ID: 1124650383

View in Genome Browser
Species Human (GRCh38)
Location 15:31469551-31469573
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124650383_1124650394 25 Left 1124650383 15:31469551-31469573 CCTTGTCCAGGAGGGCGGGGCTC No data
Right 1124650394 15:31469599-31469621 CTGGGTCTGCAGCTGTGGGTTGG No data
1124650383_1124650391 20 Left 1124650383 15:31469551-31469573 CCTTGTCCAGGAGGGCGGGGCTC No data
Right 1124650391 15:31469594-31469616 GAGGCCTGGGTCTGCAGCTGTGG No data
1124650383_1124650389 6 Left 1124650383 15:31469551-31469573 CCTTGTCCAGGAGGGCGGGGCTC No data
Right 1124650389 15:31469580-31469602 TCTTCGAAGCACAGGAGGCCTGG No data
1124650383_1124650390 7 Left 1124650383 15:31469551-31469573 CCTTGTCCAGGAGGGCGGGGCTC No data
Right 1124650390 15:31469581-31469603 CTTCGAAGCACAGGAGGCCTGGG No data
1124650383_1124650385 -2 Left 1124650383 15:31469551-31469573 CCTTGTCCAGGAGGGCGGGGCTC No data
Right 1124650385 15:31469572-31469594 TCCTGCCTTCTTCGAAGCACAGG No data
1124650383_1124650387 1 Left 1124650383 15:31469551-31469573 CCTTGTCCAGGAGGGCGGGGCTC No data
Right 1124650387 15:31469575-31469597 TGCCTTCTTCGAAGCACAGGAGG No data
1124650383_1124650396 29 Left 1124650383 15:31469551-31469573 CCTTGTCCAGGAGGGCGGGGCTC No data
Right 1124650396 15:31469603-31469625 GTCTGCAGCTGTGGGTTGGGCGG No data
1124650383_1124650395 26 Left 1124650383 15:31469551-31469573 CCTTGTCCAGGAGGGCGGGGCTC No data
Right 1124650395 15:31469600-31469622 TGGGTCTGCAGCTGTGGGTTGGG No data
1124650383_1124650392 21 Left 1124650383 15:31469551-31469573 CCTTGTCCAGGAGGGCGGGGCTC No data
Right 1124650392 15:31469595-31469617 AGGCCTGGGTCTGCAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124650383 Original CRISPR GAGCCCCGCCCTCCTGGACA AGG (reversed) Intergenic