 18:61658948-61658970 ATATTACCTTACATGGAAAAAGG + Intergenic
1158968180 18:62642114-62642136 ATGTTACCTTACATGGCAAAAGG + Intergenic
1159237948 18:65701725-65701747 ATGTTATGTTACTTGGAAAAAGG - Intergenic
1159275167 18:66209916-66209938 ATATTATCTTACATGGTAAATGG - Intergenic
1159625008 18:70682414-70682436 ATGTTACCATACATGGCAAAAGG + Intergenic
1159645820 18:70916744-70916766 CTGTTCTCTCCCATGGAAAGAGG - Intergenic
1159655002 18:71022710-71022732 ATGTTAACTTACATGGATAGGGG - Intergenic
1159671242 18:71223314-71223336 ATGTTAGATCACATGAGAAAAGG - Intergenic
1159674380 18:71263372-71263394 ATGTTAGCCTACATGGGAAAGGG + Intergenic
1159790150 18:72768536-72768558 ATGTTACTTTATATGGAAAAAGG + Intronic
1159796292 18:72848170-72848192 ATGTTATGTTACATGGCAAAAGG - Intronic
1159876257 18:73814555-73814577 ATGTTATCTAAAATGCAAATAGG - Intergenic
1160139428 18:76307812-76307834 GTGTTACCTTACATGGCAAAAGG - Intergenic
1161124383 19:2547586-2547608 GTGTCACCACACATGGAAAAAGG - Intronic
1161458614 19:4382664-4382686 CTGTTCCCTTACATGGAAAATGG - Intronic
1161761966 19:6180212-6180234 ATGTAATCTTTCATGGCAAAAGG - Intronic
1161786712 19:6331021-6331043 CTGTTTTATCACCTGGAAAATGG + Intronic
1161815835 19:6499412-6499434 CTGTTTTCTCACCTGTAAAATGG + Intronic
1161848778 19:6727886-6727908 ATGTTCTGTCACACGGCAAAAGG - Intronic
1162852647 19:13442637-13442659 CAGTTTTCTCACCTGGAAAAAGG - Intronic
1163111773 19:15165677-15165699 ATTTTTTCTCATTTGGAAAATGG - Intronic
1163134656 19:15301206-15301228 ATGTCATATTAAATGGAAAATGG - Intronic
1163481111 19:17556607-17556629 CAGTTTTCTCAAATGGAAAATGG + Intronic
1163730058 19:18943750-18943772 CAGTTTTCTCACCTGGAAAATGG + Intergenic
1163751936 19:19083355-19083377 ATGTGATCTTACATGACAAAAGG - Intronic
1163920289 19:20282376-20282398 ATTTGATGTCACATGGAAACAGG + Intergenic
1164370686 19:27641362-27641384 ATTTGATGTCACATGGAAACAGG - Intergenic
1164670518 19:30069757-30069779 ATGTGACCTCACTTGGAAATAGG + Intergenic
1164903958 19:31951717-31951739 CTGTTAACTCACATGACAAAAGG + Intergenic
1165275083 19:34743317-34743339 ATGTTATCTGACAAGAAAGATGG + Exonic
1165397643 19:35575206-35575228 ATTTGATGTCACATGGAAACAGG - Intergenic
1166019383 19:40011911-40011933 ATGTGACCTAATATGGAAAAAGG - Intronic
1166413663 19:42576024-42576046 AAGTCATCTCCCATGGAAAAGGG - Intergenic
1166479760 19:43161268-43161290 AAGTCATGTCCCATGGAAAAGGG - Intronic
1166830387 19:45635924-45635946 ATGTGACCTTACAAGGAAAATGG + Intronic
1167215131 19:48159512-48159534 ATGTTAGGTTACATGGCAAAGGG + Intronic
1167514504 19:49915219-49915241 ATGTGACCTTACATGGCAAAGGG + Intronic
1167533533 19:50033946-50033968 ATATTATCTTACATGGCGAAAGG - Intronic
1167857456 19:52254179-52254201 ATGTTATGTTACATGGTAAAAGG + Intergenic
1168012068 19:53541013-53541035 ATATTACCTTACATGGCAAAGGG - Intronic
1168345227 19:55647566-55647588 CTGTTAACTCACCTGCAAAATGG - Intronic
1168365893 19:55787041-55787063 AATTTTTCTCAAATGGAAAATGG - Intronic
925168643 2:1736858-1736880 TTGTTATCTCATGTGGACAAAGG + Intronic
925325703 2:3020318-3020340 ATGTGACCTGATATGGAAAAAGG + Intergenic
925768754 2:7262438-7262460 AAGTTACCTTACCTGGAAAAAGG - Intergenic
925843068 2:8010342-8010364 ATGTGATCTCATATGGTAGAAGG + Intergenic
925869478 2:8256597-8256619 ATGTGATATCAGCTGGAAAAAGG - Intergenic
926209736 2:10861191-10861213 CTGTTTTCTCACCTGTAAAATGG - Intergenic
926273129 2:11382732-11382754 GTTTTACCTTACATGGAAAAAGG - Intergenic
926396445 2:12447386-12447408 ATGTGTCCTCACATGGCAAAAGG - Intergenic
926447842 2:12966045-12966067 AAGATATATCACCTGGAAAAGGG - Intergenic
926463074 2:13157773-13157795 ATGTTACATCACAAGGCAAAGGG - Intergenic
926544621 2:14224428-14224450 CTGTTATCTGACCTGTAAAATGG + Intergenic
926574403 2:14564232-14564254 ATGTTATCTTACACGGCAAAGGG + Intergenic
926656109 2:15408121-15408143 ATGTTACCTTACCTGGCAAAAGG - Intronic
926888421 2:17618536-17618558 ATGTTACCTTACATGGCAAAAGG - Intronic
926935048 2:18078535-18078557 ATGTTACCTTACGTGGCAAAAGG - Intronic
926962798 2:18377120-18377142 TTGTTAGCCCACATGGCAAAAGG - Intergenic
926966833 2:18424244-18424266 CTGTTTTCTCACATGTAAGATGG + Intergenic
926996303 2:18739697-18739719 CTATAATCTCACATGGAAGAAGG - Intergenic
927161682 2:20268967-20268989 CTGTTGTCTCACAAGTAAAATGG - Intronic
927236182 2:20877083-20877105 CTTTTATTTTACATGGAAAATGG + Intergenic
927430551 2:23023221-23023243 ATCTTATCTCCCAGGGAAGATGG - Intergenic
927470591 2:23373091-23373113 ATGTTACCTTATATGGCAAAAGG + Intergenic
927710317 2:25321515-25321537 ATGTCACCTTACATGGCAAAAGG - Intronic
927922786 2:26986319-26986341 ATGTCATCTTAAATGGCAAAAGG - Intronic
928318451 2:30264216-30264238 ATGTAATGTTACATGGCAAAGGG + Intronic
928340595 2:30439913-30439935 ATGTTACCTTACATGGCAAAAGG + Intergenic
928364895 2:30692802-30692824 TGGTTTTCTCACATGGCAAAGGG + Intergenic
928646782 2:33362624-33362646 AAGTTAACACAGATGGAAAATGG - Intronic
928650748 2:33401181-33401203 ATGTTACCTTCCATGGCAAAGGG + Intergenic
928728444 2:34203176-34203198 AAGTTATTTGACATGGAACATGG - Intergenic
928777354 2:34781516-34781538 ATGTTACCTTACATGGCCAATGG + Intergenic
929010715 2:37441344-37441366 ATATTGAGTCACATGGAAAATGG + Intergenic
929012410 2:37458088-37458110 ATGTCATTACACATGGAGAAAGG - Intergenic
929102867 2:38333623-38333645 ATGTTCTCTCAAATCCAAAATGG + Intronic
929103972 2:38345838-38345860 CTGTTTTCTCATCTGGAAAATGG + Intronic
930010156 2:46931389-46931411 ATGTTATTTTACATGCAAAAAGG + Intronic
930035373 2:47082041-47082063 ATGTTACCTTACAGGGTAAAAGG + Intronic
930510829 2:52342877-52342899 ATGATATGTCCCATGGAACATGG + Intergenic
930560718 2:52957011-52957033 TTGTTATATTACATGGCAAAAGG + Intergenic
930673468 2:54175979-54176001 ATGTATCCTCACATGGTAAAGGG - Intronic
930748683 2:54911318-54911340 ATGACATGTCAAATGGAAAAAGG - Intronic
930851157 2:55961927-55961949 TAGTTTTCTCACATGTAAAATGG + Intergenic
930936142 2:56954360-56954382 ATGTTATGTTACATGGCAAAAGG - Intergenic
930948328 2:57105091-57105113 ATGTTATATTACATGGCAAAGGG + Intergenic
930970582 2:57390333-57390355 ATGTTATTTAGCATGGAAATGGG + Intergenic
931003497 2:57819410-57819432 ATCATATCTTACATGGCAAAAGG + Intergenic
931016252 2:57983427-57983449 ATGTTATCTTACATAAAAAAAGG - Intronic
931220292 2:60283303-60283325 TTGTTTCCTCACCTGGAAAATGG + Intergenic
931375588 2:61704886-61704908 ATGTTACCTTACATGGCAAAAGG - Intergenic
931451523 2:62370977-62370999 ATGTTACCTTACATGGCAAAGGG + Intergenic
931456829 2:62416514-62416536 ATGCTAGCTTACATGGCAAAAGG + Intergenic
931627649 2:64271275-64271297 TTGTAATCTCACATGGTGAAAGG - Intergenic
931708335 2:64966508-64966530 ATGTTAGCTCATATGACAAATGG - Intergenic
931827875 2:66020043-66020065 ATGTGATCTCATTTGGAAAAAGG - Intergenic
931831453 2:66055920-66055942 CTGTGTTCTCACATGGAAGAAGG - Intergenic
931940395 2:67245781-67245803 ATGTTCTCTCATATGGAAAAAGG + Intergenic
932010033 2:67966820-67966842 ATGTTATCTTCCCTGTAAAATGG - Intergenic
932263735 2:70348226-70348248 ATGTTATCGTACCTGGTAAAAGG - Intergenic
932281298 2:70494292-70494314 ATGCTACCTTACATGGCAAAGGG - Intronic
932283480 2:70514264-70514286 ATATTAACACACATGGAGAAAGG + Intronic
932376080 2:71237162-71237184 ATGTTAACTTACATGGTAAAAGG - Intergenic
932589001 2:73051830-73051852 TTGTTGTCTCACAGGGAAGAAGG + Intronic
932783566 2:74579560-74579582 CAGTTTTCTCATATGGAAAATGG + Intronic
933101157 2:78259464-78259486 ATGTTACCGTACATGGCAAAAGG - Intergenic
933135847 2:78734234-78734256 TTGTTACCTTACATGCAAAAAGG + Intergenic
933172553 2:79139936-79139958 ATGTTATATTACATGGAAAAAGG - Intergenic
933310845 2:80659830-80659852 ATTTTATCTCACATGGCATCAGG + Intergenic
933338137 2:80986029-80986051 ATGCTATCTGACATGGCAAAAGG - Intergenic
933393382 2:81701202-81701224 ATGTTAACTTACGTGGCAAAAGG + Intergenic
933441508 2:82320532-82320554 ATATTATATTACATGGAAAATGG - Intergenic
933463867 2:82625144-82625166 ATGTTACCATACATGGAAAATGG + Intergenic
933717968 2:85376056-85376078 ATGTTATGTAACATGGCAAAGGG - Intronic
933979960 2:87541266-87541288 ATGTTACCTTACACGGCAAAAGG - Intergenic
934032885 2:88064369-88064391 ATGTTACCTTATATGGCAAAAGG - Intergenic
934057486 2:88263841-88263863 ATGTGATCTTATGTGGAAAAAGG - Intergenic
934103034 2:88671140-88671162 ATGTTACCTTATATGGCAAAGGG + Intergenic
934881290 2:97982662-97982684 ATGTTACCTTACATGGCAAAAGG + Intronic
934926596 2:98386222-98386244 AGGTTACCTCATATGGCAAAGGG + Intronic
934960885 2:98671701-98671723 ATGTTACCTTACATGGCAAAAGG + Intronic
935332765 2:101989134-101989156 ATGTTACCTTACATGGGAAAAGG + Intergenic
935471062 2:103461522-103461544 ATATTACATTACATGGAAAAAGG - Intergenic
935494348 2:103760260-103760282 ATGTTATCTCATATATATAAAGG - Intergenic
936313861 2:111409525-111409547 ATGTTACCTTACACGGCAAAAGG + Intergenic
936809100 2:116374339-116374361 ATGCTATTTTACATGGAAATAGG - Intergenic
936823439 2:116552467-116552489 ATGTTGCCTTACATGGCAAAAGG - Intergenic
937143914 2:119626276-119626298 GTGTTATCTTCCATGGTAAAAGG - Intronic
937160287 2:119754670-119754692 ATGTTAGCTTGCATGGTAAAAGG + Intergenic
937165478 2:119811324-119811346 AAGCTATTTCACATTGAAAAAGG + Intronic
937242586 2:120471920-120471942 ATGTGACCTCACATGCCAAAAGG + Intergenic
937269999 2:120643615-120643637 ATGTCACCTTACATGGCAAAGGG - Intergenic
937330446 2:121024009-121024031 ATGTTACCTTATATGGCAAAAGG + Intergenic
937333837 2:121048375-121048397 ATGTTACCTTACATGTCAAAAGG + Intergenic
937363535 2:121245023-121245045 ATGTCACCTAACATGGCAAATGG + Intronic
937431509 2:121842595-121842617 ATGTTACTTTACATGGAAAAGGG + Intergenic
937588820 2:123589921-123589943 ATGTTAAGTCACATAGAAAATGG + Intergenic
937958159 2:127434950-127434972 ATGTGACCTCACTTGGAAATGGG + Intergenic
938052165 2:128184202-128184224 ATGGTTTCTGACATAGAAAAAGG - Intronic
938106785 2:128537059-128537081 GTGGTATCTAACATGGCAAAAGG - Intergenic
938710700 2:133974030-133974052 ATGTTATCCTGCATGGCAAAGGG - Intergenic
938722669 2:134080197-134080219 ATGTTATGTTACATGGAAGGGGG - Intergenic
938801793 2:134770640-134770662 ATGTTACCTTACATGGAAAAAGG - Intergenic
938945044 2:136204764-136204786 ATGTGTTCTCACATGGCAGAAGG + Intergenic
939229993 2:139412272-139412294 ATGTTACCTTACATGACAAAAGG + Intergenic
939509423 2:143088506-143088528 ATGTTACCTTACATGGCAAAAGG - Intergenic
939558255 2:143702943-143702965 ATGTTACCTCACATGGCAAAAGG - Intronic
939661200 2:144892088-144892110 ATGTTATGTCACTACGAAAATGG - Intergenic
939778913 2:146420029-146420051 ATGGTATCTTACATGGTATAAGG - Intergenic
939810251 2:146823177-146823199 ATGTTACCTTACATGGCAAACGG + Intergenic
939833736 2:147103128-147103150 ATGTTATATGACATGGCAAAAGG + Intergenic
940041095 2:149361789-149361811 ATGTTACCTTACATGGTAAAAGG + Intronic
940164507 2:150754691-150754713 ATGTTATATTACATGACAAAAGG + Intergenic
940281832 2:151997129-151997151 ATGTGACCTCATTTGGAAAAAGG + Intronic
940557103 2:155243167-155243189 ATGTTATCTTTAATGGTAAAAGG - Intergenic
940804140 2:158166874-158166896 ATGTTATGTTACATGGCAAAGGG + Intergenic
941079710 2:161046296-161046318 ATGTTACGTGACATGGCAAAAGG + Intergenic
941114231 2:161452929-161452951 ATGTTATCTTACATGGTAAAAGG - Intronic
941356896 2:164504757-164504779 ATGTTAAGCTACATGGAAAAAGG + Intronic
941363442 2:164581273-164581295 ATGTAATCTTACATTGTAAAAGG + Intronic
941468454 2:165856972-165856994 GTGTTAACTTACATGGCAAAAGG + Intergenic
941550909 2:166914006-166914028 ATGTTATCCAACATGTCAAAAGG + Intronic
941633454 2:167909373-167909395 ATGTTATTTTACATGGCAAAGGG - Intergenic
941811843 2:169762990-169763012 ATGTTACCTTAATTGGAAAAAGG - Intronic
941957573 2:171220158-171220180 ATGTTATCTTATATGGAAAAAGG - Intronic
942002528 2:171663037-171663059 ATGTGACCTCATTTGGAAAAAGG - Intergenic
942073102 2:172332876-172332898 ATGTGATCTTATATGGAAACAGG + Intergenic
942211856 2:173678991-173679013 TAGTTATCTCATATGGAAAATGG - Intergenic
942444489 2:176068981-176069003 ATGTTTTCTCATCTGTAAAATGG - Intergenic
942493028 2:176508974-176508996 ATGTTACCTTACATGGCAAGAGG - Intergenic
942546649 2:177071590-177071612 ATGATACCGCACATGGCAAATGG + Intergenic
943069384 2:183122885-183122907 ATGTTACCTTATATGGCAAAAGG + Intronic
943070452 2:183135172-183135194 ATGTTACATTACATGGCAAAGGG - Intronic
943179145 2:184521181-184521203 ATGTTAGGTTACATGGCAAAGGG + Intergenic
943197928 2:184779458-184779480 ATGTTAGGTTACATGGGAAAGGG + Intronic
944087406 2:195865405-195865427 ATGTTATCTATCTTAGAAAAAGG - Intronic
944156137 2:196609632-196609654 ATGTTATTTTATATGGAAAAGGG - Intergenic
944365911 2:198919379-198919401 ATGTCACCTGACATGGCAAAAGG - Intergenic
944371809 2:198993211-198993233 ATGCCATATCACATAGAAAATGG - Intergenic
944622697 2:201533332-201533354 AAGTTATTTCTTATGGAAAAAGG + Intronic
945060910 2:205908053-205908075 ATGTTACCTTATTTGGAAAAAGG - Intergenic
945222372 2:207497990-207498012 ATGTTATGTTACATGGCAAGGGG - Intergenic
945224482 2:207519509-207519531 ATGTTTTCTCTCATGGCAAAAGG - Intergenic
945230977 2:207589499-207589521 ATGTTACCTTATATGGCAAAGGG - Intronic
945807731 2:214510876-214510898 ATGTTACCTTACATGGCAAAGGG + Intronic
945817088 2:214618807-214618829 ATGTTTAATGACATGGAAAATGG - Intergenic
945821738 2:214673412-214673434 ATGTTACCTTCCATGGCAAAAGG - Intergenic
946172030 2:217901293-217901315 TTGTAATGTCACATGTAAAATGG + Intronic
946270727 2:218591101-218591123 ATGTTACCTTAAATGAAAAATGG - Intronic
946528382 2:220544290-220544312 ATGTGACCTTACATGGAAATGGG - Intergenic
946543437 2:220711121-220711143 ATGTTATCTTTCGTGGGAAATGG + Intergenic
947041884 2:225931801-225931823 ATATTATGTTACATGGAAAGGGG + Intergenic
947078138 2:226366356-226366378 ATGTGATCTTATTTGGAAAAAGG - Intergenic
947274894 2:228379478-228379500 ATGTTATGTTATATGGAAAAGGG - Intergenic
947468056 2:230371820-230371842 CTGCTATCTTACATGGCAAACGG + Intronic
947923972 2:233904900-233904922 ATGTCAAGTCACATGGAAAGGGG - Intergenic
947945080 2:234094132-234094154 ATGTGACCTCAGATGGGAAAAGG + Intergenic
947954806 2:234179475-234179497 ATGTTATGTTCCATGGCAAAAGG - Intergenic
947985413 2:234443687-234443709 ATGTTACCTTATATGGAAAATGG + Intergenic
948036968 2:234865579-234865601 ATGTTACCATACATGGCAAAGGG - Intergenic
948125279 2:235560453-235560475 ATGTTACCTCACATGGCAAAAGG + Intronic
948209356 2:236180958-236180980 ATCTTAGCTCACATGATAAAGGG - Intergenic
948243424 2:236457562-236457584 ATGGTATCATATATGGAAAAAGG + Intronic
948285887 2:236784866-236784888 ATGGTATCTCACATGGCAGAAGG - Intergenic
948371962 2:237495304-237495326 ATGTCACCTCACATAGCAAAAGG - Intronic
948435204 2:237948619-237948641 ATGTTGCCTCACAAGGCAAAAGG - Intergenic
948725519 2:239931439-239931461 ATGTGACCTCATTTGGAAAAGGG - Intronic
949037836 2:241826239-241826261 ATGTTTTCTGGCAAGGAAAAGGG - Intergenic
1168740232 20:183191-183213 ATATTGTCTCGCATAGAAAATGG + Intergenic
1169247833 20:4037851-4037873 ATATTACCTCACATGGCACAAGG - Intergenic
1169416802 20:5424138-5424160 ATGTTATCTTACTTGGCAAAAGG - Intergenic
1169448931 20:5694902-5694924 GTGTTAGATTACATGGAAAAGGG - Intergenic
1169489905 20:6062622-6062644 ATGTTATCTTATATAGTAAAAGG + Intergenic
1169756214 20:9046057-9046079 ATGTTATTTTACATGGCAAAAGG + Intergenic
1169878596 20:10323621-10323643 ATGTTACTTCACAGGAAAAATGG - Intergenic
1170017989 20:11803712-11803734 ATGTTAGGTCACATGACAAAGGG - Intergenic
1170032136 20:11954960-11954982 ATGTTACCTTAAATGGCAAAAGG + Intergenic
1170192235 20:13655767-13655789 ATGTAATTTCACATGGCAAAAGG + Intergenic
1170413924 20:16120412-16120434 ATGTTACCTTACATGGCAAAAGG - Intergenic
1170421674 20:16199660-16199682 ATGTTATGTTTCATGGCAAAAGG - Intergenic
1170594231 20:17793311-17793333 ATGTTACCTTATATGCAAAAAGG + Intergenic
1170717380 20:18843704-18843726 ATGTTACCTTCCATGGGAAAGGG - Intergenic
1171368904 20:24647711-24647733 TTTTTATCTCAAATGAAAAAGGG - Intronic
1172016117 20:31874341-31874363 ATGTTATATTACATGGCAAAGGG + Intronic
1172046335 20:32083282-32083304 ATGTTACCTTACATGGTAAAAGG - Intronic
1172049128 20:32102972-32102994 ATGTTACCTCACATGGCAAAAGG - Intergenic
1172181315 20:33005371-33005393 ATGTTAAGTCACAAGGCAAAAGG + Intergenic
1172593315 20:36132501-36132523 ATGTTACCTCACGTGGCAAAAGG - Intronic
1172774507 20:37399180-37399202 CAGTTATCTCATCTGGAAAATGG - Intronic
1172886596 20:38235371-38235393 ATGTTACCTTACATGGCAAAAGG + Intronic
1173072649 20:39784185-39784207 TTGTTACCTCAAATGGCAAAAGG + Intergenic
1173573694 20:44096173-44096195 ATGTTACCTTGCATGGCAAAAGG - Intergenic
1173676900 20:44843801-44843823 ATGTTAGGTTACATGGCAAAGGG - Intergenic
1173888420 20:46481898-46481920 GTGTTACCTTACATGGTAAAAGG + Intergenic
1173950387 20:46988354-46988376 AAGTTTTCTCATCTGGAAAATGG - Intronic
1174089255 20:48033977-48033999 ATGTTATCTTACATGACCAAAGG - Intergenic
1174267405 20:49341728-49341750 CAGTTTTCTCACATGTAAAATGG - Intergenic
1174419764 20:50391801-50391823 ATGTGACCTTACATGGCAAAGGG + Intergenic
1174517382 20:51103006-51103028 ACCATATGTCACATGGAAAAGGG + Intergenic
1174627904 20:51930454-51930476 ATGTTATATTACGTGGCAAAGGG - Intergenic
1174654256 20:52157202-52157224 ATGTTCTCTCAGCTGGACAAAGG + Intronic
1174661261 20:52215170-52215192 ATGTTACCTTACAGGGCAAAAGG + Intergenic
1174711613 20:52711993-52712015 ATGTTACCTTACATGGAAAAGGG - Intergenic
1174856488 20:54050298-54050320 ATGTGACCTTACATGGCAAAAGG - Intronic
1174911721 20:54615333-54615355 ATGTTACCTTACAAGGCAAAAGG + Intronic
1174983009 20:55418904-55418926 GTGTTATCTTCCATGGCAAAGGG + Intergenic
1175059188 20:56226377-56226399 ATGTTACCTTACATGGCAACAGG + Intergenic
1175148467 20:56914150-56914172 ATGTCACCTTACATGGCAAAAGG + Intergenic
1175201827 20:57283370-57283392 TTGTTGTCTGAGATGGAAAAGGG + Intergenic
1175209685 20:57344872-57344894 TTGTTTTCTCACCTGTAAAATGG - Intergenic
1175478724 20:59296285-59296307 ATGTCAACTAACATGGCAAAAGG - Intergenic
1175711910 20:61228057-61228079 ATGGTACCTCACGTGGCAAAAGG + Intergenic
1175744080 20:61441656-61441678 ATGTGTGCTCACATGGAAGACGG - Intronic
1176883278 21:14224213-14224235 ATGTTACCTTATTTGGAAAAAGG - Intronic
1176969940 21:15253559-15253581 GTGTTCTTTCACATGGCAAAGGG + Intergenic
1176982475 21:15399007-15399029 ATGTCATTTTACATGGCAAAAGG + Intergenic
1176995443 21:15550090-15550112 ATGTTACCTTACTTGGAAAAAGG - Intergenic
1177072913 21:16533398-16533420 ATGTGTTTACACATGGAAAAGGG + Intergenic
1177248637 21:18564079-18564101 ATTTGATGTCACATGGAAACAGG - Intergenic
1177395759 21:20533993-20534015 ATAATATCTTACATGGTAAAAGG + Intergenic
1177582920 21:23050991-23051013 ATGTTGTCTTTCATGGAAAATGG + Intergenic
1177698033 21:24598879-24598901 GTGTTATCTCTCATGGAACAGGG + Intergenic
1178020652 21:28404566-28404588 ATGTTACCTTGCATGGCAAAAGG - Intergenic
1178205741 21:30462972-30462994 ATGTCAGGGCACATGGAAAATGG - Intergenic
1178258134 21:31074129-31074151 ATGTTACCTAACATGGCAAAAGG - Intergenic
1178340630 21:31783158-31783180 ATGTTTTCACACAAGGAAGAGGG - Intergenic
1178687982 21:34726369-34726391 ATGTGATCTTATTTGGAAAAAGG + Intergenic
1178933297 21:36838365-36838387 ATGTTTACTTACTTGGAAAAAGG + Intronic
1179038564 21:37781958-37781980 ATGTTACTTTACATGGCAAAAGG + Intronic
1179252618 21:39685161-39685183 ATGTTAGATTACATGGCAAAGGG - Intergenic
1179530479 21:42015192-42015214 ATGTTACCTTATATGAAAAAAGG - Intergenic
1179537733 21:42063204-42063226 ATGTCAACTTACTTGGAAAAAGG - Intronic
1179557313 21:42187990-42188012 CAGTTACCTCACCTGGAAAATGG + Intergenic
1179587897 21:42385287-42385309 GTGTTATCTCAGATGGAAGGTGG - Intronic
1179643811 21:42763267-42763289 ATGTGATCTTATTTGGAAAAGGG + Intronic
1179825302 21:43961718-43961740 ACTTTGTCTCATATGGAAAACGG + Intronic
1180838341 22:18944377-18944399 ATTTGATGTCACATGGAAACAGG + Intergenic
1181878424 22:25958223-25958245 ATGTGATCTCATTTAGAAAAAGG - Intronic
1181990439 22:26832865-26832887 ATGTTATCTTACATGGCAAAAGG - Intergenic
1182004104 22:26944754-26944776 ATGTTACCTTACATGGCAAAAGG - Intergenic
1182127371 22:27825855-27825877 ATGTTACCTTACAGGGCAAAAGG - Intergenic
1182164210 22:28156162-28156184 ATGTTACCTTACATGGCAAAAGG + Intronic
1182397645 22:30047793-30047815 ATGTTATCTTAAATTGCAAAAGG + Intergenic
1183111089 22:35649011-35649033 GTGTCATCTCACAAGAAAAAAGG + Intronic
1183125148 22:35771135-35771157 ATGTTACCTTACACGGCAAAAGG + Intronic
1183209813 22:36443909-36443931 ATATTACCTTACATGGCAAAAGG + Intergenic
1183514878 22:38259345-38259367 ATGCTACCTTACATGGCAAAAGG + Intronic
1183719410 22:39553650-39553672 ATGTTTTCTCACCTGTAAAATGG + Intergenic
1184931970 22:47688007-47688029 ATGTCACCTTACATGGCAAAAGG - Intergenic
949226644 3:1702898-1702920 ATGTTAGGTTACATGGTAAAGGG - Intergenic
949264548 3:2141208-2141230 ATGCTACCTCACATGGCAAAAGG + Intronic
949362137 3:3243336-3243358 ATGCTATCTTATTTGGAAAATGG + Intergenic
949372688 3:3352738-3352760 ATGTTATCTTGCATGGCAAAAGG + Intergenic
949401414 3:3668853-3668875 ATGTTACGTTACATGGCAAAAGG - Intergenic
949485884 3:4537505-4537527 ATGTTACCTCATATGGTATAGGG + Intronic
949495545 3:4628231-4628253 CTGTTATGTCACCTGTAAAATGG + Intronic
949521331 3:4856915-4856937 ATGTTGCCTTACATGGCAAAAGG - Intronic
949606349 3:5658489-5658511 ATGTTATCTTAAAGGCAAAAGGG - Intergenic
949644549 3:6077911-6077933 ATGTTACCTGACATGGCAAAGGG + Intergenic
949984193 3:9526624-9526646 ATGTGATCTCATTTGGAAACAGG + Intronic
950151084 3:10688096-10688118 TGGTTTTCTCACCTGGAAAATGG - Intronic
950307942 3:11930677-11930699 ATGTGACCTTACTTGGAAAAGGG + Intergenic
950439493 3:13000889-13000911 CTGTTTTCTCACCTGTAAAATGG - Intronic
950484684 3:13266134-13266156 GTGTTTCCTCATATGGAAAATGG - Intergenic
950570179 3:13794938-13794960 ATGTTACCTTATATGGCAAAAGG + Intergenic
950712996 3:14827108-14827130 CTGTTTTCTCACCTGGAAAATGG - Intronic
950796403 3:15513847-15513869 ATGTTACCTTATATGGAAAATGG + Intronic
951313311 3:21157507-21157529 ATGTTATCTCACTTGGCAAAAGG - Intergenic
951354594 3:21648924-21648946 CAGTTTTCTCACATGTAAAATGG - Intronic
951594422 3:24301733-24301755 ATGCTATCTTACATGGCAAAAGG + Intronic
951737310 3:25882213-25882235 GTGTCATTTCACATGGCAAATGG - Intergenic
951744791 3:25965937-25965959 ATGTTCTCTCCCCTTGAAAATGG - Intergenic
951815996 3:26755626-26755648 ATGTTTTCTTTCATGGCAAAAGG - Intergenic
951858091 3:27220508-27220530 ATGTTATGTTACATGGTGAAGGG - Intronic
952021016 3:29020030-29020052 ATAATGTCTCAAATGGAAAAAGG - Intergenic
952126367 3:30305376-30305398 ATGTTATGTTATATGGAAAATGG - Intergenic
952442409 3:33345308-33345330 ATATTACCTTACTTGGAAAAAGG - Intronic
952475688 3:33707949-33707971 ATGGTATCACACTTGGCAAAAGG + Intronic
952661745 3:35858798-35858820 ATGTTATTTGAAATGAAAAATGG + Intergenic
952837981 3:37620530-37620552 TTGTTTTCTCAGATGTAAAATGG - Intronic
953012312 3:39039122-39039144 ATGATAGATGACATGGAAAATGG + Intergenic
953274725 3:41483702-41483724 ATATGATCTTACATGGGAAAAGG + Intronic
953416576 3:42723406-42723428 ATGTTAACTTACATGGCCAAGGG - Intronic
953453456 3:43023052-43023074 ATGTTATCTCATTTAGAAAAAGG + Intronic
953686817 3:45084384-45084406 ATGTTGTCTTGCATGGCAAAAGG + Exonic
953852308 3:46473807-46473829 ATGTTAGCTTAAATGGCAAAAGG - Intronic
954516309 3:51180684-51180706 ATGTTACCTTATTTGGAAAAAGG - Intronic
954623701 3:52010565-52010587 ATGTTACTTAACATGGCAAAGGG + Intergenic
954850595 3:53596479-53596501 ATGTTACCTTACATGGCAAAAGG + Intronic
955160120 3:56457307-56457329 ATTTTTCCTCACCTGGAAAATGG + Intronic
955169600 3:56550398-56550420 ATGTAACCTTACATGGCAAAGGG - Intergenic
955223175 3:57039885-57039907 GTGTTACCTTACATGGAAAAAGG - Intronic
955264365 3:57427247-57427269 ATGTGATCTTATATGGAAAAAGG + Intronic
955463192 3:59208176-59208198 ATGTTACCTTACATGGCAAAAGG + Intergenic
955512088 3:59691492-59691514 CAGTTTTCTCACATGCAAAATGG + Intergenic
955532680 3:59890548-59890570 ATGTTAATTCATATGCAAAATGG + Intronic
955679993 3:61490178-61490200 ATGTTACCTTACATGGCAAAAGG + Intergenic
955809076 3:62767375-62767397 TAGTTTTCTCACTTGGAAAATGG + Intronic
955896591 3:63707084-63707106 ATGTTACCTTACATGGCAAGAGG - Intergenic
956692017 3:71887325-71887347 ATGTGACCTTAAATGGAAAAAGG + Intergenic
956697723 3:71932840-71932862 ATGTGATCTTACCTGGAAATAGG + Intergenic
956775499 3:72562049-72562071 ATGTTTTCTTACATAGCAAAGGG + Intergenic
956957811 3:74360993-74361015 GTGTTATATTACATGGCAAAAGG - Intronic
957034847 3:75284316-75284338 ATGTTACCTTACACAGAAAAGGG + Intergenic
957449518 3:80360351-80360373 ATGTTACCTTGTATGGAAAAAGG + Intergenic
957617608 3:82551465-82551487 ATGTTATCTCACATATCAAAAGG - Intergenic
957622778 3:82616246-82616268 AAGTTTTCTCACCTGGAAAATGG + Intergenic
957637814 3:82809390-82809412 ATGTTATGTTACATGGCAAACGG + Intergenic
957777975 3:84779774-84779796 AAGTTACCTCTCATGGAAAGGGG - Intergenic
957935720 3:86939294-86939316 ATGTTACTGTACATGGAAAAAGG + Exonic
958009440 3:87857821-87857843 ATGTTACCTTACATGGGGAAAGG - Intergenic
958055135 3:88400452-88400474 ATATTATCATACATGGCAAAAGG + Intergenic
958455432 3:94325338-94325360 CTGTTTTCTCACCTGCAAAATGG + Intergenic
958501651 3:94918367-94918389 ATGTGACCTTACATGGTAAAAGG - Intergenic
958600155 3:96287321-96287343 ATGTTATTTTACATGATAAAAGG + Intergenic
958860715 3:99442296-99442318 ATGTTACATCACATGGCAAATGG - Intergenic
959021214 3:101189272-101189294 ATGTTCACTTACATGGCAAAAGG - Intergenic
959070480 3:101697543-101697565 ATTTGATGTCACATGGAAACAGG + Intergenic
959120543 3:102227064-102227086 ATGTTACCTTACATGGCAAAAGG - Intronic
959167071 3:102793780-102793802 ATGTTACCTTACATGGCAAAGGG + Intergenic
959283425 3:104377444-104377466 ATGTTACCTTACATGGAAAAAGG + Intergenic
959284402 3:104389867-104389889 ATGTTAGGTTATATGGAAAAGGG + Intergenic
959716615 3:109440604-109440626 ATGTTACCTTACACGGCAAAAGG - Intergenic
959861937 3:111226315-111226337 ATGTAACCTTACATGGCAAAAGG - Intronic
959908016 3:111731778-111731800 ATGTTATCTTACATGGTAAAAGG - Intronic
960027734 3:113027718-113027740 ATTTGATGTCACATGGAAACAGG - Intergenic
960085887 3:113590937-113590959 ATGTTACCTTACCTGGCAAAAGG + Intronic
960170946 3:114460337-114460359 ATGTTACCTTACGTGGCAAAGGG + Intronic
960171813 3:114471279-114471301 CTGTTTTCTCACACGCAAAATGG - Intronic
960205641 3:114894212-114894234 TTGTTTTCTCACCTGCAAAATGG + Intronic
960300943 3:116001888-116001910 ATGCTACCTTACATGGCAAAAGG - Intronic
960856928 3:122111392-122111414 ATGTTATCTTACATGGCAAAAGG + Intronic
960897984 3:122526226-122526248 ATGTTACCTTACATGGCAAAAGG - Intergenic
960931960 3:122861210-122861232 ATGTTATTTCACAAGACAAAGGG - Intronic
961078726 3:124005900-124005922 ATGTTACCTTACAGGGCAAAGGG + Intergenic
961345714 3:126262034-126262056 ATGTCACCTTACATGGCAAAGGG + Intergenic
961425609 3:126844720-126844742 GTTTTCTCTCACATGGCAAAAGG + Intronic
961669192 3:128516757-128516779 ATGTCACCTCACATGCCAAAGGG + Intergenic
961760502 3:129163871-129163893 ACGTTACCTTACATGGCAAAAGG + Intergenic
961773905 3:129270175-129270197 ATGTTACCTTGCATGGTAAAAGG - Intronic
962016653 3:131447932-131447954 ATGTGTCTTCACATGGAAAAAGG + Intergenic
962164365 3:133033755-133033777 AAGTTATCTCACCTGTAAAATGG - Intergenic
962363220 3:134758861-134758883 GTGTTACCTCCCATGGTAAAAGG + Intronic
962444900 3:135455494-135455516 ATGTTATCTTACATGGCAACAGG - Intergenic
962528521 3:136257112-136257134 ATGTTATTTTACACGCAAAAGGG + Intronic
962663340 3:137627541-137627563 ATGTGACCTTACTTGGAAAATGG - Intergenic
962886518 3:139632842-139632864 ATGTTATATTACATGGCAAAAGG + Intronic
962888177 3:139647480-139647502 ATGTTACTTTACTTGGAAAAAGG + Intronic
962914541 3:139888026-139888048 ATGTTACCTTACATAGCAAAGGG - Intergenic
963006820 3:140734252-140734274 ATGTTACCTTATATAGAAAAAGG - Intergenic
963110784 3:141686200-141686222 ATGTCACTTCACATGGCAAAAGG + Intergenic
963353745 3:144184438-144184460 ATGTTATCTTATATTGCAAAAGG + Intergenic
963569053 3:146969107-146969129 ATGTTATTTTATATGGCAAAAGG + Intergenic
963844923 3:150145474-150145496 CAGTTTTCTCACATGTAAAATGG - Intergenic
963941335 3:151098703-151098725 ATGTGACCTCATTTGGAAAAAGG - Intronic
964020045 3:151999122-151999144 ATGTTACCTTACATGGTGAAGGG + Intergenic
964465318 3:156985501-156985523 ATGTTCCCTTACATGGCAAAAGG + Intronic
964593676 3:158396931-158396953 TTGTTTTCTCATATGTAAAATGG - Intronic
964702034 3:159578911-159578933 ATGCTATTTCACATGGCAAAGGG - Intronic
964723831 3:159794071-159794093 ATGCTACTTCACATGGCAAAAGG - Intronic
964813505 3:160691770-160691792 ACGTTACCTCACATGGTAAAAGG + Intergenic
964894966 3:161584610-161584632 AGGTTAACTTACATGGCAAAAGG - Intergenic
965217929 3:165888255-165888277 ATGTTACCTTACATGGCAAAAGG - Intergenic
965427390 3:168544566-168544588 ATGTTACCTTACATGACAAAGGG + Intergenic
965492810 3:169360719-169360741 TTGTTATTTCATATGGAATAAGG + Intronic
965555960 3:170018663-170018685 ATGTTACCTTACCTGGCAAAAGG - Intergenic
965667961 3:171116087-171116109 ATGTTACCACACATAGAAATAGG + Intronic
965868025 3:173229591-173229613 TTGTTATATCTCATGGAATAGGG + Intergenic
966101306 3:176271778-176271800 CTGTTACCTTACATGGCAAAAGG + Intergenic
966170673 3:177076474-177076496 ATGTAATCTTACTTGGAAATAGG - Intronic
966246454 3:177813310-177813332 ATGTTACCTTACATGACAAAGGG + Intergenic
966254748 3:177905024-177905046 ATGGTTCCTCACCTGGAAAATGG - Intergenic
966461651 3:180183077-180183099 AGGTTATCTAACATGACAAAGGG + Intergenic
966482042 3:180421212-180421234 ATGTTAAGTTACATGGCAAAGGG + Intergenic
966936589 3:184713773-184713795 GTGTAACCTCACCTGGAAAATGG - Intergenic
967000257 3:185327353-185327375 ATGTTACCTTCCATGGCAAAAGG - Intronic
967026165 3:185566001-185566023 ATTTGATGTCACATGGAAACAGG - Intergenic
967143113 3:186580472-186580494 CTGTTACCTCACCTGTAAAATGG + Intronic
967221983 3:187255054-187255076 ATGTTATGTTAAATGGCAAAAGG + Intronic
967311752 3:188112826-188112848 ATGTTATGTTACATGGCAAAGGG - Intergenic
967345889 3:188455009-188455031 ATGTCATCTCACTTGTATAAAGG - Intronic
967698877 3:192568230-192568252 ATGTGATCTTATTTGGAAAAGGG - Intronic
967722314 3:192828489-192828511 CTGTTTTCTCATTTGGAAAATGG + Intronic
967794721 3:193587520-193587542 ATGTTACCTTACTTGGAAAAGGG - Intronic
967924916 3:194638487-194638509 ATGTTACCTTATATGGAAAAAGG - Intergenic
967991859 3:195137440-195137462 ATGTTTTCCCACATGGGTAAAGG + Intronic
969240936 4:5897006-5897028 ATGTTACTCCACATGGCAAATGG + Intergenic
969309044 4:6341587-6341609 CTGTTATCTCACATGGCAAAAGG + Intronic
969342763 4:6552702-6552724 TTGTTACCTTACATGGCAAAAGG - Intronic
969377426 4:6772007-6772029 ATGTTACCTTACCTGGCAAAAGG - Intergenic
969496125 4:7527276-7527298 ATGCTACCTTACATGGCAAAGGG + Intronic
969833357 4:9817236-9817258 ATGTTAACTTACAGGGCAAATGG - Intronic
969838725 4:9864811-9864833 GTGTTGTCTCGCATGGCAAAAGG + Intronic
969951000 4:10835522-10835544 ATGTGTCCTCACATGGCAAAAGG + Intergenic
970466771 4:16331811-16331833 ATGTTACCTCATGTGGCAAAAGG - Intergenic
970466859 4:16332865-16332887 ATGTTACCTCACGTGGCAAAAGG - Intergenic
970493399 4:16599500-16599522 ATGTGACCTTACATGGCAAAAGG - Intronic
970602809 4:17653756-17653778 ATGTTACCTTACATGGTCAAAGG + Intronic
970656829 4:18240423-18240445 ATGTTGTCTTACATAGTAAAAGG - Intergenic
970658007 4:18253404-18253426 ATGTGATATTACATGGTAAAAGG + Intergenic
970680660 4:18503906-18503928 ATATTACCTCATATGGAAAAAGG - Intergenic
970814286 4:20135671-20135693 ATGTTACCTTACATGGCAAAAGG - Intergenic
971040350 4:22744779-22744801 ATGTTACCTTCCATGGCAAAAGG - Intergenic
971098549 4:23435850-23435872 CTGTGTTCTCACATGGCAAAAGG - Intergenic
971264257 4:25084266-25084288 ATGTTACCTTACATGACAAAAGG + Intergenic
971278766 4:25223617-25223639 ATGTTATCTTATCTGGAAAAAGG - Intronic
971788088 4:31130967-31130989 ATGTTAGGTAACATGGTAAAGGG - Intronic
971813666 4:31460636-31460658 ATGTTACCTTACATGGCCAAAGG + Intergenic
971893815 4:32563269-32563291 ATGTTATCTTACATGGCAAATGG - Intergenic
971985220 4:33813370-33813392 ATGTTACCATACATGGCAAAAGG - Intergenic
972080086 4:35139639-35139661 ATGGTATCTTACATGGCAAAAGG - Intergenic
972180632 4:36460575-36460597 ATGTTACCTTACATTCAAAAAGG - Intergenic
972231444 4:37076913-37076935 ATGTTTTCTCACTTGTAAGATGG - Intergenic
972233249 4:37099662-37099684 ATGTTACATTACATGGCAAAAGG + Intergenic
972247948 4:37265840-37265862 ATGTTACCTTATATGGCAAAGGG - Intronic
972791526 4:42375712-42375734 ATGTTACCTTACATGGCAAACGG - Intergenic
972955094 4:44379148-44379170 ATGTTACTTCATATGGCAAAAGG - Intronic
973000474 4:44942449-44942471 ATGTTATCTGACATGCCAGAAGG + Intergenic
973176428 4:47211984-47212006 ATGTTACCTTATATGAAAAAAGG - Intronic
973216249 4:47672775-47672797 CTGTTCTCTCATATGGGAAATGG + Intronic
973334062 4:48938240-48938262 ATGTTTCCTTACATGGTAAAAGG + Intergenic
973849750 4:54949239-54949261 ATGTGACCTCATTTGGAAAAGGG - Intergenic
973875408 4:55213352-55213374 ATGTTATCTAACATGGGAAAAGG - Intergenic
974022735 4:56706161-56706183 ATGTTACCTTACATAGCAAAGGG + Intergenic
974195698 4:58571667-58571689 ATGTTACATTACATGGCAAAGGG - Intergenic
974225669 4:59039620-59039642 ATGTGTTCACAGATGGAAAAAGG - Intergenic
974351612 4:60754861-60754883 ATGTTATATTATATGGCAAAAGG - Intergenic
974420588 4:61668047-61668069 ATGTTATCTTATATGGCTAAAGG + Intronic
974482585 4:62465495-62465517 ATGTTATCTTACATGGCAAAAGG - Intergenic
974952477 4:68599736-68599758 ATTTGATATCACATGGAAACAGG + Intronic
975240885 4:72057633-72057655 ATGTGACCTTACTTGGAAAAAGG - Intronic
975262092 4:72315282-72315304 ATGTTACCTTATTTGGAAAAAGG + Intronic
975280677 4:72558554-72558576 ATGTTATGTTACATGCCAAAGGG - Intronic
975439256 4:74392132-74392154 ATGTTACCTTCCATGGTAAAAGG + Intergenic
975525004 4:75339376-75339398 ATGTTATGTTGCATGGCAAAGGG - Intergenic
975597244 4:76060580-76060602 ATGTTATATTACATGGCAAAAGG + Intronic
975604161 4:76136542-76136564 ATGTTATCTTACATAGCAAAAGG + Intronic
975799035 4:78039464-78039486 ATGTTATCTTATATGGCAAAAGG + Intergenic
976063901 4:81161872-81161894 ATGTTATATTACATGGCAAAAGG - Intronic
976065232 4:81179530-81179552 ATATGATCTCAGATGGAAACTGG + Intronic
976141781 4:82000566-82000588 ATGTTAGATCACATGGCAAAGGG - Intronic
976348008 4:84027471-84027493 ACGTTACCTTACATGGCAAAAGG - Intergenic
976598676 4:86917786-86917808 AGGTTATCTCACATGGCCTAGGG - Intronic
976648832 4:87413724-87413746 ATGTTACCTAACATGAAAAAAGG + Intergenic
976695093 4:87910566-87910588 ATGTTATCTTATATCGCAAAAGG - Intergenic
976830730 4:89310628-89310650 ATATTACCTTACATGGCAAAGGG - Intergenic
976838851 4:89407651-89407673 ATGTTACCTGATATGGCAAAAGG + Intergenic
976945568 4:90762787-90762809 ATGTTACCTTACTTGAAAAAGGG + Intronic
976989243 4:91344197-91344219 ATGTGTTCTCACATGGAGGAAGG - Intronic
977031963 4:91894330-91894352 ATCTTATGTCACATGATAAAGGG - Intergenic
977095376 4:92736034-92736056 ATGTTAACTTACATGACAAAAGG + Intronic
977135318 4:93296371-93296393 AAGTTATCTTTCAAGGAAAATGG - Intronic
977175565 4:93815718-93815740 ATGTTACTTTACATGGCAAAGGG + Intergenic
977275306 4:94969933-94969955 ATGTTTCCTTACATGTAAAAAGG + Intronic
977576980 4:98685240-98685262 ATGCTACCTCACGTGGCAAAAGG - Intergenic
977644026 4:99391026-99391048 CTGTGTACTCACATGGAAAAAGG + Intergenic
977727503 4:100313991-100314013 TTGTTATTTCACATGGGAATTGG - Intergenic
977943592 4:102884191-102884213 CAGTTTTCTCACATGTAAAATGG + Intronic
978017030 4:103757128-103757150 ATGTTATCTTATATGGCAAAAGG - Intergenic
978220939 4:106273534-106273556 ATGTTACCTTATTTGGAAAAAGG + Intronic
978744610 4:112178220-112178242 ATGATATCTTACATGGCAAAAGG + Intronic
978806196 4:112803251-112803273 ATGTTACCTTACTTGGAAAAGGG + Intergenic
979099196 4:116593785-116593807 ATGTTATTTTATATGGCAAATGG - Intergenic
979236015 4:118401120-118401142 ATGTTATGTTACATGCAAAGGGG + Intergenic
979382781 4:120027912-120027934 ATGTTATCTCCCATCTATAATGG + Intergenic
979406873 4:120323382-120323404 ATTTTCTCTTACCTGGAAAATGG + Intergenic
979471361 4:121101346-121101368 ATGTGTTCTCACATGGAAGAAGG - Intergenic
979724599 4:123945417-123945439 ATGTCACATTACATGGAAAAAGG + Intergenic
980254744 4:130364473-130364495 ATGTTGTTTGACATGGCAAAAGG + Intergenic
980492059 4:133541107-133541129 AAGCTATCTCAGATGCAAAAGGG - Intergenic
980539405 4:134174570-134174592 GTGTTATATCACATGTACAATGG - Intergenic
980586629 4:134825551-134825573 ATGTGTTCTCACATGGCAAAAGG - Intergenic
980689111 4:136269400-136269422 ATGTTATCTCATATTCCAAAAGG + Intergenic
980774777 4:137423471-137423493 ATGTCTACTCACATTGAAAAAGG + Intergenic
980880305 4:138703434-138703456 ATGTTACCTTACGTGGCAAAAGG - Intergenic
981425346 4:144596290-144596312 ATGTTATTTTACATGGCAAAAGG - Intergenic
981561069 4:146048966-146048988 ATGTTACCTTACATGGCAAAAGG - Intergenic
981722459 4:147815405-147815427 ATGTTATTTTACATGGCAAAAGG + Intronic
981841352 4:149116195-149116217 ATGATATCTTACATGGAAAGTGG - Intergenic
981873815 4:149517345-149517367 ATCTTATGTCACATGATAAAGGG - Intergenic
982086967 4:151845389-151845411 ATGTTAGCATACATGGCAAAAGG + Intergenic
982217154 4:153092244-153092266 ATGTGACCTTATATGGAAAAAGG - Intergenic
982320584 4:154072902-154072924 GTGTTACCTTACATGGTAAAGGG + Intergenic
982530136 4:156530574-156530596 ATGTTATCTTAAAAGGAAGAGGG + Intergenic
982680795 4:158426737-158426759 ATGTTGTGTTACATGGCAAAAGG - Intronic
982802817 4:159725226-159725248 ATGTTATTTTACATGGAAAAAGG + Intergenic
982852985 4:160342463-160342485 TTGTTCACTCCCATGGAAAAGGG - Intergenic
982942358 4:161574198-161574220 ATGTTACCTTATATGGCAAAGGG - Intronic
983009872 4:162534582-162534604 ATGTTATCTTACATGACAGAAGG + Intergenic
983018222 4:162641057-162641079 ATGTTACCTCACAAGGCAAAGGG + Intergenic
983051474 4:163052667-163052689 ATGATAACTAAAATGGAAAATGG + Intergenic
983251990 4:165355687-165355709 ATGTGATCTTATTTGGAAAAGGG - Intergenic
983344569 4:166510445-166510467 ATGTTACCTTACATGGCAAAAGG + Intergenic
983445661 4:167847389-167847411 ATTTTATCTGAGATGGATAAAGG - Intergenic
983488437 4:168359540-168359562 ATTTTCTCTCACCTGGAATATGG + Intronic
983826526 4:172268789-172268811 CTGTGTTCTCACATGGAAGAGGG - Intronic
983849684 4:172565077-172565099 CTGTGCTCTCACATGGAAGAAGG + Intronic
983855312 4:172636385-172636407 ATGTTTCCTTACATGGCAAAAGG + Intronic
983951360 4:173646443-173646465 ATGTTAAGTTACATGGCAAAGGG + Intergenic
984023382 4:174513961-174513983 TTCTTATCTCAAATGGCAAATGG - Intronic
984210492 4:176841162-176841184 ATGACATCCCACATGGACAAGGG + Intergenic
984418683 4:179492255-179492277 ATGTTACCTTACATGGTAAAAGG + Intergenic
984467962 4:180125493-180125515 AAGAAATCTCAAATGGAAAAAGG + Intergenic
984507773 4:180640891-180640913 ATGTTTTCTCATCTGTAAAATGG - Intergenic
984758363 4:183343794-183343816 CTGATTTCTCACATAGAAAATGG - Intergenic
984882988 4:184426549-184426571 ATGTCACCTCATTTGGAAAAAGG - Intronic
984933487 4:184868953-184868975 ATGGTATCTCCCATGGATAAGGG - Intergenic
985134441 4:186771490-186771512 ATGTTATTTCATATGGCAAGAGG + Intergenic
985346924 4:189015929-189015951 ATGTTGTATCACATGGAGACTGG - Intergenic
985461342 4:190109830-190109852 ATTTGATATCACATGGAAACAGG - Intergenic
986244310 5:5991437-5991459 ATGTTACCTTATATGGTAAAAGG + Intergenic
986605035 5:9514320-9514342 ATGTTACCTGACATGGCAAAAGG - Intronic
986769334 5:10957644-10957666 ATGTTATCTTACATGGCAAGAGG + Intergenic
987022821 5:13892331-13892353 ATGTTACCTTATATGGCAAAAGG + Intronic
987246063 5:16050011-16050033 ATGTCACCTTACATGGCAAAAGG + Intergenic
987431400 5:17838485-17838507 TTGCTACATCACATGGAAAAAGG + Intergenic
987449534 5:18064651-18064673 ATGTCATGTAACATGGCAAATGG + Intergenic
987807968 5:22794743-22794765 ATATTATCTTACATAGCAAAAGG + Intronic
987824319 5:23008707-23008729 ATGTGTTCTCACATGGGAGAAGG - Intergenic
987844589 5:23266075-23266097 TTTTTATCTCACATGGAACATGG + Intergenic
987918140 5:24242773-24242795 ATGTTACCTTACTTGGAAAAAGG - Intergenic
988101924 5:26690642-26690664 ATATTACCTTACATGGCAAAAGG + Intergenic
988244358 5:28659981-28660003 ATGTTGTCTCACTTGGAAATAGG - Intergenic
988380315 5:30490386-30490408 ATTTGATGTCACATGGAAACAGG - Intergenic
988579100 5:32453671-32453693 ATGTCATCTTACATGGCAGAAGG - Intergenic
988600172 5:32632344-32632366 ATGTTTCCTCACATGGCAGAAGG - Intergenic
988710419 5:33768898-33768920 ATGTTAGATTACATGGTAAAGGG + Intronic
988771453 5:34437210-34437232 ATGTTATCTCATTTGGCAAAAGG + Intergenic
988858138 5:35249058-35249080 CTGTGATCTCACATGGCAGAAGG + Intergenic
988955358 5:36310938-36310960 CTGTTATCTTATTTGGAAAATGG + Intergenic
989001631 5:36766796-36766818 CTGTTACCTTACATGGCAAAGGG - Intergenic
989091152 5:37733333-37733355 ATGTTCTCTCATTTGGAAAAAGG - Intronic
989136101 5:38156533-38156555 ATGTTACCTTACATGGCAAAAGG - Intergenic
989274273 5:39568797-39568819 CTGTTTTCTCACCTGTAAAATGG + Intergenic
989344279 5:40411674-40411696 ATGTTGGGTTACATGGAAAAAGG + Intergenic
989558404 5:42823856-42823878 TTGTTATCTCACAGGGTAAGTGG - Intronic
989650812 5:43688140-43688162 ATTTTACCTTACATGGCAAAAGG + Intronic
989836791 5:46003490-46003512 ATTTGATGTCACATGGAAACAGG - Intergenic
990033377 5:51289647-51289669 TGGTGATCTCACATGGCAAAGGG + Intergenic
990148646 5:52790752-52790774 ATGTTATCTTAGATGGTAAAAGG - Intronic
990220142 5:53579480-53579502 ATGTTACCTTATATGGCAAAAGG + Intronic
990283499 5:54276639-54276661 ATGTTATCTTACATGGCAAAAGG + Intronic
990374082 5:55151895-55151917 ATGTTACTTCATATGGCAAAGGG + Intronic
990516504 5:56535520-56535542 ATGTTACCTTATATGGCAAAAGG - Intronic
990568882 5:57057492-57057514 ATGTTATGTTACATGGAAGGGGG + Intergenic
990620698 5:57555817-57555839 ATGTTACCTTACATGGCAAAAGG - Intergenic
990659903 5:58001723-58001745 ATGTTACCTTACGTGGCAAAAGG - Intergenic
990802870 5:59625026-59625048 ATATTACTTTACATGGAAAAAGG + Intronic
990957879 5:61361967-61361989 ATGTTTTCACATATGGAAATAGG + Intronic
990985418 5:61637009-61637031 AGGTTACCTCAAATGGCAAAAGG - Intergenic
991040722 5:62172711-62172733 ATATTATCTTACATGGCAAAAGG - Intergenic
991155790 5:63433319-63433341 ATATTACCTTACATGAAAAAAGG + Intergenic
991185334 5:63800103-63800125 ATGTTACTTTACATGGCAAAAGG - Intergenic
991210258 5:64096278-64096300 GTGTTGTCTTACATGGCAAAAGG - Intergenic
991398203 5:66226423-66226445 ATGTTACCTTATAAGGAAAAGGG - Intergenic
991398788 5:66232629-66232651 ATGTAATTTCAAATGGGAAAAGG - Intergenic
991567108 5:68016765-68016787 ATGTTACCTTTCATGGAAATAGG + Intergenic
991613382 5:68471065-68471087 ATGTTTGCTCATCTGGAAAATGG - Intergenic
991971282 5:72144094-72144116 ATGTGACCTCATTTGGAAAAAGG - Intronic
992169034 5:74084156-74084178 CTGTTTTCTCACCTGTAAAACGG + Intergenic
992268176 5:75038620-75038642 CTGTGTTCTCACATGGCAAAGGG + Intergenic
992282206 5:75190728-75190750 TTATTATCTGACATGTAAAAAGG + Intronic
992658445 5:78933763-78933785 ATGTTACCTTACATGGCAACGGG + Intronic
993275953 5:85858970-85858992 ATTTTATCCCACATGGAGAATGG + Intergenic
993439578 5:87939230-87939252 TGGTTATCTCATATGTAAAATGG - Intergenic
993443720 5:87987086-87987108 ATGTTCTCTCATAAGGAAAAAGG + Intergenic
993483294 5:88451068-88451090 ATGTTACCTTTCATGGCAAAGGG - Intergenic
993731537 5:91428678-91428700 ATGTTACCTTACACGGCAAAAGG + Intergenic
993820342 5:92607268-92607290 ATGTGTTCTCACAAAGAAAATGG + Intergenic
993832016 5:92771524-92771546 ATGTTACCTTACAAGGCAAAAGG - Intergenic
993986901 5:94608075-94608097 ATGTTATGTTACATGGCCAAGGG - Intronic
994048022 5:95330990-95331012 ATGTGACCTTACATGGAAAAAGG + Intergenic
994275936 5:97837331-97837353 ATGTTACCTTACATGGCAAAGGG - Intergenic
994389732 5:99177555-99177577 ATAGTATATCACATGGGAAAGGG - Intergenic
994447955 5:99901782-99901804 ATGTTACCTAACAGGGCAAAAGG + Intergenic
994453229 5:99970789-99970811 ATATTATCTTATTTGGAAAATGG + Intergenic
994456551 5:100015752-100015774 ATGTTACATTACATGGCAAAGGG - Intergenic
994580722 5:101638473-101638495 AAGTTAGCTCACATGTGAAATGG - Intergenic
994667819 5:102728071-102728093 ATGTTACCTTACATAGCAAAAGG + Intergenic
994739043 5:103595304-103595326 ATGTTACCTTACATGGCAAAAGG - Intergenic
994915789 5:105977294-105977316 ATGTTTTCTCACCTATAAAATGG + Intergenic
994947193 5:106410152-106410174 ATGTTACACCACATGGCAAAGGG + Intergenic
994977018 5:106820790-106820812 ATGTTATCTTACATGGCAAAAGG - Intergenic
995033382 5:107505891-107505913 CAGTTTTCTCAAATGGAAAATGG - Intronic
995281120 5:110336927-110336949 ATGATACCTTACATGGCAAAAGG + Intronic
995405975 5:111796376-111796398 ATGTTATCTTACATGGCAAAGGG - Intronic
995541837 5:113193298-113193320 ATTTTACCTTACATGGTAAAAGG - Intronic
995627795 5:114098254-114098276 ATGTTCCCTTACATGGTAAAAGG - Intergenic
996301539 5:121992550-121992572 ATGTTATTTTACATGGCAGAAGG - Intronic
996387921 5:122928353-122928375 ATGTTACCTTACATGCAGAAGGG + Intronic
996395287 5:123007367-123007389 ATGTTTTCTCAAAAGGAAGATGG - Intronic
996442201 5:123504226-123504248 ATATTATCTCAAATGGCACAAGG + Intergenic
996560315 5:124821185-124821207 ATGTGATCTAATTTGGAAAAAGG - Intergenic
996624821 5:125557829-125557851 ATGTTATCTTACATGGTACAAGG - Intergenic
996642779 5:125777089-125777111 ATGTTACCTTATATGGCAAAGGG - Intergenic
996928098 5:128853052-128853074 ATGTTACCTCATTTGGAAATAGG - Intronic
997100645 5:130965208-130965230 ATGTTACCTTACATGGCAAAAGG + Intergenic
997298701 5:132786258-132786280 ATCTTACCTTACATGGCAAAGGG + Intronic
998298159 5:140991903-140991925 ATGTTATGTTACATGGCAAAAGG - Intronic
998305104 5:141068346-141068368 ATGTTATGTTACATGGCAAAGGG - Intergenic
998745651 5:145256518-145256540 ATGTTAGATTATATGGAAAAGGG - Intergenic
998773661 5:145573979-145574001 ATGTTATGTTACATGGCAAGGGG + Intronic
998861521 5:146448148-146448170 CTGTTATCTCACCTGTAAGATGG - Intronic
999003967 5:147955577-147955599 ATGTTACCTTACATGGCAAAAGG + Intergenic
999057086 5:148589445-148589467 ATGTGATCTCACAAGAAAATAGG - Intronic
999063126 5:148656221-148656243 ATGTTACCTTGCATGGCAAAAGG + Intronic
999571791 5:152926959-152926981 ATGTCTTCTCACTTGAAAAAAGG - Intergenic
999684732 5:154091975-154091997 GTGTTACCTTACATGGCAAAAGG + Intronic
999835275 5:155363755-155363777 ATGTTAACTCAGGTGGAAAATGG - Intergenic
999932785 5:156451842-156451864 TTGTTATCTAACATGGAACCAGG - Intronic
999937856 5:156507114-156507136 GTATTATATTACATGGAAAAGGG + Intronic
999952010 5:156661159-156661181 ATTTGATGTCACATGGAAACAGG - Intronic
1000017456 5:157290561-157290583 ATGTTCCTTCACATGGAAAGAGG - Intronic
1000287403 5:159838449-159838471 ATGTTACCTTACCTGGAAAAAGG + Intergenic
1000397461 5:160790772-160790794 ATGTTACATCACATGGCAAAGGG + Intronic
1000428693 5:161124242-161124264 ATGTGAACTTACATGGCAAAAGG + Intergenic
1000564533 5:162831362-162831384 ATGGTATGTTACATGGCAAAAGG - Intergenic
1000921639 5:167145177-167145199 ACGTTACCTTACATGGTAAAAGG - Intergenic
1001090532 5:168736920-168736942 CGGTTATCTCACCTGCAAAATGG + Intronic
1001102737 5:168827642-168827664 ATGTTGTCTTACATGGCAAAAGG - Intronic
1001136955 5:169110639-169110661 ATGTTACCTCATTTGGAAATAGG - Intronic
1001172035 5:169428481-169428503 ATGTTATCTCACATGGCAAAAGG + Intergenic
1001244015 5:170092314-170092336 ATGTGATCTTACTTGGAAATAGG - Intergenic
1001270415 5:170307076-170307098 ACGTTAAGTTACATGGAAAAGGG + Intergenic
1001698131 5:173687818-173687840 ATGTAATCTTACATGGCAAAAGG - Intergenic
1001699052 5:173693599-173693621 ATGTGACCTCATTTGGAAAAGGG + Intergenic
1001784258 5:174398336-174398358 ATGTTACCTTAAATGGCAAAAGG + Intergenic
1001813160 5:174646075-174646097 ATGTCACCTTACATGGCAAAAGG - Intergenic
1001815606 5:174666687-174666709 ATGTTTTCTTACATGGCTAAAGG - Intergenic
1001907559 5:175485592-175485614 ATGTTACCTCACATGGTGCAGGG - Intronic
1001985198 5:176068685-176068707 ATGTTATCTCCCATAGTTAATGG - Intronic
1002263673 5:178014303-178014325 ATGTTATCTCCCATAGTTAACGG - Intronic
1002594804 5:180315067-180315089 ATGGTATTTAAAATGGAAAATGG + Intronic
1002902573 6:1422576-1422598 CTGTTTTCTCACCTAGAAAATGG + Intergenic
1002988317 6:2213468-2213490 ATGTAAACTCACTTTGAAAAAGG + Intronic
1003268077 6:4584017-4584039 ATGTTACCTTACATGGCCAAAGG - Intergenic
1003476633 6:6489714-6489736 ATGTGATCTTACTTGGAAATAGG + Intergenic
1003699731 6:8448513-8448535 ATGTGATATCATATGGCAAAAGG - Intergenic
1003981277 6:11392490-11392512 ATGTTACCTTACATGGCAAAAGG - Intergenic
1004056985 6:12149230-12149252 ATGATCTCTGACATGGAAAATGG + Intronic
1004139699 6:13005891-13005913 AAGTTCTCACACTTGGAAAAAGG + Intronic
1004274053 6:14220318-14220340 GTGTTACCTGACATGGCAAAAGG + Intergenic
1004636034 6:17468714-17468736 AAGGATTCTCACATGGAAAATGG + Intronic
1004999237 6:21224172-21224194 ATGTTACCTTACATGGCAAAAGG + Intronic
1005204953 6:23392226-23392248 ATGTTAGCTTGCATGGCAAAAGG + Intergenic
1005730151 6:28689190-28689212 ATTTGATGTCACATGGAAACAGG + Intergenic
1005761841 6:28974570-28974592 ATGTTAACTTACATGGCAAAGGG + Intergenic
1005774828 6:29119669-29119691 ATGTTACTTTACATGGCAAAAGG + Intergenic
1005781026 6:29192393-29192415 ATGTTACTTTACATGGCAAAAGG - Intergenic
1005902603 6:30230541-30230563 ATGTTACCGTACATGGCAAAAGG + Intergenic
1006206722 6:32350652-32350674 ATGTTAGGTTACATGGAAAAAGG + Intronic
1006252420 6:32798970-32798992 CTGTTACCTTACATGGCAAAAGG + Intergenic
1007827446 6:44611309-44611331 ATGTTATGCTACATGGCAAAAGG - Intergenic
1007852033 6:44812559-44812581 ATGTTACATCACATAGCAAAAGG - Intronic
1007934492 6:45721066-45721088 GTGTTATCTCACATGGCAAAAGG + Intergenic
1008079102 6:47176429-47176451 ATCTTATGTCACATGATAAAAGG + Intergenic
1008132407 6:47733827-47733849 ATGTTAGGTTACATGGCAAAGGG + Intergenic
1008417583 6:51260998-51261020 TAATTATCTCACATGGAAGATGG + Intergenic
1008457173 6:51724688-51724710 ATGTTATCTTATATAGAAAAGGG + Intronic
1008492885 6:52104227-52104249 AGGTTACCTTACATGGTAAAAGG + Intergenic
1008547094 6:52592698-52592720 ATGTTACCTTACATGGCAAAAGG - Intergenic
1008618158 6:53245932-53245954 ATGTTACCTTATATGGCAAAGGG - Intergenic
1008762230 6:54865453-54865475 ATGTGACCTTACATGGAAATAGG - Intronic
1008818844 6:55606733-55606755 ATGTTATTTTACATGGCAAAAGG + Intergenic
1009059803 6:58385310-58385332 ATGTTATCTTACATTTCAAAAGG - Intergenic
1009176542 6:60466942-60466964 ATGTAATCTCACATAAACAAAGG - Intergenic
1009231108 6:61062086-61062108 ATGTTATCTTACATTTCAAAAGG + Intergenic
1009540415 6:64949298-64949320 ATGTGATCTCACCTAGGAAATGG + Intronic
1009649181 6:66451385-66451407 ATGTTACTTTACATGGCAAAGGG + Intergenic
1009761326 6:68010528-68010550 ATGTTACCTTACATGGCAAAAGG + Intergenic
1010496978 6:76545805-76545827 CTGTAATTTCACATGGCAAAAGG - Intergenic
1010572720 6:77497081-77497103 ATGTCACCTTACATGGCAAAGGG - Intergenic
1010591788 6:77720653-77720675 ATTTGATGTCACATGGAAACAGG - Intronic
1010628307 6:78166581-78166603 CTGTAATCTCACATGAAAGAAGG + Intergenic
1010680149 6:78789649-78789671 ATGTTAGGTTACATGGTAAAGGG + Intergenic
1010736129 6:79445229-79445251 ATGTTACCTTACTTGGAAAAGGG + Intergenic
1010812660 6:80317643-80317665 ATGTTACCTTACATGGCAAAAGG - Intronic
1010865058 6:80966181-80966203 ATGTTACCTTACATGTTAAAAGG - Intergenic
1011010787 6:82701749-82701771 ATGTTACCTTACCTGGCAAAAGG - Intergenic
1011389254 6:86833664-86833686 ATGTTATCTTACATTCCAAAAGG - Intergenic
1011476691 6:87755551-87755573 ATGTTACCTTACATGGCAAAAGG - Intergenic
1011507033 6:88056662-88056684 ATGTTATCTTAGAGGGCAAAGGG - Intronic
1011597110 6:89026497-89026519 ATGTTATTTTACATGGTAAAAGG + Intergenic
1011753347 6:90475132-90475154 ATGTTAGCTTACATGGCAAAAGG - Intergenic
1011820952 6:91253577-91253599 ATGTTATCTCTTGTGGCAAAAGG - Intergenic
1011877960 6:91985384-91985406 ATGTGTTCCCACATGGCAAAAGG - Intergenic
1012009937 6:93770733-93770755 ATGTTAAGTGACATGGCAAATGG - Intergenic
1012072546 6:94640991-94641013 ATGTTGTCTTACATGACAAAGGG - Intergenic
1012228011 6:96726958-96726980 ATGTTACCTTATATGGCAAAAGG + Intergenic
1012425933 6:99114422-99114444 ATGTTATCTTATTTAGAAAAAGG - Intergenic
1012676762 6:102124153-102124175 ATGTTATTTTATATGGTAAAGGG + Intergenic
1012859080 6:104537733-104537755 ATACTATCTCGCATGTAAAAAGG - Intergenic
1012863865 6:104594924-104594946 ATATTATTTTACATGGCAAAAGG - Intergenic
1013129368 6:107217244-107217266 ATGTTACCTTACAAGGCAAAAGG + Intronic
1013425128 6:110004740-110004762 ATGTTACCTTACATTGCAAAAGG - Intergenic
1013788716 6:113812069-113812091 GTGTTATCTCACATGGCCAAAGG - Intergenic
1013847672 6:114473668-114473690 ATGTTACTTTACATGGAAAATGG + Intergenic
1013905390 6:115210950-115210972 ATGTTGTATTACATGGCAAAAGG + Intergenic
1014145572 6:117994406-117994428 ATGTTATGTTATATGGCAAAAGG - Intronic
1014270127 6:119327044-119327066 ATGTTATTTCACATGGCAAAGGG + Intronic
1014308253 6:119768372-119768394 ATTTTCTCTCCCATTGAAAAAGG - Intergenic
1014483200 6:121964533-121964555 ATGTTATATCACATTGGAAAGGG + Intergenic
1014801453 6:125782836-125782858 ATGTCACCTTACATGGCAAAAGG + Intronic
1015060906 6:128964220-128964242 GTGATATCTGACATGGGAAAGGG + Intronic
1015107456 6:129553537-129553559 ATGTTATTTTATATGGCAAAAGG - Intergenic
1015282375 6:131447376-131447398 ATGTGATCTTACTTGGAAATGGG + Intergenic
1015337506 6:132057276-132057298 ATACTACCTTACATGGAAAAGGG - Intergenic
1015921482 6:138270330-138270352 ATGTTGTCTCAGACAGAAAAGGG + Intronic
1016000490 6:139036350-139036372 ATGTTACCTTACATGGCAAAAGG - Intronic
1016355027 6:143209338-143209360 ACGTTATGTTACATGGCAAAGGG + Intronic
1016373237 6:143395355-143395377 ACGTCATCTCAAATGGAGAAAGG - Intergenic
1016393473 6:143598136-143598158 ATGTTACTTTACATGGCAAAAGG + Intronic
1016574527 6:145553671-145553693 ACTTTATCCCATATGGAAAATGG + Intronic
1016964548 6:149706557-149706579 ATGTTATCTTATTTGGAAAAAGG + Intronic
1017287280 6:152690467-152690489 ATGTCACATTACATGGAAAAGGG - Intergenic
1017387012 6:153898154-153898176 ATGTTACCTTACATTGCAAAAGG + Intergenic
1017430920 6:154369898-154369920 ATGTTATTTTACATGGCAAAAGG - Intronic
1017562217 6:155640596-155640618 ATGTTATCTTACAAGGCAAAAGG - Intergenic
1017980227 6:159394748-159394770 TAATTATCCCACATGGAAAAGGG - Intergenic
1018468979 6:164079998-164080020 ATGTTATCTGACTCGGAACAGGG - Intergenic
1018881401 6:167885467-167885489 ATGTTATGTCTCATAGAATAGGG + Intronic
1019097652 6:169598139-169598161 ATGTGATCTTATTTGGAAAAAGG + Intronic
1019309378 7:352799-352821 CTGTTTTCTCACCTGTAAAATGG - Intergenic
1019875368 7:3806252-3806274 ACGTTACCTCACATGGGAAAGGG - Intronic
1019976465 7:4586171-4586193 ATTTGATGTCACATGGAAACAGG - Intergenic
1019977401 7:4594675-4594697 ATTTGATGTCACATGGAAACAGG - Intergenic
1020218776 7:6217827-6217849 ATGTTAACTTACATGACAAAAGG + Intronic
1020363220 7:7352382-7352404 ATGCTACCTTACATGGCAAAAGG + Intergenic
1020457574 7:8391442-8391464 ATGTTATCCTGCATGGCAAAAGG + Intergenic
1020516705 7:9130528-9130550 ATGTTATTTTACATGGCAAAAGG - Intergenic
1020611658 7:10404726-10404748 ATTTTATTTCTCAAGGAAAATGG + Intergenic
1020669981 7:11094542-11094564 ATGTTATCTTGTATGGTAAAAGG - Intronic
1020686109 7:11297597-11297619 ATGTAATGTTACATGGCAAAAGG + Intergenic
1020690336 7:11347137-11347159 ATACTATCTTACATGGTAAAAGG + Intergenic
1020710599 7:11599513-11599535 ATCTTATGTCACATGATAAAGGG - Intronic
1020744405 7:12064071-12064093 ATGTTACCTCTCATGGCCAAAGG + Intergenic
1020827384 7:13047012-13047034 ATGATATCTGACATGGGTAAAGG - Intergenic
1020957329 7:14757441-14757463 ATGTTATGATACATGGTAAATGG + Intronic
1021032682 7:15757496-15757518 ATGTTAATTAACATGGCAAAAGG - Intergenic
1021149655 7:17134226-17134248 ATGTTATCTTACATGGCAAAAGG + Intergenic
1021386510 7:20037492-20037514 ATGTTATCTTACATGGGAAAAGG + Intergenic
1021402269 7:20222827-20222849 ATGTTACCTGACATGGCAAAAGG - Intergenic
1021858529 7:24882050-24882072 ATGTTACCACATTTGGAAAAAGG - Intronic
1021876908 7:25058163-25058185 ATGTTACCTTACATGACAAAAGG - Intergenic
1022079818 7:27008654-27008676 ATCTTATGTCACATGACAAAGGG - Intergenic
1022130831 7:27402930-27402952 CAGTTTTCTCACCTGGAAAATGG - Intergenic
1022356298 7:29617753-29617775 ATGTTACCTTACATGGCAAAGGG - Intergenic
1022431846 7:30331818-30331840 ATGTTAACACAAATGGAACACGG - Intronic
1022487094 7:30787460-30787482 AGTTTATCTCACATGGAGATGGG - Intronic
1022652911 7:32293583-32293605 CTGTTTCCTCACATGTAAAATGG - Intronic
1022682128 7:32558618-32558640 CTGTTTTCTTACCTGGAAAAAGG - Exonic
1022911125 7:34900364-34900386 CTGTTATCTTACATGATAAAAGG + Intergenic
1023672611 7:42593915-42593937 ATGTTACCTTACATGACAAAAGG + Intergenic
1023686361 7:42739458-42739480 CTGTTAGCTTACATGGCAAAAGG - Intergenic
1023754226 7:43401097-43401119 ATGTTACCTTACATGGTAAAAGG - Intronic
1024388990 7:48785741-48785763 TTTTTATCTCAAATGTAAAAAGG - Intergenic
1024574000 7:50748977-50748999 TTGTTCTCTCACCTGTAAAAGGG + Intronic
1024755281 7:52522147-52522169 CTGTGACCTCACATGGCAAAGGG + Intergenic
1024786817 7:52917312-52917334 ATGTGACCTTACATGGAAAATGG + Intergenic
1024850800 7:53714472-53714494 ATGCTATGTTACATGGCAAAAGG - Intergenic
1025900185 7:65737944-65737966 ATGATATGTCACATGAATAAAGG + Intergenic
1026272783 7:68851116-68851138 ATGTTACTTCACATGGCAAAAGG - Intergenic
1026521350 7:71120843-71120865 GTGTTAGCTTACATGGCAAAAGG + Intergenic
1026839678 7:73663002-73663024 ATGTTACCTTACATGGCAACAGG - Intergenic
1027593308 7:80141109-80141131 ATGTCACCTCACAGGGCAAAAGG - Intronic
1027693949 7:81385025-81385047 ATATTATCTCAAATGACAAAAGG - Intergenic
1027848960 7:83424659-83424681 ATGTTACCTTACATGGCAAAAGG + Intronic
1027920003 7:84380993-84381015 ATGTTGCCTTACATGGCAAAAGG - Intronic
1028202214 7:87975044-87975066 ATGTTACCTCACATGGAAAAAGG - Intronic
1028213365 7:88102046-88102068 ATGGTTTCTCACTTGTAAAAGGG + Intronic
1028335844 7:89653586-89653608 ATGTTACCTTATTTGGAAAAGGG + Intergenic
1028527676 7:91803411-91803433 ATGTTATCCTACATGGCAAAAGG - Intronic
1028583912 7:92434494-92434516 ATGTTATCTTGCATGTCAAAAGG + Intergenic
1028704809 7:93829046-93829068 GGGTTATATCACTTGGAAAACGG + Intronic
1028893287 7:96012827-96012849 ATGTTACCTCAAGTGGCAAAAGG + Intronic
1028917104 7:96271088-96271110 ATGTTACCTTATTTGGAAAAAGG - Intronic
1028950012 7:96624067-96624089 ATGTTACCTTATTTGGAAAAGGG - Intronic
1030247766 7:107403604-107403626 ATATGATCCCACATGGCAAAAGG + Intronic
1030254466 7:107492801-107492823 ATGTTAACTTACATTGCAAAAGG - Intronic
1030300366 7:107968440-107968462 ATGTTACCTCATATGGCAAAAGG + Intronic
1030323910 7:108199782-108199804 ATGTCACCTTACATGGCAAAAGG - Intronic
1030548363 7:110927386-110927408 ATGTTACATTACATGGCAAAGGG + Intronic
1030785017 7:113649231-113649253 AGGATTTCTCACATGTAAAATGG + Intergenic
1031060126 7:117041795-117041817 ATGTTATATTAAATGGCAAAGGG + Intronic
1031132043 7:117843881-117843903 ATGTTCCCTTACATGGCAAAAGG + Intronic
1031144867 7:117986509-117986531 ATCTTACCTTACATGGCAAAAGG - Intergenic
1031331046 7:120465002-120465024 ATGTTATCTTACATGGCAAAAGG - Intronic
1031429238 7:121646154-121646176 ATGTTATCTCACAAGGCAAAAGG - Intergenic
1031565680 7:123294421-123294443 ATGTTACCTTGCATGGCAAAGGG + Intergenic
1031681943 7:124686300-124686322 ATGCTACCTTACATGAAAAAAGG + Intergenic
1031731002 7:125300344-125300366 ATGTTAAATGACATGGGAAAAGG - Intergenic
1031792177 7:126119702-126119724 ATGTTACCTTATTTGGAAAAAGG - Intergenic
1031819225 7:126478114-126478136 ATGTGATCTTATATGGAAAAGGG - Intronic
1032123608 7:129174737-129174759 ATATTACCTCATATGGCAAAAGG - Intergenic
1032510763 7:132470554-132470576 AGGTTACCTAACATGGCAAAAGG + Intronic
1032592189 7:133201666-133201688 ATGTTACCTTAAATGGTAAAGGG - Intergenic
1033436021 7:141334310-141334332 CTGTTATCTCATCTGAAAAATGG + Intronic
1033727833 7:144139238-144139260 ATTTTATCACACATGGCAAATGG - Intergenic
1034125868 7:148671125-148671147 ATGTTACCTTACATGGCAAAAGG + Intergenic
1034325552 7:150228408-150228430 ATGTTATCTTATATGACAAAAGG + Intergenic
1034351830 7:150421002-150421024 CTGTCATCTCTAATGGAAAATGG + Intergenic
1034930572 7:155158503-155158525 CTGCTATATCACATGGCAAAAGG + Intergenic
1034985104 7:155507529-155507551 ATGTTAAATCACAAGGAAACTGG - Intronic
1035173980 7:157037564-157037586 ATGTTAGGTTACATGGCAAAGGG + Intergenic
1035186493 7:157130123-157130145 ATGTTATCTTACACAGCAAAAGG + Intergenic
1035269773 7:157712354-157712376 ATGTTATGTAACTTGGAAAAAGG + Intronic
1035521780 8:280448-280470 ACGCTATCTCACTTGGAAAATGG - Intergenic
1036051350 8:5202073-5202095 ATGTGATCTCATTTGGAAAAAGG + Intergenic
1036195684 8:6711959-6711981 ATGTTTTCTTATTTGGAAAAAGG - Intronic
1036292014 8:7501620-7501642 ATTTGATGTCACATGGAAACAGG - Intronic
1036493253 8:9247182-9247204 ATGCTACCTCAAATGGCAAAAGG - Intergenic
1036505641 8:9352869-9352891 ATGAAATCTCACTTGGAAAATGG - Intergenic
1036625273 8:10465918-10465940 ATGTTAGCTTACATGGCAAAGGG + Intergenic
1036944040 8:13077900-13077922 ATGTTATCTGACCTGAAATATGG + Intergenic
1038204658 8:25454573-25454595 ATGTTGAGGCACATGGAAAAAGG + Intronic
1038684562 8:29704520-29704542 ATGTGTCCTCACATGGCAAAAGG + Intergenic
1039016804 8:33158430-33158452 ATGTTACCTTACATGGCAAAAGG - Intergenic
1039675319 8:39658274-39658296 ATGCTATTTCACATGGCAAAAGG + Intronic
1039997949 8:42550718-42550740 ATGTTACCTCACAAGACAAAAGG - Intronic
1040557353 8:48492645-48492667 ATGTTATATTACATGACAAAGGG + Intergenic
1040635080 8:49263838-49263860 ATGTTATTTTACATGGCAAAAGG + Intergenic
1040706408 8:50133819-50133841 ATGTAAACTCATTTGGAAAAGGG - Intronic
1040745627 8:50638054-50638076 ATGTTACCTTATGTGGAAAAAGG + Intronic
1040828345 8:51648255-51648277 ATTTTATCTGATAAGGAAAAGGG + Intronic
1040883084 8:52229663-52229685 ATGTTATCTTGCATGACAAAAGG - Intronic
1041147344 8:54891081-54891103 AAGATATCCCACTTGGAAAAGGG - Intergenic
1041155036 8:54977039-54977061 ATGTTCACTCCCATGGAAAGGGG + Intergenic
1041213895 8:55580635-55580657 ATGCTATCTTATATGGCAAAAGG - Intergenic
1041474150 8:58244709-58244731 ATGTTACCTTACATGCCAAACGG - Intergenic
1041716933 8:60941015-60941037 CTGTGTTCTCACATGGAAGAAGG + Intergenic
1041734022 8:61091033-61091055 CCGTTACCTCACATGGCAAAAGG + Intronic
1041734193 8:61092807-61092829 ATGTTATGACACATGGGAAAGGG - Intronic
1041888447 8:62841073-62841095 ATGTTATCTTACATAGAACAAGG + Intronic
1042062854 8:64840139-64840161 GTGTTATCTTACATGAATAAAGG + Intergenic
1042109189 8:65361319-65361341 ATGTTATGTTACATGGCAAGGGG - Intergenic
1042377180 8:68065052-68065074 AATTTATCTAGCATGGAAAATGG - Intronic
1042480659 8:69298430-69298452 ATGTTGTCTTACATGGCAAAAGG - Intergenic
1042525587 8:69761533-69761555 ATGTTATCTTACATGGCAAGAGG - Intronic
1042928118 8:73987722-73987744 ATATTACCTTACATGGCAAAAGG + Intergenic
1043169998 8:76953940-76953962 ATGTTATTTTACAAGGCAAAAGG + Intergenic
1043191879 8:77234740-77234762 ATTTTATCTTTCATGTAAAAAGG - Intergenic
1043447764 8:80335912-80335934 ATGTTACATTACATGGCAAAGGG - Intergenic
1043534823 8:81191093-81191115 ATGTTACCTTAAATGGTAAAAGG + Intergenic
1043986989 8:86705458-86705480 ATGTTACATTACATGGCAAAAGG + Intronic
1044226495 8:89724893-89724915 ATATTACCTCACATGGCAAGAGG - Intergenic
1044277001 8:90312871-90312893 ATGTTACCTTACATGCCAAAAGG + Intergenic
1044287289 8:90423792-90423814 ATATTATCTCACCTGTTAAATGG - Intergenic
1044300847 8:90581245-90581267 ATGTTACCTTATATGGCAAAAGG - Intergenic
1044355298 8:91215158-91215180 ATGTCACCTCACATAGCAAAAGG - Intronic
1044361144 8:91285501-91285523 ATGTGATCTTATTTGGAAAAAGG - Intronic
1044544736 8:93447135-93447157 ATGTTATATTATATGGCAAAGGG + Intergenic
1044828192 8:96219205-96219227 ATGTTAACCTACATGGAAAAAGG + Intergenic
1044828344 8:96220245-96220267 ATGTTAACCCACATGGCAAAAGG + Intergenic
1045149713 8:99390459-99390481 ATGTTCTGAAACATGGAAAAGGG - Intronic
1045340112 8:101246132-101246154 ATGTTACCTTACATGACAAAAGG + Intergenic
1045607899 8:103798789-103798811 ATGTTACCTTACCTGGCAAAGGG + Intronic
1045640116 8:104240238-104240260 ATGTTACTTTACATGGTAAAAGG - Intronic
1045651731 8:104347818-104347840 ATATTACCTCGCATGGTAAAAGG + Intronic
1045661373 8:104441411-104441433 ATGTTACTTTACATGGCAAAGGG + Intronic
1045682444 8:104677167-104677189 ATGTTAGGTTACATGGCAAAGGG + Intronic
1045804725 8:106145182-106145204 ATGTTATCTTATTTGGAAAAAGG + Intergenic
1045860970 8:106814756-106814778 ATGTTACCTTACATGGGAAAAGG - Intergenic
1045912860 8:107430553-107430575 ATGTTACCTTACATGGTAAAAGG + Intronic
1046018705 8:108637394-108637416 ATGTTATTTTACATTGAAAAAGG + Intronic
1046019589 8:108648483-108648505 ATGTTATTTTACATGGCAAAAGG + Intronic
1046275244 8:111950524-111950546 ATGTTTCCTTACATGGCAAAAGG + Intergenic
1046680072 8:117158885-117158907 ATGTTAAATCATATGGCAAAAGG + Intronic
1047009891 8:120660855-120660877 TTGTTATGTCACAGGGAACACGG + Intronic
1047023742 8:120805279-120805301 ATGTTAACTTACGTGGCAAAGGG + Intronic
1047036654 8:120946993-120947015 ATGTTATCTGTCACAGAAAACGG + Intergenic
1047065162 8:121273757-121273779 ATGTTTTCTTACATGGCAAAAGG - Intergenic
1047075353 8:121395355-121395377 ATATTATAAGACATGGAAAATGG + Intergenic
1047120828 8:121902682-121902704 ATGTTACCTGACATAGCAAAAGG + Intergenic
1047239245 8:123071456-123071478 CTGTTACCTTACTTGGAAAAAGG + Intronic
1047243173 8:123112773-123112795 ATGTTTTCTCTAATTGAAAAGGG - Intronic
1047467243 8:125128931-125128953 ATGTTATGTTACATGGAAAGGGG - Intronic
1047572201 8:126111240-126111262 ATGTTATATTACATGGCAAAGGG - Intergenic
1047852335 8:128870489-128870511 ATGTTTCCTCATCTGGAAAACGG - Intergenic
1048067001 8:130980271-130980293 ATGTGATCTTACTTGGAAATAGG - Intronic
1048075802 8:131069587-131069609 GTGTCATCTCACATGAATAATGG - Intergenic
1048182050 8:132204402-132204424 ATGTTATTTCAAAGGAAAAATGG - Intronic
1048230313 8:132633638-132633660 ATGTTACCTTACATGGCAAAAGG + Intronic
1048257221 8:132914174-132914196 ATGTTAGGTTACATGGCAAAGGG - Intronic
1048323507 8:133420963-133420985 ATGTTACTTTACATGGAAAAGGG + Intergenic
1048370783 8:133774316-133774338 ATGTTATTTCACATGGCAAAGGG + Intergenic
1048390741 8:133961664-133961686 TTGTTGTCTCACATGTAAAATGG + Intergenic
1048405962 8:134121299-134121321 CTGTTCTCTCATATGCAAAATGG + Intergenic
1048509926 8:135053070-135053092 ATATGATCTTACATGGCAAAAGG + Intergenic
1048556059 8:135477661-135477683 ATGTTACCTTACATGGTAAAAGG + Intronic
1048746868 8:137624323-137624345 CTGTGATCTCATTTGGAAAAGGG - Intergenic
1048949709 8:139485792-139485814 ATGTTATCTTGTTTGGAAAAGGG - Intergenic
1049003605 8:139841306-139841328 ATGGTACCTTACATGGCAAAAGG - Intronic
1049393732 8:142386193-142386215 ATGTCATGTTACATGGCAAAAGG - Intronic
1049537914 8:143190536-143190558 ATGTGAGCTCATTTGGAAAAAGG - Intergenic
1049876429 8:145025049-145025071 ATTTGATATCACATGGAAACAGG - Intergenic
1049967217 9:790617-790639 ATGTGATCTCATTTGGAAATAGG - Intergenic
1050055215 9:1645634-1645656 ATGTTACTTTACATGGTAAAAGG + Intergenic
1050108350 9:2189123-2189145 ATGTTATATTACATGGCAAAAGG - Intronic
1050344170 9:4669802-4669824 ATGTTACCTTACATGGTAAAGGG - Intergenic
1050429830 9:5551120-5551142 ATGTCACCTTACATGGCAAAAGG - Intronic
1050489795 9:6176533-6176555 ATGTTATTTTATATGGCAAAAGG + Intergenic
1050505444 9:6343277-6343299 ATGTAATCTCTCCTGGAGAATGG - Intergenic
1050746934 9:8887064-8887086 CAGTTAACTCACATGTAAAATGG - Intronic
1050795788 9:9539886-9539908 ATGGTATCACATTTGGAAAAGGG - Intronic
1050854444 9:10334236-10334258 ATGTTATATCAAATGTTAAAAGG + Intronic
1050915484 9:11125156-11125178 ATATTACCCTACATGGAAAAAGG - Intergenic
1051111156 9:13638266-13638288 ATGTTACCTTACATAGCAAAAGG - Intergenic
1051301712 9:15658513-15658535 ATGTTACCTTACATGGCAAATGG + Intronic
1051330874 9:16023878-16023900 ATGTTACCTTACATGGCAAAAGG + Intronic
1051599602 9:18859459-18859481 ATGCTACCTCACATGACAAAAGG - Intronic
1052159170 9:25234220-25234242 GTGTTATCTTGCATGGCAAACGG - Intergenic
1052214948 9:25954790-25954812 ATTCTAGCTCCCATGGAAAATGG + Intergenic
1052419424 9:28223332-28223354 CTGTGGTCTCACATGGAAGAAGG + Intronic
1052509412 9:29396333-29396355 ATGTTAGCTTATATGGCAAAAGG - Intergenic
1052657387 9:31380202-31380224 ACGTTACCTAACATGAAAAAAGG + Intergenic
1052708393 9:32021415-32021437 ATGTTATCTTACATGGAAAAAGG - Intergenic
1052832566 9:33228258-33228280 ATGTTACCTCACATGACAAAAGG - Intronic
1053063319 9:35048159-35048181 ATATTATTTCACATGGAAAAAGG - Intergenic
1053294971 9:36906202-36906224 ATGTGACCTTACATGGCAAAAGG + Intronic
1053377175 9:37617434-37617456 CTGTTTCCTCACATGTAAAATGG + Intronic
1053382279 9:37658809-37658831 ATGTGATCTTATTTGGAAAAAGG - Intronic
1053445348 9:38148934-38148956 ATGTTACTTTACATGGCAAAAGG + Intergenic
1053531710 9:38888697-38888719 ATGTTACCTGACATGGCCAAGGG + Intergenic
1053594785 9:39548781-39548803 ATGTGAACTTACATGAAAAATGG + Intergenic
1053852569 9:42303814-42303836 ATGTGAACTTACATGAAAAATGG + Intergenic
1054203934 9:62113125-62113147 ATGTTACCTGACATGGCCAAGGG + Intergenic
1054571469 9:66816186-66816208 ATGTGAACTTACATGAAAAATGG - Intergenic
1054634428 9:67475240-67475262 ATGTTACCTGACATGGCCAAGGG - Intergenic
1054754251 9:68941243-68941265 ATGTTACCTTATATGGCAAAAGG + Intronic
1054862426 9:69967569-69967591 ATGTTACCTTATATGGTAAAAGG - Intergenic
1054869960 9:70040073-70040095 ATGTGACCTCATTTGGAAAAAGG - Intergenic
1054919233 9:70525252-70525274 ATGTTACCTTATATGGCAAAAGG - Intergenic
1054960328 9:70961019-70961041 ATGTTATCTTACATGGCAAGAGG + Intronic
1055479862 9:76698795-76698817 ATGTTATCAGACATGAAAAAAGG + Intronic
1055501850 9:76909182-76909204 ATGTTAGGTTACATGGCAAAGGG - Intergenic
1055538589 9:77276940-77276962 ATGTTAACTCATATGGCAAAAGG - Intronic
1055567985 9:77588176-77588198 ATGTTACTTGACATGGCAAAAGG - Intronic
1055851504 9:80636358-80636380 ACTTTATCTCACCTGGGAAAAGG - Intergenic
1055890671 9:81120655-81120677 ATGTTTTCTCATCTGTAAAATGG + Intergenic
1056198326 9:84250144-84250166 ATGTTATCTTATGTGGCAAAAGG + Intergenic
1056233324 9:84568803-84568825 ATGTTATCTTATATGGAAGAAGG + Intergenic
1056315497 9:85385648-85385670 ATGTGTTCTCACATGGCAGAAGG + Intergenic
1056337100 9:85582898-85582920 ATGTTACTTTACATGGCAAAAGG + Intronic
1056389885 9:86131316-86131338 ATGTTATTTTACATGGCAAAAGG - Intergenic
1057223554 9:93271388-93271410 ATGTTAACTTGCATGGAAAAAGG + Intronic
1057533297 9:95874497-95874519 ATATTAGCTTACATGGCAAAAGG + Intergenic
1057841366 9:98487832-98487854 ACGTTATGTCACGTGGTAAAGGG + Intronic
1057843628 9:98505562-98505584 ATGTGACCTCATTTGGAAAAAGG + Intronic
1057853321 9:98582111-98582133 ATTTTATGTTACATGGCAAAAGG + Intronic
1057865383 9:98676024-98676046 ATGTTACCTTGCATGGCAAAAGG + Intronic
1057942535 9:99297501-99297523 CTGTTTTCTCACCTGCAAAATGG - Intergenic
1057945216 9:99321729-99321751 ATGTTACTTTACATGGCAAAAGG - Intergenic
1057978815 9:99636902-99636924 ATGTCACCTTACATGGCAAAAGG - Intergenic
1058003187 9:99888401-99888423 ATGTTATCTCCCATTTAATAAGG - Intergenic
1058135992 9:101308144-101308166 ATGTTACCTTACATGGCAAAAGG + Intronic
1058255043 9:102751312-102751334 ATGTTACTTTACATGGAAAAGGG + Intergenic
1058339964 9:103882803-103882825 ATATTATCTAACATAGCAAAAGG - Intergenic
1058375814 9:104320306-104320328 ATGTTATTTTATATGGAAACTGG + Intergenic
1058387506 9:104455606-104455628 AATGTATCTCAGATGGAAAAGGG + Intergenic
1058442008 9:105018076-105018098 ATGTTACCTTACATGGAAAAAGG - Intergenic
1058572603 9:106363788-106363810 CTGTGTTCTCACATGGAACAAGG + Intergenic
1058573580 9:106375112-106375134 GTGTTAAGTCACATGGCAAAAGG - Intergenic
1058577111 9:106415586-106415608 ATGTTACCTTACATGGCAAAAGG + Intergenic
1058712368 9:107691348-107691370 CAGTTTCCTCACATGGAAAATGG - Intergenic
1058714974 9:107715399-107715421 AAGTTTTCTCACCTGTAAAATGG + Intergenic
1058812846 9:108658037-108658059 ATTTTTTTTCACATGAAAAATGG + Intergenic
1059502683 9:114768480-114768502 TTGTGACCTCACATGGTAAAAGG - Intergenic
1059618799 9:115980594-115980616 CTGTTTTCTCACATGTAAATTGG + Intergenic
1059770188 9:117416566-117416588 CAGTTTCCTCACATGGAAAATGG - Intergenic
1060012229 9:120053858-120053880 ATGTTACATTACATGGCAAAGGG - Intergenic
1060144880 9:121243402-121243424 ATGTTAGCTTATATGGCAAAAGG - Intronic
1060204021 9:121671442-121671464 ATGTTGCCTTACATGGCAAAAGG - Intronic
1060541015 9:124430164-124430186 ATGTTACCTTACATGATAAAAGG + Intergenic
1060926999 9:127462014-127462036 CAGTTTTCTCACCTGGAAAATGG - Intronic
1061674382 9:132207589-132207611 ATGTGACCTTACATGGAAACGGG - Intronic
1061703758 9:132436421-132436443 ATGTGACCTCATTTGGAAAAAGG - Intronic
1062135867 9:134927807-134927829 ATCTTATGTCACATGGTAGAAGG - Intergenic
1062263035 9:135672316-135672338 ATGTCACCTCATATGGCAAAGGG - Intergenic
1062486960 9:136782700-136782722 ATTTAATATCACATGGAAACAGG - Intergenic
1185787434 X:2902616-2902638 ATGTTAGCTAACATGGCAAAAGG + Intergenic
1185808930 X:3087159-3087181 ATGTGATATTACATGGTAAAAGG - Intronic
1186002317 X:5026557-5026579 ATGTTACCTAACATGGCAAAAGG + Intergenic
1186083698 X:5962785-5962807 CTGTGTCCTCACATGGAAAAAGG - Intronic
1186098205 X:6126670-6126692 ATGTTATCTCATTTGTAAACTGG - Intronic
1186295752 X:8145848-8145870 ATGTTTTCTTACATGACAAAAGG - Intergenic
1186304169 X:8236300-8236322 ATATTAGCTTACATGGCAAAAGG - Intergenic
1186331601 X:8540640-8540662 ATGTTAAATCACCTGCAAAATGG - Intronic
1186365961 X:8893584-8893606 ATGTTACCTTACATGGCAAAAGG - Intergenic
1186420972 X:9426112-9426134 ATGTTACTTTACATGGCAAAGGG + Intergenic
1186526059 X:10249410-10249432 ATGTTACCCTACATGGCAAAAGG + Intergenic
1186566855 X:10672315-10672337 GTGTTATGTTACATGGCAAAAGG + Intronic
1186594027 X:10961107-10961129 ATGTTACCTTACATGGCAAAAGG + Intergenic
1186622864 X:11259922-11259944 ATGTTATTTTACATGGTAAAAGG + Intronic
1186624481 X:11278207-11278229 GTGTTACCTTACATGGCAAAAGG + Intronic
1186698865 X:12067909-12067931 ATGTTACCTCATATGCCAAAGGG + Intergenic
1186723541 X:12331262-12331284 ATGTTATATCACTTTCAAAATGG - Intronic
1187077363 X:15948418-15948440 ATGTGACCTTACATGGCAAAAGG - Intergenic
1187091497 X:16101670-16101692 ATGTTATCTTCTATGGAAACAGG + Intergenic
1187205839 X:17180409-17180431 CTGTTTCCTCACCTGGAAAAAGG + Intergenic
1187295887 X:18000096-18000118 CTGTTACCTTACATGGCAAAAGG - Intergenic
1187410185 X:19044453-19044475 ATGTTACCTTACATAGCAAAGGG - Intronic
1187536793 X:20148294-20148316 ATGTTATCTCACATGGCAACAGG + Intergenic
1187780876 X:22822557-22822579 ATGTCACCTTACATGCAAAAGGG - Intergenic
1187903796 X:24048630-24048652 CTGTTTTCTCACCTGTAAAATGG + Intergenic
1188243585 X:27816262-27816284 ATGTTATGTTACATGGCCAAAGG - Intronic
1188324023 X:28777370-28777392 ATGTTACCTTACATGTCAAAAGG - Intronic
1188325726 X:28798550-28798572 ATGTCATATTACATGGCAAAAGG - Intronic
1188355245 X:29182763-29182785 ATGTTAGCATACATGGCAAAAGG + Intronic
1188472423 X:30555361-30555383 CTGTTAACTTACATGGCAAAAGG + Intergenic
1188506896 X:30892646-30892668 ATTTTCTCTCCCATTGAAAAAGG - Intronic
1188584165 X:31752179-31752201 ATGTTACCTTACATGGCAAAAGG - Intronic
1188620646 X:32218734-32218756 CTGTTTTCTCCAATGGAAAATGG - Intronic
1188787888 X:34371244-34371266 ATGTGATCTCATTTGGAAATAGG + Intergenic
1188930547 X:36104857-36104879 ATGTTTCCTCACATATAAAATGG + Intronic
1189020796 X:37336821-37336843 ATATTATCTAACATGGAAAAAGG + Intergenic
1189097693 X:38157638-38157660 ATGTTACCTTACATGAAAAAAGG - Intronic
1189311615 X:40022819-40022841 CTGTGAGCTCAGATGGAAAAAGG + Intergenic
1189532692 X:41902573-41902595 ATGTTACTTTACATGGTAAAAGG - Intronic
1189561183 X:42192920-42192942 ATGTTACCTTACAAGGCAAAAGG + Intergenic
1189595423 X:42559878-42559900 ATGTTACCTTACATGGCAGAAGG - Intergenic
1189705182 X:43752441-43752463 ATGTTACCTTACATGGCAAAGGG - Intergenic
1189730166 X:44011836-44011858 ACGTTATGTTACATGGCAAAGGG - Intergenic
1189800198 X:44684831-44684853 ATATTATCTTACATGGCAAAAGG + Intergenic
1189900518 X:45701530-45701552 GTGTTATCTTACACGGCAAAAGG + Intergenic
1189957808 X:46293996-46294018 ATGTTATCTTATTTGAAAAAGGG + Intergenic
1190577229 X:51852339-51852361 ATGTTACCTTACATGGCAAATGG - Intronic
1190781914 X:53604955-53604977 ATGGTCTCTCACCTGGTAAATGG + Intronic
1190876041 X:54460971-54460993 AAGTTTTCTCACATGTAGAATGG - Intronic
1191102493 X:56746990-56747012 ATGTTATTTTACAAGGCAAAAGG - Intergenic
1191677661 X:63808597-63808619 ATGTTAGGTTACATGGCAAAAGG + Intergenic
1191920857 X:66255526-66255548 CTGTTTTCTCATCTGGAAAATGG + Intronic
1191939690 X:66464670-66464692 ATTTGATATCACATGGAAACAGG - Intergenic
1192105906 X:68316827-68316849 ATGTTATATTGCATGGCAAAAGG - Intronic
1192495570 X:71614790-71614812 ATGTTACCTTAGATGGCAAAAGG - Intergenic
1192570921 X:72203729-72203751 CTGTTTCCTCACATGAAAAATGG + Intronic
1192820852 X:74643490-74643512 ATGTTAGCTTACATTGTAAAGGG - Intergenic
1193312591 X:80025299-80025321 ATTTTATCTCACAGAGATAATGG - Intronic
1193331956 X:80244819-80244841 ATGTTACTTTACATGGCAAAAGG + Intergenic
1193426592 X:81347485-81347507 ATGTTACCTTATTTGGAAAAAGG - Intergenic
1193629696 X:83867818-83867840 ATGTTATCTTATATGACAAAAGG - Intronic
1193679327 X:84499030-84499052 ATGTTTTCTCATTTGTAAAATGG + Intronic
1193753688 X:85379689-85379711 ATTTGAGCTCAAATGGAAAATGG + Exonic
1193895258 X:87107031-87107053 ATTTTGTTTCACATGGAAAATGG - Intergenic
1193905413 X:87237773-87237795 ATCTTATGTCACATGATAAAAGG + Intergenic
1193978408 X:88151650-88151672 CTGTGTTCTCACTTGGAAAAAGG + Intergenic
1193997344 X:88383033-88383055 ATGTGTTCTCACATGGCAGATGG + Intergenic
1194020449 X:88684043-88684065 CTGCAATCTCACATGGAAGAAGG + Intergenic
1194281912 X:91963458-91963480 AGGTGATCTCAGATGGAAATGGG - Intronic
1194355002 X:92871988-92872010 ATGTTACCTTACATAGCAAAAGG - Intergenic
1194408359 X:93526497-93526519 ATGTTGCCTTACATGGAAAAAGG + Intergenic
1194454954 X:94092270-94092292 ATCTTACCTTACATGGCAAACGG + Intergenic
1194475006 X:94347684-94347706 ATGTTATCTCATTTGGAAAAGGG - Intergenic
1194754907 X:97727436-97727458 ATATTACCTTACATGGCAAAAGG + Intergenic
1194812161 X:98399953-98399975 ATGTTACATTACATGGCAAATGG + Intergenic
1194883517 X:99283601-99283623 ATGTCATCTCACTTTGAAAATGG - Intergenic
1194915991 X:99709327-99709349 ATGTTACATTACATGGCAAAAGG - Intergenic
1195098636 X:101531286-101531308 ATGTTACCTCATATAGCAAAAGG - Intronic
1195486444 X:105413286-105413308 ATGTTATGTTATATGGAAATGGG + Intronic
1195651861 X:107293113-107293135 GTGTTTTCTCACCTGTAAAATGG - Intergenic
1195765712 X:108294725-108294747 ATGTTACCTCATCTGCAAAATGG + Intronic
1196059269 X:111389938-111389960 ATGTTATGTTTCATGGCAAAAGG + Intronic
1196083801 X:111661892-111661914 ATGTTACCTGACATGGTAAAAGG + Intergenic
1196138645 X:112236803-112236825 ATGTTACCTTACATGGCAAAAGG + Intergenic
1196284896 X:113868073-113868095 ATGTTATCTTACATAGCAAAAGG + Intergenic
1196321374 X:114344392-114344414 CTGTTTTCTCACATGGCAGAAGG - Intergenic
1196641527 X:118068470-118068492 AGGTTATCTCACATGGGGGATGG - Intronic
1196676080 X:118421351-118421373 ATGTTATTTCTCATGTAAAAAGG - Intronic
1196714393 X:118797597-118797619 ATGTAACTTTACATGGAAAAAGG + Intergenic
1196804075 X:119569327-119569349 ATGTTACCTTACATGGCAAAAGG - Intergenic
1196974854 X:121148130-121148152 ATGTGTCCTCACATGGAAGAAGG - Intergenic
1197116214 X:122836767-122836789 ATGTTACCCTACATGGCAAAAGG + Intergenic
1197134757 X:123048227-123048249 ATATTACTTCACATGGAAAAGGG + Intergenic
1197201367 X:123751657-123751679 ATGTTAGGTTACATGGCAAAGGG + Intergenic
1197210382 X:123823512-123823534 ATGTTATCTCAGAGGGTACAGGG - Intergenic
1197312540 X:124923566-124923588 ATGTTAGGTTACATGGCAAAGGG + Intronic
1197454243 X:126658057-126658079 ATGTGACCTCACTTGGAAACAGG + Intergenic
1197626355 X:128806679-128806701 ATGATATCCTACCTGGAAAATGG + Intergenic
1197989782 X:132305659-132305681 ATGTTACCTTACAGGCAAAAGGG + Intergenic
1198057388 X:133008430-133008452 ATGATATGTTACATGGCAAAGGG - Intergenic
1198187454 X:134267229-134267251 ATGATACCACCCATGGAAAAAGG + Intergenic
1198263084 X:134983878-134983900 CTGTTTCCTCACATGGCAAAAGG - Intergenic
1198478621 X:137019667-137019689 CTGTTTTCTCAGCTGGAAAATGG - Intergenic
1198495036 X:137183812-137183834 ATGTTAGGTTACATGGAAAGGGG - Intergenic
1198506674 X:137308260-137308282 CTGTTTTCTCATATGTAAAATGG + Intergenic
1198553781 X:137771559-137771581 TGGATATCTCACATGGAAGACGG + Intergenic
1198680578 X:139177715-139177737 ATGTTCACTCCCCTGGAAAAGGG - Intronic
1198701753 X:139404527-139404549 CTGTTTTCTCACCTGTAAAATGG + Intergenic
1198910717 X:141610494-141610516 ATATTACCTTACATGGTAAAAGG - Intronic
1198988899 X:142488258-142488280 ATATAATCTCAAATGGAAGAGGG + Intergenic
1199054063 X:143271558-143271580 ATGCTACCTTACATGGCAAAAGG - Intergenic
1199115394 X:143985997-143986019 TTGTCATCTCCCATGGAAAAAGG - Intergenic
1199157861 X:144571752-144571774 ATGTTATCTCCCAAGAAAATGGG + Intergenic
1199611655 X:149621943-149621965 ATGTTCTGTTACATGGCAAAGGG - Intronic
1199666047 X:150097369-150097391 ATGTGACCTTACAAGGAAAAAGG - Intergenic
1199768339 X:150956979-150957001 ATGTTGCCTTATATGGAAAAAGG - Intergenic
1199903729 X:152203879-152203901 ATGTTAGGTTACATGGAAAGGGG - Intronic
1200260301 X:154612195-154612217 ATTTGATATCACATGGAAACAGG - Intergenic
1200599509 Y:5188114-5188136 AGGTGATCTCAGATGGAAATGGG - Intronic
1200663362 Y:5989003-5989025 ATGTTACCTTACATAGCAAAAGG - Intergenic
1201225098 Y:11810968-11810990 ATGTTATCTTACATGGCAAAGGG - Intergenic
1201316834 Y:12655678-12655700 ATATTTCCTCACATGGCAAAAGG - Intergenic
1201431014 Y:13901970-13901992 ATGTTAAATCACCTGCAAAATGG + Intergenic
1201492417 Y:14556815-14556837 GTGTGGTCTTACATGGAAAAGGG - Intronic
1201501783 Y:14651340-14651362 ATGTTATCTCACTTGTAAACTGG + Intronic
1201866080 Y:18656906-18656928 ATGTGACCTCATTTGGAAAAAGG + Intergenic
1201935889 Y:19410811-19410833 ATGGTTTGTCCCATGGAAAATGG + Intergenic
1202264071 Y:22999795-22999817 TCATTATCTCACATGGATAAAGG + Intronic
1202417062 Y:24633537-24633559 TCATTATCTCACATGGATAAAGG + Intronic
1202453725 Y:25036549-25036571 TCATTATCTCACATGGATAAAGG - Intronic