ID: 1124648135

View in Genome Browser
Species Human (GRCh38)
Location 15:31454229-31454251
Sequence GCGGCGGGTGTGTTTCGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124648135_1124648143 28 Left 1124648135 15:31454229-31454251 CCAGGCCGAAACACACCCGCCGC No data
Right 1124648143 15:31454280-31454302 AGAGCCTCACTCTGTTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124648135 Original CRISPR GCGGCGGGTGTGTTTCGGCC TGG (reversed) Intergenic