ID: 1124650384

View in Genome Browser
Species Human (GRCh38)
Location 15:31469557-31469579
Sequence AGGCAGGAGCCCCGCCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 953
Summary {0: 10, 1: 51, 2: 99, 3: 182, 4: 611}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124650384_1124650389 0 Left 1124650384 15:31469557-31469579 CCAGGAGGGCGGGGCTCCTGCCT 0: 10
1: 51
2: 99
3: 182
4: 611
Right 1124650389 15:31469580-31469602 TCTTCGAAGCACAGGAGGCCTGG No data
1124650384_1124650392 15 Left 1124650384 15:31469557-31469579 CCAGGAGGGCGGGGCTCCTGCCT 0: 10
1: 51
2: 99
3: 182
4: 611
Right 1124650392 15:31469595-31469617 AGGCCTGGGTCTGCAGCTGTGGG No data
1124650384_1124650394 19 Left 1124650384 15:31469557-31469579 CCAGGAGGGCGGGGCTCCTGCCT 0: 10
1: 51
2: 99
3: 182
4: 611
Right 1124650394 15:31469599-31469621 CTGGGTCTGCAGCTGTGGGTTGG No data
1124650384_1124650390 1 Left 1124650384 15:31469557-31469579 CCAGGAGGGCGGGGCTCCTGCCT 0: 10
1: 51
2: 99
3: 182
4: 611
Right 1124650390 15:31469581-31469603 CTTCGAAGCACAGGAGGCCTGGG No data
1124650384_1124650391 14 Left 1124650384 15:31469557-31469579 CCAGGAGGGCGGGGCTCCTGCCT 0: 10
1: 51
2: 99
3: 182
4: 611
Right 1124650391 15:31469594-31469616 GAGGCCTGGGTCTGCAGCTGTGG 0: 20
1: 18
2: 85
3: 151
4: 710
1124650384_1124650387 -5 Left 1124650384 15:31469557-31469579 CCAGGAGGGCGGGGCTCCTGCCT 0: 10
1: 51
2: 99
3: 182
4: 611
Right 1124650387 15:31469575-31469597 TGCCTTCTTCGAAGCACAGGAGG No data
1124650384_1124650385 -8 Left 1124650384 15:31469557-31469579 CCAGGAGGGCGGGGCTCCTGCCT 0: 10
1: 51
2: 99
3: 182
4: 611
Right 1124650385 15:31469572-31469594 TCCTGCCTTCTTCGAAGCACAGG No data
1124650384_1124650395 20 Left 1124650384 15:31469557-31469579 CCAGGAGGGCGGGGCTCCTGCCT 0: 10
1: 51
2: 99
3: 182
4: 611
Right 1124650395 15:31469600-31469622 TGGGTCTGCAGCTGTGGGTTGGG No data
1124650384_1124650396 23 Left 1124650384 15:31469557-31469579 CCAGGAGGGCGGGGCTCCTGCCT 0: 10
1: 51
2: 99
3: 182
4: 611
Right 1124650396 15:31469603-31469625 GTCTGCAGCTGTGGGTTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124650384 Original CRISPR AGGCAGGAGCCCCGCCCTCC TGG (reversed) Intergenic
900150852 1:1178860-1178882 AGGCAGGCGCCCCACCCAGCAGG + Intronic
900160005 1:1219034-1219056 AGACCGGGGCCCCACCCTCCAGG + Intronic
900191636 1:1354631-1354653 AGGCGGGAGCCCACCCCACCGGG - Intronic
900205695 1:1431128-1431150 AGGCAGGGGCCCCACCCCCTAGG + Intergenic
900233881 1:1577400-1577422 GGACAGGAGCCCCACCCTCCTGG + Intergenic
900238589 1:1604094-1604116 TGGGAGGAGCCCCATCCTCCAGG + Intergenic
900238671 1:1604531-1604553 ATGCAGCAGCCCCGGCTTCCAGG + Intergenic
900275591 1:1824850-1824872 AGGCATGAGCCCCCCACACCCGG + Intronic
900379919 1:2378643-2378665 TGGCAGCAGCGCGGCCCTCCGGG - Intronic
900476881 1:2880199-2880221 AGCCAGGACCCCCTCCCTGCAGG + Intergenic
900482509 1:2905912-2905934 AGGGAGGAGCCCAGCCGTGCGGG + Intergenic
900536089 1:3178482-3178504 CTCCAGGAGCCCCGGCCTCCGGG - Intronic
901641111 1:10693744-10693766 AGGCAGCCGCCCGACCCTCCCGG + Intronic
901691065 1:10973764-10973786 AGGCAGGAGCCCCACCCTCCTGG + Intronic
901757839 1:11452156-11452178 ACACAGGAACCCCACCCTCCTGG + Intergenic
901811452 1:11769025-11769047 GGCCAGGGTCCCCGCCCTCCAGG + Intronic
901831277 1:11894132-11894154 ATGCAGTAGCAGCGCCCTCCAGG + Intergenic
901936470 1:12630432-12630454 AGGCAGGAGCCCTGCCCTCTGGG + Intergenic
901936488 1:12630512-12630534 AGGCAGGAGCCCCATACCCCTGG + Intergenic
902515293 1:16986654-16986676 AGGCAGGAGCCACGCCCCCCCGG + Intronic
902729777 1:18361907-18361929 AGACAAGAGCCCTCCCCTCCTGG - Intronic
902922615 1:19675815-19675837 AAGCAGGAGCCTCTTCCTCCAGG + Intronic
903672232 1:25043281-25043303 AGGTGGGAGCCCCACTCTCCTGG - Intergenic
903944061 1:26950838-26950860 AGGGAGGAGCCACTCACTCCTGG + Intronic
904207337 1:28863616-28863638 AGGTTGAAGCCCCGCCTTCCTGG - Exonic
904365829 1:30010442-30010464 AGGCAGGAGCCCAGCCCTCCTGG - Intergenic
904443678 1:30550661-30550683 AGACAGGATCCCTGCCTTCCTGG + Intergenic
904697753 1:32339772-32339794 AGGCAGGGTCCCAGCCCTCAGGG + Intergenic
904893376 1:33795754-33795776 AGGCCTGACCCCTGCCCTCCAGG - Intronic
905545930 1:38800869-38800891 AGGCGGGATCCCTGCCCTCCTGG + Intergenic
905703963 1:40040531-40040553 GGGAAAGAGCCCCGCCCTCAAGG - Exonic
905839365 1:41162023-41162045 AGGCAGGAGTCCCGCCATCCTGG + Intronic
905839384 1:41162104-41162126 AGGCAGGAGCCCTGCCGTGACGG + Intronic
905960141 1:42036041-42036063 AGCGAGCATCCCCGCCCTCCGGG - Intergenic
906082520 1:43102527-43102549 AGGCAGAAGCCCTGCCTTTCTGG - Intergenic
906082536 1:43102617-43102639 AGGCAGGATCTCTGCCCTACTGG - Intergenic
906185695 1:43860354-43860376 CGTCAGGAGCCCAGGCCTCCTGG - Intronic
906208116 1:43997688-43997710 AGACTGGGGCCCTGCCCTCCTGG - Exonic
906315940 1:44786446-44786468 ACGCAGGTGCGCCGCCCGCCGGG - Exonic
906321550 1:44820480-44820502 AGGCACGACCCCACCCCTCCTGG + Intronic
907297803 1:53466661-53466683 AGGCCCCAGGCCCGCCCTCCTGG + Exonic
907562812 1:55406434-55406456 AGACAAGTGCCCTGCCCTCCAGG - Intergenic
907603542 1:55793904-55793926 CGGCAGGAGCCCCGCCCTCCTGG + Intergenic
907682568 1:56578453-56578475 AGGCAGGAGCCCGACTCTCGGGG + Intronic
907714835 1:56917002-56917024 AGAGGGGAGCACCGCCCTCCTGG - Intronic
907761702 1:57367904-57367926 AGGCAGAAGCACCTCCCTCCTGG + Intronic
909197658 1:72648365-72648387 GGGGAGGAGCCCCGCCCTTCTGG + Intergenic
911025978 1:93435555-93435577 GGGTAGAAGCCCTGCCCTCCAGG - Intergenic
911188464 1:94926485-94926507 ACGCAGGAGCGCCCCCTTCCCGG + Intronic
911288778 1:96029215-96029237 AGGAAGGAGCCCTACCCTCCTGG - Intergenic
912370678 1:109171816-109171838 AGGCAGGAGCACAGCCCACCAGG - Intronic
912509223 1:110176890-110176912 GGGCATGGGCCCTGCCCTCCAGG + Intronic
912924958 1:113905530-113905552 ACGCAGGAGCCCTGCCCCCGTGG + Exonic
913176497 1:116277369-116277391 GGGCAGGAGCCCCACCTTCCAGG - Intergenic
914392846 1:147237336-147237358 AGGCAGGAGCCCCACCCTCCTGG - Intronic
915203731 1:154253278-154253300 AGGCATGAGCCACGGCTTCCGGG + Intronic
915217622 1:154350567-154350589 AGCAAGGAGCCCCGCCCCTCAGG + Exonic
915636832 1:157193337-157193359 AGGCAGAGGCCCCTCCCTCCTGG - Intergenic
915751201 1:158212725-158212747 AGGCAACAGCCCTGCCCTCCTGG + Intergenic
915935134 1:160086038-160086060 AGGCAGGCCCCTCACCCTCCAGG + Intronic
916648971 1:166817107-166817129 AGGCAGAAGACACGCCCTCCTGG - Intergenic
916966253 1:169945385-169945407 GGCCAGGAGCCCCACACTCCTGG - Intronic
918381492 1:183960029-183960051 AGGCAGAAGCCCTGCCATCAGGG - Intronic
919083346 1:192891868-192891890 AGGCAGGATTCCTGCCCTCCTGG - Intergenic
919165433 1:193885553-193885575 AAGTAGGAGCCCTGCCTTCCCGG - Intergenic
919191889 1:194230866-194230888 AGGCAGGAGTCCCACCCTCCTGG - Intergenic
919205838 1:194420842-194420864 AGGCAGGAGCCCAGCCCTCCTGG - Intergenic
919302646 1:195790669-195790691 GGGTGGGAGCCCTGCCCTCCTGG + Intergenic
919314114 1:195948851-195948873 GGGCAGTAGGCCTGCCCTCCTGG + Intergenic
919718370 1:200804642-200804664 AGACAGGATCCCTGCTCTCCAGG + Intronic
919992477 1:202718062-202718084 AGGCAGGGACCCTGCCCTCAGGG - Intergenic
920009450 1:202857292-202857314 AAACAGGAGCCCCTCCCACCTGG + Intergenic
920269427 1:204752141-204752163 GGGCAGGAACCCCAGCCTCCTGG + Intergenic
921097674 1:211901351-211901373 AGGGAGGAGCTCTGCCCTCCGGG + Intergenic
922244653 1:223783896-223783918 AGGGAGGACCCCTGACCTCCAGG + Intronic
922748323 1:228059565-228059587 AGGGAGGAGTCCCGCCCCCAGGG - Exonic
922748333 1:228059584-228059606 AGGTAGGAGCCCCACCCCCAGGG - Exonic
922776921 1:228219097-228219119 AGGCACACGCCCTGCCCTCCTGG + Intronic
924418315 1:243882914-243882936 AGGCTGCAGCCTCGACCTCCTGG + Intergenic
924605233 1:245528496-245528518 AGGTTGGAGCCCACCCCTCCAGG + Intronic
924672914 1:246147621-246147643 AGGCAGGCGCCCCGCCTTCCTGG + Intronic
924783901 1:247176822-247176844 AGGCAGGAGGCCCATCCTCCTGG + Intergenic
1063249459 10:4258175-4258197 AAGCAGGAGAACAGCCCTCCTGG - Intergenic
1063369700 10:5513086-5513108 GGGCAGGAGCCCAGGCCACCCGG - Intergenic
1064444412 10:15380740-15380762 AGGCAAAAGCCCTGCCCTCATGG - Intergenic
1065869548 10:29944791-29944813 AGGCTGGAGAGCAGCCCTCCAGG - Intergenic
1065971054 10:30806360-30806382 AGGCAGCAGCCCAGCCTTGCAGG + Intergenic
1066986881 10:42475922-42475944 AGGCAGGAGTCTCGGCCTCTCGG + Intergenic
1066987141 10:42477484-42477506 AAGCAGGAGTCTCGGCCTCCCGG + Intergenic
1067477948 10:46578782-46578804 AGGCTGTAGCCCTGCTCTCCGGG + Intronic
1067578715 10:47425726-47425748 AGGCAGGACCACAGCCCACCAGG + Intergenic
1067616789 10:47763005-47763027 AGGCTGTAGCCCTGCTCTCCGGG - Intergenic
1068060759 10:52064631-52064653 AGGCAGGAGCCCTGTCTTCCAGG - Intronic
1068280000 10:54855299-54855321 AAGCAGGAGTCCCATCCTCCTGG - Intronic
1068352642 10:55869072-55869094 AGGCATGAGCCCCCCACGCCCGG + Intergenic
1068744957 10:60519356-60519378 AGGCAAAATCCCTGCCCTCCAGG + Intronic
1068830065 10:61483739-61483761 AGGCAGGAGCCAGTCCCTGCAGG + Intergenic
1068967217 10:62924625-62924647 AGGCAGGCGCTCCGCCCTCCTGG - Intergenic
1069212404 10:65778982-65779004 AGGCGAGAGCCCCACACTCCTGG + Intergenic
1069592852 10:69652604-69652626 AGGCAAGAGTCCTGCCCTCCTGG + Intergenic
1069793849 10:71040162-71040184 AGGGAGCAGCCTGGCCCTCCAGG + Intergenic
1069904977 10:71726840-71726862 AGGCAGGAGCCCACCACGCCTGG - Intronic
1070091892 10:73295037-73295059 AGGCATGAGCCACCCGCTCCTGG - Intronic
1070289798 10:75106700-75106722 AAGCAGGATCCCTGCCCTCTTGG - Intronic
1070479696 10:76870202-76870224 GGACAGGAGCCCCGCCCGCAAGG - Intronic
1070594402 10:77821899-77821921 AGGAAGGAGCCAGGCCCCCCAGG - Exonic
1071067803 10:81656699-81656721 AATCAGCAGCCCCTCCCTCCAGG - Intergenic
1071572899 10:86707822-86707844 AAGGAGGAGCCTGGCCCTCCAGG + Intronic
1072154868 10:92715094-92715116 AGGCAGGGGCCCTGCCCCCCTGG - Intergenic
1072237606 10:93466601-93466623 AGCCAGGTGCCTGGCCCTCCTGG - Intronic
1072413565 10:95228515-95228537 AGTCAGGATCCCCACTCTCCAGG - Intronic
1072452175 10:95547348-95547370 AGACAAGAGCCCTGCCCTCTGGG + Intronic
1072470349 10:95707284-95707306 AGGTAGAAGCTCCACCCTCCTGG - Intergenic
1072753200 10:97999204-97999226 AGGCATGAGCCCCACCATCCTGG + Intronic
1074028658 10:109663278-109663300 AGGCAGGAGGACCACCTTCCTGG + Intergenic
1074028675 10:109663359-109663381 AGGCACGAGCCCTGTCCCCCCGG + Intergenic
1074185994 10:111099811-111099833 AGGAAGGAGTCCAACCCTCCAGG - Intergenic
1074248062 10:111714222-111714244 AGGCAGGAGCCCTGCCCTCCTGG - Intergenic
1074248085 10:111714313-111714335 AAGCAGCAGCCCCACCCTCTTGG - Intergenic
1074483951 10:113854882-113854904 AGGCTGCGGCCCCGGCCTCCGGG - Exonic
1075007669 10:118842367-118842389 AGGCAGGAGCCCAGCGCCCCCGG + Intergenic
1075951263 10:126479559-126479581 GGGCAGGACCCACCCCCTCCAGG + Intronic
1076078132 10:127554037-127554059 AGGCAGCATCCCTGCCCTCCGGG + Intergenic
1076395662 10:130136155-130136177 AGCCAGGAGCCCCGACAGCCAGG + Intergenic
1076434145 10:130428026-130428048 GGACAGGGGCCCCTCCCTCCAGG - Intergenic
1076683898 10:132188052-132188074 AGGCAGCAGCCCCTCCCATCTGG - Intronic
1076816428 10:132917232-132917254 CGGCAGGTGCCCTGTCCTCCAGG + Intronic
1076836122 10:133021843-133021865 AGCCAGGCGCGCCGACCTCCAGG - Intergenic
1076948289 10:133665939-133665961 TAGCGGGACCCCCGCCCTCCGGG + Intergenic
1076949278 10:133669249-133669271 TAGCGGGACCCCCGCCCTCCGGG + Intronic
1076950262 10:133672548-133672570 TAGCGGGACCCCCGCCCTCCGGG + Intergenic
1076951247 10:133675847-133675869 TAGCGGGACCCCCGCCCTCCGGG + Intergenic
1076952237 10:133679157-133679179 TAGCGGGACCCCCGCCCTCCGGG + Intergenic
1076953225 10:133682467-133682489 TAGCGGGACCCCCGCCCTCCGGG + Intergenic
1076955193 10:133742118-133742140 TAGCGGGACCCCCGCCCTCCGGG + Intergenic
1076956183 10:133745428-133745450 TAGCGGGACCCCCGCCCTCCGGG + Intergenic
1076957171 10:133748737-133748759 TAGCGGGACCCCCGCCCTCCGGG + Intergenic
1076958160 10:133752047-133752069 TAGCGGGACCCCCGCCCTCCGGG + Intergenic
1076959144 10:133755346-133755368 TAGCGGGACCCCCGCCCTCCGGG + Intergenic
1076960133 10:133758656-133758678 TAGCGGGACCCCCGCCCTCCGGG + Intergenic
1077012223 11:384454-384476 AGGCAGGAGCTCGGCCCTCCTGG + Intergenic
1077391765 11:2303608-2303630 AGGCAGTATCCCTGACCTCCTGG - Intronic
1077912617 11:6586680-6586702 AGGCGGGAGCCCCGCCCTCCTGG + Intronic
1078179823 11:9002627-9002649 ATGCAGAAGCTCTGCCCTCCTGG + Intronic
1078315322 11:10289380-10289402 AGGCAGCAGCCCCGCCCTCCTGG - Intronic
1078345651 11:10545221-10545243 GGGTGGGAGCCCCACCCTCCTGG - Intergenic
1078623822 11:12935061-12935083 AGGCAGGTGGGCCGCCATCCTGG + Intronic
1078740883 11:14065187-14065209 AGGCAGGTGGCCCGCCCTCAAGG + Intronic
1078836521 11:15035378-15035400 AGGCAGGATCCCTGCCCTCCTGG - Intronic
1078836545 11:15035469-15035491 AGGCAGGAGCCCCGCCCTCCTGG - Intronic
1079030693 11:16984003-16984025 AGGCTGCAGCCTCGACCTCCTGG - Intronic
1079184255 11:18221754-18221776 AGACAGGAGCCTTGCCCTCCTGG - Intronic
1079279653 11:19075802-19075824 AGACATGAGCCCTGCCCTCCTGG - Intergenic
1079504104 11:21133864-21133886 GGGTAGGAGCCCCACCCTCCAGG - Intronic
1079733168 11:23961888-23961910 AGGCAGGAGCACCGCCCTCCTGG + Intergenic
1080489417 11:32747308-32747330 AGGCAGGTGCCCCTCCCTCTGGG - Intronic
1080584130 11:33666154-33666176 AGGCAGGAGCCCTGCCCTCCTGG - Intronic
1080600309 11:33816212-33816234 AGACTGGAGCCCCACCCTGCGGG - Intergenic
1080668755 11:34357766-34357788 CAGCAGGAGCCCCACGCTCCCGG + Exonic
1080852078 11:36078663-36078685 AGGCAGGAGTCCCACCCTTCTGG - Intronic
1081268475 11:41057031-41057053 AGGCAGGAGCCCCACCCTCCAGG + Intronic
1081481900 11:43497283-43497305 AGGCAGCAGCCCTGCCCTGTGGG + Intergenic
1081971619 11:47203009-47203031 AGGCAGGAGTCCCACACTCTGGG + Intergenic
1082790010 11:57340622-57340644 AGACAGGGTCCTCGCCCTCCTGG + Intronic
1083066867 11:59932413-59932435 AGGCAGGAGCCCTGCCCTCCTGG - Intergenic
1083200365 11:61117950-61117972 AATCTGGAGCCCCACCCTCCTGG + Intronic
1083571058 11:63762678-63762700 AGGCCGCTGCCACGCCCTCCAGG - Exonic
1083597826 11:63927605-63927627 AGACAGGTGCCCCACCCTCTGGG - Intergenic
1083644352 11:64164141-64164163 AGGCAAGGGCCCTGCCCTCATGG - Intronic
1083926544 11:65810677-65810699 GGGCAGGAGCCTGGCTCTCCAGG + Intergenic
1084398721 11:68931516-68931538 CGGCTGTAGCCCCGCCCTTCTGG + Intronic
1084469545 11:69348985-69349007 AGGCAGGAGACCCACCCTCCTGG - Intronic
1084556833 11:69880550-69880572 AGGCAGGAGCCCGGCCAGACAGG - Intergenic
1084621029 11:70270524-70270546 AGACGGGAGCCACGCCCCCCAGG - Intergenic
1084767784 11:71323738-71323760 AGGCAAGGACCCTGCCCTCCTGG - Intergenic
1084973006 11:72781628-72781650 GGGCAGGAGGGGCGCCCTCCAGG + Intronic
1084991034 11:72925900-72925922 AGGCAGGAGCCCCACCCTCCTGG + Intronic
1085042129 11:73332708-73332730 AGACAGGATTCCCGCCCCCCAGG - Intronic
1085435006 11:76492716-76492738 GGGCAGGAGCCCCGCCCTCCTGG + Intronic
1085496752 11:76977748-76977770 GGGCAGGAGCCCCACACTCCCGG + Intronic
1085528194 11:77176116-77176138 AGGAAGGAGCCCTGTCATCCGGG - Intronic
1086092641 11:83020145-83020167 AGGTAGAAGCCCCACCCTCTCGG + Intronic
1087534509 11:99425762-99425784 TGGCAGGAGCCCCACACTCCAGG - Intronic
1088513123 11:110598881-110598903 AGGTGGGAGCCCTGCCCTCCCGG + Intronic
1088650971 11:111958087-111958109 AGGCAGGAGCCCCACCCTCCTGG + Intronic
1088650994 11:111958178-111958200 AGGTAGGAGTCCCGGCCTCCCGG + Intronic
1089009048 11:115118131-115118153 TGGCAGGAGCCCGGCCTCCCTGG - Intergenic
1089138951 11:116271190-116271212 AGGCTGGAACCCAGGCCTCCTGG - Intergenic
1089505928 11:118961765-118961787 AGGCAGGAGCCCTGCCCAGGAGG - Intergenic
1089688696 11:120172776-120172798 TGGCACGAGCCCCTCTCTCCAGG - Intronic
1089822651 11:121241896-121241918 AGGCAGGATCTCTGCCCTCCTGG - Intergenic
1089822671 11:121241989-121242011 AGGCAGAAGCCCCACCCTCCTGG - Intergenic
1090910242 11:131111915-131111937 AGGCAGGAGTCCTGCCCTTCTGG - Intergenic
1091689957 12:2589194-2589216 AGGGAAGACCCCCACCCTCCTGG + Intronic
1091785916 12:3243355-3243377 AAACAGGAGCCCCTGCCTCCTGG - Intronic
1092172836 12:6384290-6384312 AGGCAGGAGGCCCGACGTCCTGG - Exonic
1092187685 12:6493296-6493318 AGCCACGAGCCCCGCCCCCCGGG + Exonic
1092272162 12:7031679-7031701 GGGCAGGAGCCCTGGACTCCTGG - Intronic
1092300188 12:7240723-7240745 AGTCAGGATCCCCACTCTCCGGG - Intergenic
1092501258 12:9050546-9050568 AGGCAGGAGCCCCGTCCTCCTGG + Intergenic
1093059728 12:14589698-14589720 AGGCAGAAGCCCTGCTCTCCTGG - Intergenic
1093281672 12:17203637-17203659 TGGTGGGAGCCCTGCCCTCCCGG + Intergenic
1094025509 12:25957337-25957359 AGGGAGGATCCATGCCCTCCAGG + Intergenic
1094427173 12:30327925-30327947 AGGTAGGAGCCCTGCCCCCATGG + Intergenic
1095444201 12:42268052-42268074 AGGTGGGAGCCCCACCTTCCTGG - Intronic
1095603107 12:44037209-44037231 AGGCAGGAGCCGTGCTGTCCTGG + Intronic
1095942650 12:47736954-47736976 AGGCTGAGGCCCCGCCCTCTGGG - Intronic
1095989718 12:48026373-48026395 AGAGAGGAGCCACGCCGTCCTGG - Intergenic
1096467546 12:51855779-51855801 AGCCAGGAGCCCAGGCCTCTGGG + Intergenic
1096500074 12:52059289-52059311 AGGGATGGGCCCCGCCTTCCTGG + Exonic
1096869044 12:54582029-54582051 ACCCAGGAGTCCCGCCCACCTGG - Exonic
1097076370 12:56397586-56397608 AAGCAGGAGCCCCACCCTCTTGG - Intergenic
1097078282 12:56410894-56410916 AGGCAGGACCCCCACCCTCCTGG - Intergenic
1097084610 12:56457976-56457998 AGACATGGGCCCTGCCCTCCTGG - Intronic
1097446594 12:59679160-59679182 AGGCAGGAGCCCTGCCTTCCTGG - Intronic
1097492113 12:60283026-60283048 TGGCAGGAGTCCCACCCTCCTGG - Intergenic
1097684123 12:62676426-62676448 GGACAGGAGCCCTGTCCTCCTGG + Intronic
1097894981 12:64816312-64816334 ATGCATGAGCCCCGGCATCCAGG + Intronic
1098465781 12:70784171-70784193 AGGCAGAAGCCCCGCCCTCCTGG - Intronic
1099682218 12:85843882-85843904 AGGCGGGAGCCCCGCCCTTCCGG + Intergenic
1099911914 12:88844559-88844581 AGGCAGGAGCCCCACCCTCTTGG - Intergenic
1100847761 12:98678498-98678520 AGGCCAGAGCCCTGCCCTCCTGG + Intronic
1101086178 12:101239144-101239166 AGGTGGGAGCCCCACCCTCCTGG + Intergenic
1101823000 12:108198181-108198203 AGGTAATAGCCCTGCCCTCCTGG - Intronic
1102060276 12:109926310-109926332 CGGCAGTAGCCCCACCCTCCTGG - Intronic
1102138501 12:110595164-110595186 AGGCTGGAGCCTCAACCTCCCGG - Intergenic
1102214957 12:111154382-111154404 AGGCAGGAGCCCAGGCCACAGGG + Intronic
1102501967 12:113359022-113359044 AGGCTGCAGCACCGCCCTGCGGG + Intronic
1102510974 12:113415139-113415161 AGGCAAAAACCCTGCCCTCCTGG - Intronic
1102566303 12:113799613-113799635 AGACAGAGGCCCCGCCCGCCGGG + Intergenic
1102633829 12:114305080-114305102 AGAGAGGATCCCTGCCCTCCTGG - Intergenic
1103921129 12:124399710-124399732 AGGCCGAAGCCCCGCCTGCCAGG - Intronic
1104735967 12:131136245-131136267 AGGAGGGAGGCCTGCCCTCCCGG + Intronic
1104905383 12:132210623-132210645 AGGCCCGAGCCCCGTCCTCCTGG + Intronic
1105041737 12:132966601-132966623 AGGCTGGAGCCCCACCCTCCTGG + Intergenic
1105424327 13:20282303-20282325 TGGTGGGAGCCCTGCCCTCCTGG + Intergenic
1106253628 13:28002305-28002327 GGGCGGGAGCCCCACCCTCCTGG - Intergenic
1106308751 13:28534971-28534993 AGGCAGGAGCCCCGCCCTCCTGG + Intergenic
1106330968 13:28739214-28739236 AAGCTGGAGCCCAGCCCTCAGGG - Intergenic
1106379426 13:29222670-29222692 GGGTGGGAGCCCCGCCCTCCTGG + Intronic
1106537537 13:30660433-30660455 AGGCAAGATCTCCACCCTCCTGG - Intronic
1106571881 13:30934797-30934819 AAGCAGGAGCCCTGCAGTCCTGG + Intronic
1106626930 13:31430289-31430311 AGGCATGAGCCACCGCCTCCAGG + Intergenic
1107145864 13:37059735-37059757 TGGCAGCGGCCCCGCCCTCCCGG - Intergenic
1107513448 13:41107364-41107386 AGGCAGAAGCCCCACCCTCCTGG + Intergenic
1107588902 13:41881978-41882000 AGTGAGGAGCCCCTCCGTCCCGG - Intronic
1107853308 13:44591603-44591625 AGGCAGGAGCTCCGCCCTCCTGG + Intergenic
1107875980 13:44790463-44790485 AGGCAGGAGCCCCGCCCTCCTGG - Intergenic
1108002248 13:45915151-45915173 AGGCAGGAGCCCCAACTTCTCGG + Intergenic
1108002270 13:45915242-45915264 AGGCAGGAGCCCTGCTCTCCCGG + Intergenic
1108017110 13:46087087-46087109 AGGCAGGAGCCCTGCCCTCCTGG - Intronic
1109030128 13:57179998-57180020 GGGCAGGAGCACTGCCCTCCTGG - Intergenic
1109426078 13:62167831-62167853 TGGCAGGAGCCCCACCCTCCTGG + Intergenic
1109426096 13:62167885-62167907 AGGCGGGAGCCCTGCTCTCCAGG + Intergenic
1109470540 13:62799037-62799059 AGGGAGGAGCTCCTCCCTCCTGG + Intergenic
1109563379 13:64078758-64078780 GGACAGGAGCCCCGCCCTTCCGG - Intergenic
1109780613 13:67106650-67106672 AGGCAGGAGACCCGCCCTCCTGG + Intronic
1109837354 13:67877350-67877372 AGGCAGGAGCCCTTGCCTCCTGG + Intergenic
1110440219 13:75518785-75518807 GGTCAGGAGCCCTGCCCTGCGGG - Intergenic
1110757762 13:79195973-79195995 AGGCAGGAGGCCTGCCCTTAAGG + Intergenic
1110810540 13:79807429-79807451 AGGCAAGAGCCTCGCCCTCCTGG + Intergenic
1111237671 13:85430860-85430882 GGGCAGGAGCCCCACCCTGAAGG + Intergenic
1111474233 13:88725072-88725094 GGGTGGGAGCCCTGCCCTCCTGG + Intergenic
1111800603 13:92975283-92975305 AGCCAGGAGCCCTGCTGTCCTGG - Intergenic
1112338924 13:98536964-98536986 TGGCCGGAGCCCGCCCCTCCCGG + Intronic
1112740883 13:102472018-102472040 AGACAGGAGCCACTCTCTCCAGG - Intergenic
1113592813 13:111512786-111512808 AGCCAGGGGCTCCTCCCTCCTGG + Intergenic
1113660275 13:112103034-112103056 AGGAAGGAGCCCTGCCCTGGAGG + Intergenic
1113783845 13:112991757-112991779 AGCCAGGAGCCCTTCCCTGCGGG + Intronic
1113833755 13:113315323-113315345 AGGCAGGAAGCCCAGCCTCCAGG - Intronic
1114032829 14:18590736-18590758 TGGCAGAAGCCCCCCCCCCCAGG + Intergenic
1114280931 14:21192134-21192156 AAACAGGAGCCCCGCCCTCTTGG + Intergenic
1114280951 14:21192226-21192248 AGGCAGGATCCCTGTCCTCCAGG + Intergenic
1114577240 14:23726162-23726184 AGGCATGTGCCCTGCCCCCCGGG - Intergenic
1115147518 14:30242325-30242347 AGGCATGACCCCTGCTCTCCTGG - Intergenic
1116221784 14:42096554-42096576 AGGCAGGAGCCCCATCTTCCTGG - Intergenic
1116317085 14:43410769-43410791 GGGTGGGAGCCCTGCCCTCCTGG - Intergenic
1116448646 14:45039805-45039827 GGGTAGGAGCCCTGACCTCCTGG - Intronic
1116541677 14:46108431-46108453 AGCCAGGAGCCCCACCCTCCTGG - Intergenic
1117072953 14:52072395-52072417 AGGCAAAATCCCTGCCCTCCAGG - Intergenic
1117733903 14:58750845-58750867 GGGCAGGAGCCCTGCCCTTCTGG + Intergenic
1118200197 14:63664063-63664085 AGGCAGGATCCCCACCCTCCTGG - Intergenic
1118213708 14:63788538-63788560 AGGCAGGAGCCCCGCTCTCCTGG - Intergenic
1118522120 14:66596791-66596813 AGGTGGGAGCCCCGCCCCCCGGG - Intronic
1118522257 14:66597664-66597686 GGGCAGGAGCCCTACCCTCCTGG - Intronic
1119322162 14:73738727-73738749 TGGCAGGAGCCTCTCGCTCCCGG + Exonic
1119618031 14:76111700-76111722 AGGCAGGAGCCCCGCCCTACTGG + Intergenic
1119655686 14:76415089-76415111 AGTCAAGAGCCCTGCCCTCTAGG + Intronic
1119705824 14:76781990-76782012 AGCCAGCAGCCCCCACCTCCAGG - Exonic
1121318116 14:92974171-92974193 CTGCAGGGGCCCCACCCTCCAGG - Intronic
1121553494 14:94819613-94819635 AGACAGGAGCCTCACCCTCTTGG - Intergenic
1121695419 14:95908332-95908354 AGGCAGGAGCCCCACCCCACTGG - Intergenic
1121973934 14:98385402-98385424 AGGCAAGAGCCCTACCCTCCTGG + Intergenic
1122135090 14:99628157-99628179 AGGCAGGAGCCCAGGTCCCCAGG + Intergenic
1122153051 14:99734897-99734919 TGGGAGGAGCCCCGCCTGCCCGG - Intergenic
1122249472 14:100427833-100427855 GGGCTGGAGCCCTGGCCTCCTGG + Intronic
1122270370 14:100566278-100566300 AGGCAGCAGATCCGCCCACCTGG + Intronic
1122327716 14:100892386-100892408 AGGTAGGAGCACCTCCTTCCAGG + Intergenic
1122416703 14:101553281-101553303 AGGCATGAGCCTCGGCATCCTGG - Intergenic
1122839057 14:104445919-104445941 ATTCAGGAGCCCTGGCCTCCAGG + Intergenic
1122891282 14:104733382-104733404 AGGCAGGGGGCTCACCCTCCTGG - Intronic
1123054127 14:105561179-105561201 AGGCAGGAGCAGCCCCCTCCTGG - Intergenic
1123078710 14:105681596-105681618 AGGCAGGAGCAGCCCCCTCCTGG - Intergenic
1123216464 14:106813294-106813316 AGGAAGGAGCCCTGCCTCCCCGG + Intergenic
1124650384 15:31469557-31469579 AGGCAGGAGCCCCGCCCTCCTGG - Intergenic
1124820736 15:33043870-33043892 AGACAAAAGCCCCGCCCTCCTGG + Intronic
1125381721 15:39092974-39092996 AGGCAGGAGCCCCACCCTCCTGG - Intergenic
1125435906 15:39645428-39645450 AAGCAGGAGCCTCGCCCTCCTGG + Intronic
1125767955 15:42147523-42147545 AGGCAGGATCCCAGCCCCTCAGG + Intronic
1125861978 15:43008244-43008266 GGGCAGAAGCCCCGTGCTCCCGG + Intronic
1126018450 15:44375704-44375726 TGACTGGAGCCCCGACCTCCGGG - Intronic
1126215113 15:46145927-46145949 GGGCAGGAGCCCTGCCCTCCAGG + Intergenic
1127526046 15:59792569-59792591 AGGCAGGAGCCCCACCCTCCCGG - Intergenic
1127916075 15:63456424-63456446 AGACTGGAGCCCAGCTCTCCAGG - Intergenic
1128269096 15:66293429-66293451 AGGCTGGGGCCCGGCCCTCCCGG - Intronic
1128516795 15:68347250-68347272 AGGCGGGAGCCCTGCCCTCAAGG - Intronic
1128533304 15:68470092-68470114 AAGGATGAGCCCAGCCCTCCTGG + Intergenic
1128847758 15:70916829-70916851 AGGCAGGAGCCCCGCCCTCCTGG + Intronic
1129369112 15:75076875-75076897 AGGCAGGAGCCCTGCCTTCCTGG - Intronic
1129522864 15:76196722-76196744 GGGCTGGCACCCCGCCCTCCTGG - Intronic
1129784931 15:78303907-78303929 AGGCAGGGTCGCCACCCTCCTGG + Intergenic
1129799864 15:78405781-78405803 AGGCAGCAGCCCAGCCCTCCTGG + Intergenic
1129910673 15:79223437-79223459 AGGCAGGAATCCCGCCCTCAAGG + Intergenic
1130102419 15:80903992-80904014 ATGCTGGAGCCCCCTCCTCCAGG - Intronic
1130332091 15:82930483-82930505 AGGCAGAAGACCCTCCCTTCAGG - Intronic
1130933544 15:88449733-88449755 AGGCAGGCGCCCCACCCTACTGG + Intergenic
1132348577 15:101123071-101123093 AGGCAGGTGCTCAGCCCACCTGG + Intergenic
1132679835 16:1135159-1135181 CGCCAGGAGCCCCCGCCTCCAGG - Intergenic
1132681254 16:1142948-1142970 TGGCAGGAGTCCCGCCCTCCAGG + Intergenic
1132685351 16:1159763-1159785 TGGCAGCAGCCACGCCCTCTGGG - Intronic
1132745805 16:1435871-1435893 AGGCAGGACCCCCAGCCTACGGG - Intronic
1132883615 16:2172880-2172902 AGGCAGGAGCCCAGTTCTTCAGG + Intronic
1132903732 16:2271807-2271829 AGGCAGGGCCCCCGCTCCCCGGG + Intergenic
1132911904 16:2318088-2318110 CGGCAGGAGCCCAGCCCTTCTGG + Intronic
1134109593 16:11506855-11506877 AGGCAGGCCCTCAGCCCTCCCGG + Intronic
1134125545 16:11613546-11613568 CAGCAGGGGCCCCACCCTCCAGG - Intronic
1134236265 16:12468645-12468667 AGGCAGGATCCCAGCCTCCCAGG - Intronic
1134254462 16:12600318-12600340 ATGCATGAGCCCCACCCTCCTGG + Intergenic
1135053324 16:19210274-19210296 AGGCAGGAGTCCTGAACTCCCGG + Intronic
1135745726 16:25015027-25015049 AGGCCCGAGCGCCGCGCTCCAGG - Intronic
1136363022 16:29793539-29793561 AGGCAGGTCACCCGCCCTCTTGG - Intronic
1136923454 16:34350552-34350574 AGGCGGGAGCCCAGGCCTCCTGG + Intergenic
1136981119 16:35061254-35061276 AGGCGGGAGCCCAGGCCTCCTGG - Intergenic
1137282851 16:46992756-46992778 AGGCAGGAATCCCACACTCCTGG - Intergenic
1137291664 16:47055696-47055718 AGGCAAACGCCCCGCCCTCCTGG - Intergenic
1137334478 16:47533973-47533995 AGGGGGGAGCCCCACCATCCTGG - Intronic
1137608915 16:49805971-49805993 AGGGAGGGCCCCCGGCCTCCCGG + Intronic
1137698564 16:50478959-50478981 AGGCAGGAGCCCCACCCTCCTGG - Intergenic
1138243759 16:55450358-55450380 AGGCATGAGCCACCCGCTCCTGG + Intronic
1138354152 16:56364282-56364304 AGGCAGCAGGCCTGCCCTCAGGG - Intronic
1138394717 16:56695326-56695348 AGGCAGGAGTTCTGCCCCCCTGG + Intronic
1138582967 16:57953533-57953555 AGGAAGGAGCCCCTGCTTCCAGG + Intronic
1139343357 16:66286505-66286527 AGGCAGGAGCCTCTCTCACCTGG - Intergenic
1139516258 16:67454081-67454103 AGTCATGAGCCCTGCACTCCAGG + Intronic
1139625941 16:68188305-68188327 AGGAAGAAGCCCCACCATCCTGG - Intronic
1141108071 16:81249877-81249899 AGGCAGGCTCCCCGCACTCTGGG - Intronic
1141687610 16:85579252-85579274 AGGCAGAAGCCCCGCCCCAAGGG - Intergenic
1142033942 16:87852292-87852314 AGGAAAGGGCCCCGCCCTCATGG - Intronic
1142379260 16:89722219-89722241 GGGCAGGCGCTGCGCCCTCCAGG - Intronic
1142380834 16:89730989-89731011 AGGCCTGAGCCCAGCCCACCCGG + Intronic
1142499855 17:326186-326208 ATGAAGGAGCCGAGCCCTCCTGG + Intronic
1142675925 17:1513285-1513307 AGGCAGGGGCCCCGGGGTCCAGG + Intronic
1142906810 17:3049101-3049123 AAACAGGAGTCCCACCCTCCTGG + Intergenic
1143030193 17:3963575-3963597 AGGCGGGAGACCCACCTTCCTGG - Intronic
1143204273 17:5131749-5131771 AGCCAGGAGCCCATCCCTCAGGG + Intronic
1143394004 17:6577351-6577373 AGGCAGGGTCCCTGCCCTCAAGG + Intergenic
1143512656 17:7404962-7404984 AGCCAGGAGTCCGGGCCTCCCGG + Intronic
1143717631 17:8786238-8786260 AGGAAGGTGCCCCGCCCTGAAGG + Intergenic
1143885879 17:10064467-10064489 AGGCAGGAGCCACTTGCTCCCGG - Intronic
1144754431 17:17670591-17670613 AGAGAGCAGCCCCGGCCTCCAGG - Intergenic
1144875341 17:18394439-18394461 AGCCAGGAGCCCATCCCTCGGGG + Intergenic
1144959797 17:19038699-19038721 AGGCAGGTGCCCAGCCAGCCTGG + Intronic
1144975363 17:19135825-19135847 AGGCAGGTGCCCAGCCAGCCTGG - Intronic
1145041170 17:19579499-19579521 AGGCAGGACCCCTCCTCTCCCGG + Intergenic
1145156884 17:20549982-20550004 AGCCAGGAGCCCATCCCTCGGGG - Intergenic
1145217195 17:21061267-21061289 AGGCAGGAGCCCTACCCTCCTGG - Intergenic
1145760004 17:27420498-27420520 AGGCTGGAGCCCATCCCTCAGGG + Intergenic
1146093428 17:29905432-29905454 AAGCAGGAGCCCTGCTCTCCTGG + Intronic
1146399020 17:32489017-32489039 AGGCAAGATCCCCGCCACCCGGG + Exonic
1146425195 17:32731822-32731844 AGGCAGGAGCCCCAACCTCCTGG + Intronic
1146708670 17:35021517-35021539 AGGCACGAGTCCTGTCCTCCTGG + Exonic
1146844407 17:36174074-36174096 AGCCAGGAGCCCATCCCTCAGGG - Intronic
1146863905 17:36326366-36326388 AGCCAGGAGCCCATCCCTCAGGG + Intronic
1146872621 17:36385920-36385942 AGCCAGGAGCCCATCCCTCAGGG - Intronic
1146879980 17:36437005-36437027 AGCCAGGAGCCCATCCCTCAGGG - Intronic
1147066765 17:37926954-37926976 AGCCAGGAGCCCATCCCTCAGGG + Intronic
1147075506 17:37986544-37986566 AGCCAGGAGCCCATCCCTCAGGG - Intronic
1147078297 17:38006515-38006537 AGCCAGGAGCCCATCCCTCAGGG + Intronic
1147087031 17:38066090-38066112 AGCCAGGAGCCCATCCCTCAGGG - Intronic
1147094235 17:38130450-38130472 AGCCAGGAGCCCATCCCTCAGGG + Intergenic
1147102976 17:38190053-38190075 AGCCAGGAGCCCATCCCTCAGGG - Intergenic
1147580155 17:41623507-41623529 AGCCAGCAGCCCCGCCCCCTGGG + Intronic
1147644236 17:42024243-42024265 AGGTAGGGGCCCCACCCTCTGGG + Exonic
1148124052 17:45227964-45227986 AGGCAGGTATCCCGCCCACCTGG + Intronic
1148640558 17:49184109-49184131 AGGCAGAAGCCTCACCCTCCTGG - Intergenic
1148772854 17:50076928-50076950 AGCCAAGAGCCCCGCCCCCAGGG - Intronic
1149085323 17:52709773-52709795 AAGCAGGAGCCATGCTCTCCTGG + Intergenic
1149088574 17:52750986-52751008 AGGCAGGAGCCCTGCCCTCCTGG + Intergenic
1149330675 17:55577827-55577849 AGGAAGGAGCCCCACCCCCTCGG - Intergenic
1149523561 17:57336966-57336988 AAGCAGGAGCTTCGCCTTCCGGG + Intronic
1149847548 17:60016520-60016542 AGCCAGGAGCCCATCCCTCAGGG - Intergenic
1150085907 17:62273137-62273159 AGCCAGGAGCCCATCCCTCAGGG - Intronic
1150326400 17:64262173-64262195 TGGCACGAGCCCTGCCCTCAAGG + Intronic
1150520894 17:65865957-65865979 AGGCAGGAGCCTCACCCTCCTGG + Intronic
1150520917 17:65866048-65866070 AGGCAGGAGCCCTGCCGTCCTGG + Intronic
1150950807 17:69801066-69801088 AGGTGGGAGCCCCACCCTCCTGG + Intergenic
1151288495 17:73131326-73131348 GGGGAGGAGCACTGCCCTCCAGG - Intergenic
1151395456 17:73819911-73819933 AGGCAGGAGTCCCACCTCCCTGG - Intergenic
1151975098 17:77480094-77480116 AGAGAGGAGCCCTGGCCTCCAGG + Intronic
1152428950 17:80236813-80236835 AGGCAGGAGACGCCCCCACCGGG - Intronic
1152616364 17:81339765-81339787 AGGAAGGACCTCTGCCCTCCTGG - Intergenic
1152636647 17:81432922-81432944 AGGGAGGAGCGCAGCCTTCCTGG - Intronic
1152864280 17:82712947-82712969 GGGCAGGAACCCCATCCTCCTGG - Intergenic
1152914127 17:83024177-83024199 AGGCAGCAGAGCAGCCCTCCTGG + Intronic
1152930021 17:83104665-83104687 AGGCAGGAGCTCCTCTCTCAGGG - Intergenic
1153428081 18:4988039-4988061 GGGCAGGAGCCCCACCATCCTGG - Intergenic
1153800406 18:8663296-8663318 AGGCAGGGTCCCGGTCCTCCAGG + Intergenic
1154168723 18:12035593-12035615 AAACAGGAGCCCTGACCTCCAGG + Intergenic
1154357644 18:13633827-13633849 GGGCAGGAGCCCTGCCCTCCTGG - Intronic
1155120832 18:22816878-22816900 AGGCAGAAGACCTGCCCTCCTGG - Intronic
1155284228 18:24271942-24271964 CGGCCGCAGACCCGCCCTCCGGG + Intronic
1155819072 18:30352501-30352523 AGGCAGGAGCCCCACACTCCTGG + Intergenic
1155830972 18:30514244-30514266 AGGTGGTAGCCCCACCCTCCTGG - Intergenic
1156160211 18:34350611-34350633 AGGCAGGAGACCTGCCCTCCTGG + Intergenic
1156228737 18:35133806-35133828 AGGCAAGAGCCCTTGCCTCCTGG + Intronic
1156244560 18:35284887-35284909 AGGCAGGAGCCCTGCTCTCCTGG - Intronic
1156298949 18:35818339-35818361 AGGCAGGATCCCTGCCCTCCTGG - Intergenic
1156448987 18:37255926-37255948 GGGCAGAAGCCCAGCCTTCCTGG + Intronic
1157042997 18:44061625-44061647 AGGCAGGAGCCCCACCCTTCTGG - Intergenic
1157045882 18:44100764-44100786 AGGCAGGACAGCCGCCCACCAGG - Intergenic
1157382411 18:47231421-47231443 AGGCAGGTGCCCAGCCTTCTCGG + Intronic
1158773702 18:60552721-60552743 AAGCAGGAGCCCTGCCTTCCTGG + Intergenic
1158774015 18:60555254-60555276 TGGAAGGAGCCCTGCGCTCCTGG + Intergenic
1159519172 18:69496060-69496082 AGGCAGGAGACCCACATTCCTGG - Intronic
1159519191 18:69496140-69496162 AGGCAGGAAACCTGCCCTCCTGG - Intronic
1159519215 18:69496248-69496270 AGGCAGGATCCCTGTCCTCCTGG - Intronic
1159623738 18:70669045-70669067 AGGCAGGAGCCCCACTCTCCTGG + Intergenic
1159774067 18:72584017-72584039 AGGCAGGAGCCAGGTCCTTCAGG - Intronic
1160050145 18:75425893-75425915 AGGCAGGGGCCCCCACCTCAGGG - Intronic
1160743579 19:699347-699369 AGGCAGCAGCCCCGGCCCCCTGG - Intergenic
1160797296 19:951704-951726 AGTCAGCAGCCGCCCCCTCCGGG - Intronic
1161025524 19:2034998-2035020 AGGCAAAAGCTCCGCCCCCCAGG + Intergenic
1161048596 19:2150585-2150607 TGGCAGCAGCCCCACCTTCCTGG + Intronic
1161097137 19:2398966-2398988 AGGGAGGGGCTCCGCCCTGCTGG - Intronic
1161995308 19:7707899-7707921 AGGCTGGAGTCCCAACCTCCTGG - Intergenic
1162231644 19:9271281-9271303 AGGGAGGAGCCACCCTCTCCAGG + Intergenic
1163020718 19:14479669-14479691 AGTCAGGATTCCTGCCCTCCTGG - Intronic
1163114656 19:15181557-15181579 AAGCAGAGGCCCCGCCCACCTGG + Exonic
1163144990 19:15373934-15373956 TGGCAGGGGCCCCGGCCGCCAGG + Exonic
1163754065 19:19096204-19096226 AGGCAAGTACCCCGGCCTCCTGG + Exonic
1164156307 19:22599657-22599679 AGCCAGCAGCCCCCCTCTCCAGG + Intergenic
1164160437 19:22622948-22622970 CCGCAGGGGCCCTGCCCTCCAGG - Intergenic
1164179748 19:22807804-22807826 CCGCAGGATCCCCGCCCTCTAGG + Intergenic
1164426869 19:28149505-28149527 AGGCAGGAGCCTCGCCGTTCAGG + Intergenic
1164624023 19:29714983-29715005 TGCCGGGAGCCCGGCCCTCCCGG - Exonic
1164648979 19:29878693-29878715 AGGGAGCAGCCTCGACCTCCTGG + Intergenic
1165027085 19:32969848-32969870 AGGCAGGAGCCCCACCCTCTTGG - Intronic
1165110365 19:33498744-33498766 AGGCAGGTGCCCATCCCACCAGG + Intronic
1165110401 19:33498876-33498898 AGGCAGGTGCCCATCCCGCCAGG + Intronic
1165431370 19:35775414-35775436 AGGCCGATGCCCCGCCCACCCGG - Intronic
1165550404 19:36578926-36578948 AGGCATGAGCCACTGCCTCCAGG - Intronic
1165814962 19:38636267-38636289 AAGTAGGAGCCCAGCCCTGCCGG + Intronic
1166179438 19:41096496-41096518 AGGCAGGACAGCCGCCCGCCAGG - Intergenic
1166267015 19:41690672-41690694 AGCCAGGAGCCCCCATCTCCAGG + Intronic
1166897340 19:46032360-46032382 AGGCAGGAGCCCCACCTTCCTGG + Intergenic
1166898047 19:46036345-46036367 AGGCAGGAGCCCTGCCTTCCTGG + Intergenic
1167234943 19:48308751-48308773 AGGCAGGATCCCCGCCCTCCTGG + Intronic
1167269601 19:48499580-48499602 AGGCAGGTGCCCCCCCACCCCGG + Exonic
1167295133 19:48645363-48645385 ACCCAGGAGTCCGGCCCTCCCGG - Intronic
1167473292 19:49686975-49686997 AGGCTGAAACCCTGCCCTCCTGG + Intronic
1168405313 19:56107596-56107618 GGGCAGGACCTCGGCCCTCCTGG - Intronic
925352939 2:3214938-3214960 AGACAGGAAGCCTGCCCTCCAGG - Intronic
926554441 2:14341289-14341311 GGGCAGAAGCCTTGCCCTCCTGG + Intergenic
926859398 2:17292281-17292303 AGGCAGGAGTCCCACTCTCCTGG - Intergenic
927072793 2:19548086-19548108 AGGAAGTAGCCCCACTCTCCTGG + Intergenic
927073278 2:19551161-19551183 TGGCTGGAGCCCCGACCTCAGGG - Intergenic
927236583 2:20880515-20880537 GGGCAGGAGCCCTGAGCTCCTGG - Intergenic
927497951 2:23563312-23563334 GGCCAGGGGCCCGGCCCTCCAGG - Intronic
927605489 2:24482971-24482993 AGGCAGAGGCCCCACCCTCAGGG + Intergenic
927613675 2:24566978-24567000 AGGCAGAAGGCCCGCCCTCCTGG - Intronic
928803351 2:35121521-35121543 AGCAAGGAGCCCAGGCCTCCTGG + Intergenic
928840340 2:35598498-35598520 AGGCAGGAGCCCTGCCCTCCAGG + Intergenic
929014456 2:37481201-37481223 AGGCAGGAGTCCTGTCCTCCTGG + Intergenic
930957154 2:57217015-57217037 AGGCAGGAGCCCCAACCTCTAGG + Intergenic
931005925 2:57850080-57850102 AGACAGTAGCTCTGCCCTCCCGG - Intergenic
931499929 2:62854968-62854990 AGGTGGGAGCCCTGCCCTCCTGG + Intronic
931649249 2:64454034-64454056 CGACAGGGCCCCCGCCCTCCCGG + Intronic
931665791 2:64609061-64609083 AGGCAGGGACCCCGTCCGCCTGG + Intergenic
931734051 2:65177973-65177995 GGGTGGGAGCCCTGCCCTCCGGG - Intergenic
931881557 2:66575812-66575834 AGGTTGCAGCGCCGCCCTCCCGG - Intergenic
932219511 2:69989190-69989212 AGCCAAGAACCCTGCCCTCCAGG - Intergenic
932469448 2:71944383-71944405 AGGCAGGACCTCAGGCCTCCCGG - Intergenic
932501734 2:72188136-72188158 AGGCAAGAGCCCTACCCTCCTGG - Intronic
932644758 2:73488527-73488549 GGGCAGGAACCCCACCCTCCTGG - Intronic
933219389 2:79670340-79670362 GAGCTGTAGCCCCGCCCTCCTGG + Intronic
933606632 2:84390262-84390284 GGGCAGGAGTCCCACCCTCCTGG - Intergenic
933767802 2:85722324-85722346 AGGCATGAGCCACGCCCAGCCGG - Intergenic
933801267 2:85961856-85961878 AGGCAGGAGTCCCACTCCCCAGG - Intergenic
933801279 2:85961937-85961959 AGGCAGGAGACCCACTCTTCTGG - Intergenic
933997612 2:87681269-87681291 CAGCAGCAGCCCCGCCCTCCTGG - Intergenic
934696642 2:96404989-96405011 AGTCAGGAGTCCCACACTCCTGG - Intergenic
934754566 2:96816368-96816390 AGGCAGAAGCCCAGCACTCGCGG - Exonic
935204797 2:100888266-100888288 AGGCATGGGTCCCACCCTCCTGG - Intronic
935275802 2:101474413-101474435 GGGCGGGAGCCCAGTCCTCCAGG + Intronic
936024426 2:109020661-109020683 AGGCAGGCTCCCTGACCTCCTGG - Intergenic
936290277 2:111217477-111217499 AGGCAGGGTCCCTGCCCTCCTGG - Intergenic
936296240 2:111269601-111269623 CAGCAGCAGCCCCGCCCTCCTGG + Intergenic
937164157 2:119795723-119795745 AGGCAGAAGCCCCGCCCCCCAGG - Intronic
937278187 2:120699739-120699761 AGGCAGGGGCCCAGGCATCCTGG + Intergenic
937294545 2:120801871-120801893 AGGCAGGAGCCCCAAGCCCCGGG - Intronic
937543606 2:122988942-122988964 AGGCAGCAGCTCCACCCTCCCGG + Intergenic
938732679 2:134158627-134158649 GGGCAGGAGCCCTGACCTCCTGG - Intronic
940851042 2:158688552-158688574 GGTCAGAAGCCCCACCCTCCTGG + Intergenic
941440460 2:165528976-165528998 AGGGGGGAGCCCTGCCCTCCTGG + Intronic
942103886 2:172613871-172613893 AGGCAGGAGCCCCGCCCTCCTGG + Intergenic
943189893 2:184663121-184663143 AGGCAGGAGGCCTGCTGTCCTGG + Intronic
943226409 2:185184935-185184957 GGGCAGGAGCCCCACCCTCCTGG + Intergenic
943427104 2:187750417-187750439 AGGCAGGAGCCCCACCTTCCTGG - Intergenic
943526183 2:189020508-189020530 AGGCAGGAGCCCTGCCCTCCTGG + Intergenic
943858303 2:192827944-192827966 TGGTGGGAGCCCCGCTCTCCTGG + Intergenic
943928582 2:193820117-193820139 GGGCAGGAGCCCTGCACTCCTGG - Intergenic
943961086 2:194264755-194264777 AGGCAGGAGCCCTGCCCTCCTGG + Intergenic
945770485 2:214035658-214035680 AGGAAGGACCCCCGCCCCCAGGG - Intronic
946052441 2:216875039-216875061 AGTCAGGGTCCCCGCCCTTCAGG - Intergenic
947327405 2:228993020-228993042 AGGCAGGAGTCCTGCCCTGCTGG - Intronic
947327426 2:228993113-228993135 AGGCAGGATCTCCACCCTTCTGG - Intronic
947828983 2:233125583-233125605 TGGCAGGAGGCTCTCCCTCCAGG + Intronic
948283007 2:236762849-236762871 AGGCAGGGACCCAGCCATCCCGG - Intergenic
948777568 2:240297616-240297638 AGGAATGAGCCCCGGCCTCATGG - Intergenic
1168891466 20:1297624-1297646 AGGCATCAGGCCTGCCCTCCAGG + Intronic
1168957654 20:1845868-1845890 TGGCAGGAGCCCCCTCCTGCTGG - Intergenic
1170221438 20:13946648-13946670 AGGTGGGAGCCCCACCTTCCTGG + Intronic
1170564768 20:17592350-17592372 CTGCAGGAGCCCTGACCTCCTGG - Intronic
1171087095 20:22247486-22247508 GGGAAGGAGCCCAGACCTCCTGG + Intergenic
1171188960 20:23144833-23144855 AGGCAGGAGGCCCAGACTCCTGG + Intergenic
1171404404 20:24900240-24900262 TGGTAGGAGCCCAGGCCTCCTGG - Intergenic
1172047158 20:32088314-32088336 AGGCATGATCCCAGCCATCCAGG + Intronic
1172346906 20:34209330-34209352 AGGCAGGAGGCCTACCCTCACGG + Intronic
1172346926 20:34209423-34209445 AGGCAGGAACCCCACCCTCCTGG + Intronic
1172676560 20:36676929-36676951 AAGCAGGATCCCCGCCCTCCTGG + Intronic
1173397632 20:42694983-42695005 AGGCATGAGCCACCCCCGCCTGG - Intronic
1173495483 20:43514775-43514797 GGGTAGGAGCCCCGCTCCCCAGG + Exonic
1173524600 20:43721952-43721974 AGGCAGGAACCCTGCCCTACTGG - Intergenic
1173953620 20:47013180-47013202 GGGAACCAGCCCCGCCCTCCTGG + Intronic
1174446896 20:50596593-50596615 AGGCAGGAGCCCCACACTCAAGG + Intronic
1174651532 20:52129810-52129832 AGGCAGGATCCCTGCCCCCTGGG - Intronic
1175364145 20:58439728-58439750 AGGAAGGAGCCCCATCCTCTAGG + Intronic
1175448670 20:59043833-59043855 TGGCAAGAGCCTCGCCCTCAGGG - Intergenic
1175519105 20:59588391-59588413 ATGCAGCAGCCCCGTCCCCCTGG + Intronic
1175715692 20:61253028-61253050 GGGCAGGCGCCCCGCACTCGCGG - Intronic
1175824853 20:61931281-61931303 AGGGAGGAGCCACGCACTGCAGG - Intronic
1175960026 20:62631284-62631306 AGGCAAGAGCTCCACCCTCCCGG - Intergenic
1176087816 20:63306018-63306040 AGCCAGGATCCGCGCACTCCTGG + Exonic
1176096111 20:63345349-63345371 AGGCAGGGGACACGCCATCCTGG + Exonic
1176151834 20:63595482-63595504 AGGCAGGAGACCGGCAGTCCTGG + Intronic
1176225728 20:63997851-63997873 AGGCATGAGCCCCGGCGCCCCGG + Intronic
1176973381 21:15290592-15290614 AGGCAGGAGCCCCACCCTACAGG - Intergenic
1177344748 21:19854374-19854396 GGGCGAGAGCCCCGCCCTCCAGG - Intergenic
1177396173 21:20538424-20538446 AGGCAGGAGCCCTGCCTTCCTGG - Intergenic
1177404221 21:20645371-20645393 GGGCAGGATCCCTGCCCTCCTGG + Intergenic
1179607350 21:42525368-42525390 CGGCCGGAGCCCCGCCCTGTGGG + Intronic
1179855038 21:44159061-44159083 AGGCAGGGGCCCCGGTCTCACGG - Intergenic
1180025765 21:45161240-45161262 GGGCAGGAGCCCTGCCATCCTGG + Intronic
1180177258 21:46096909-46096931 AGGCAGGAGCCCTGGACTCATGG + Intergenic
1180873577 22:19162605-19162627 AGCCATGAGCCCCGCTCGCCGGG - Intergenic
1181009777 22:20033342-20033364 GGGCAGCAGACCAGCCCTCCAGG - Intronic
1181988008 22:26815148-26815170 AGGCAGGAACCCTGCTCTCATGG + Intergenic
1182014301 22:27026150-27026172 ATCCAGGAGCCCCGTCCTCAAGG + Intergenic
1182285442 22:29244310-29244332 AGGTAGGAGCCACGGCATCCCGG - Intronic
1182303049 22:29349456-29349478 AGGCAGGTCCCCTTCCCTCCTGG - Intronic
1182696411 22:32202023-32202045 CGGAAGGAGCCCGGCCCTGCTGG - Intronic
1183201554 22:36388245-36388267 AGGCGGGAGCCCCGCCCTCTAGG + Intergenic
1183316716 22:37141145-37141167 AGGCAAGAGCCCCGCTCTCCTGG + Intronic
1183316746 22:37141274-37141296 ACGCAGGAGACCCACCCTCCCGG + Intronic
1183341519 22:37284352-37284374 AGGCAGGAGCCACATCCTGCAGG + Intronic
1183404590 22:37624172-37624194 AAGCAGGAGCCCCACCCACAAGG + Intronic
1183623195 22:38986718-38986740 AGGCAAGAGCTCAGCCTTCCAGG + Intronic
1183654769 22:39178030-39178052 AGGCTGGAACCCCACCCTGCTGG + Intergenic
1183975462 22:41509371-41509393 AGGCAGGGGCCCTGCCTTCAGGG + Intronic
1184173766 22:42774600-42774622 AGGTAGGAGCCCTGTTCTCCTGG + Intergenic
1184236991 22:43187691-43187713 ACGTAGGCACCCCGCCCTCCCGG - Intergenic
1184265245 22:43342977-43342999 ACTCAGGAGCCCCGGCCGCCCGG + Intronic
1184828830 22:46971233-46971255 AGGCAGGAGCCTCGCTCTCTTGG - Intronic
1184869537 22:47226424-47226446 AGGCGGGACCCCCACCCTCCTGG - Intergenic
1185098845 22:48826736-48826758 AGGCAGCAGCTCTGCCCACCTGG + Intronic
1185415177 22:50705663-50705685 CAGCAGGAGCCCCGCCCGCAAGG + Intergenic
949169099 3:977307-977329 AGGCAGTATCCCCTTCCTCCAGG + Intergenic
949226227 3:1699420-1699442 GGACAGGAGCCCCACCCTCCTGG + Intergenic
950207528 3:11092223-11092245 AGGCAGGAGCACTGCCCTCCTGG + Intergenic
952016000 3:28958637-28958659 AGGCAGGTGCCCTGACCTTCTGG + Intergenic
952764870 3:36945007-36945029 ACGCAGGAACCCCGGCGTCCGGG + Exonic
952793227 3:37217147-37217169 AGGCAAGAGCCCCACCCTCCTGG + Intergenic
952840428 3:37641115-37641137 AGGCAGGAGTCCCCAACTCCTGG + Intronic
952840543 3:37641708-37641730 AGGCAGGAGCCCCACTGTACAGG - Intronic
953037794 3:39227839-39227861 AGTGAGGAGCCCCTCCCGCCCGG + Intergenic
953345602 3:42172687-42172709 AGGCAGGACACCTGCCCTCCTGG - Intronic
953439530 3:42906129-42906151 CGGCCCGAGCCCCGGCCTCCCGG + Intronic
954005127 3:47584486-47584508 AGGCAGGACCCATGCCATCCAGG - Intergenic
954099449 3:48358073-48358095 AGGCAGGAGGCCTGCTCTCCTGG - Intergenic
954651014 3:52162655-52162677 AGGCAGGAGCTCCACCCTCCTGG - Intergenic
954708563 3:52493908-52493930 AGGCAGGACCCCCACTCTGCTGG - Intergenic
954764010 3:52897675-52897697 CGGCCGGAGCCCCGCCCCTCGGG - Intergenic
954920489 3:54186853-54186875 AGGCAGGAGCAACGCTGTCCTGG - Intronic
955303679 3:57809072-57809094 GGGCAGGAGCCCTGCCCTTCCGG + Intronic
956454204 3:69404859-69404881 AATCAGGATCCCTGCCCTCCTGG - Intronic
956851112 3:73229073-73229095 TTCCAGGAGCCCCTCCCTCCAGG - Intergenic
956990100 3:74752328-74752350 AGGCAGGAGCCCTGCCCTGCTGG - Intergenic
957486602 3:80870515-80870537 GGGCGGGAACCCTGCCCTCCTGG + Intergenic
957614428 3:82509165-82509187 GGGCAGGAGCCCCACCATCCAGG + Intergenic
957624349 3:82640449-82640471 AGGCAGAAGCAACACCCTCCTGG + Intergenic
957625738 3:82650456-82650478 AGGCAGGAGCCCCACCTACTGGG + Intergenic
957625757 3:82650547-82650569 AGGCAGGAACCCTGCTCCCCCGG + Intergenic
957665447 3:83218998-83219020 AGCCAGGAGCCCCACCCTCCAGG - Intergenic
957678604 3:83403743-83403765 AGGCAGGAGCCCCACCCTCCTGG + Intergenic
958498510 3:94875312-94875334 AGGTAGGAGCCCTGCCCTCCTGG - Intergenic
958584576 3:96069534-96069556 GGGTGGGAGCCCTGCCCTCCCGG - Intergenic
959484143 3:106908425-106908447 TGGCTGCAGCCCCACCCTCCTGG - Intergenic
960690469 3:120341836-120341858 AGGGAGAAGCCCCACCCTCCTGG + Intronic
960968778 3:123124378-123124400 CGGCAGATGCCCCGCCCTCTGGG - Intronic
961094192 3:124140774-124140796 AAGCAGCAGCCTTGCCCTCCCGG + Intronic
961311274 3:126003696-126003718 GGGCAAGAGCCCTGCGCTCCTGG + Intergenic
961493514 3:127274148-127274170 AGGCAGGAGCCCTGTCCTCCTGG + Intergenic
961525713 3:127496182-127496204 AGGCAGGAGCCCCACCCTCCTGG + Intergenic
961647712 3:128401246-128401268 AGGCAGGGGTCCTGCCCTGCTGG + Intronic
961791269 3:129378433-129378455 AGGCAGGAGCCCTGCCCTCCGGG - Intergenic
961943074 3:130657048-130657070 AGGCAGGGGCCCTGCCCTCCTGG - Intronic
962891463 3:139676643-139676665 AGACAGGGGCCCTGCCCTCCTGG - Intronic
963125540 3:141812564-141812586 AGGCATGAATCCTGCCCTCCAGG + Intronic
963346174 3:144098893-144098915 AGGCAGGAGCCCAGTGCTCCTGG + Intergenic
963805025 3:149714272-149714294 AGGCAGGAGCCCCGCCCTCCTGG + Intronic
964791963 3:160460770-160460792 AGGCAGGAGCCCCACCCTCCTGG - Intronic
965036837 3:163450919-163450941 AGATGGGAGCCCTGCCCTCCTGG + Intergenic
965117969 3:164515581-164515603 GGGCAGGAGCCCCACCCAGCTGG - Intergenic
965206269 3:165721305-165721327 GGGCAGGAGCCCTTCCCTCCCGG - Intergenic
965364017 3:167776367-167776389 TGGCAGGTCCCCAGCCCTCCTGG - Intronic
965367658 3:167820348-167820370 AGGCGGGAGCCCAGCCAACCTGG + Intronic
965757320 3:172039978-172040000 AGGCGGGGGCCGCCCCCTCCCGG - Intronic
965793202 3:172411359-172411381 TGGCAGGAGTCCCGCTCCCCAGG - Intergenic
965793222 3:172411440-172411462 GCACAGGAGCCCCACCCTCCTGG - Intergenic
965924405 3:173959126-173959148 AGGCAGGTGTCCTGCCCTCCTGG - Intronic
966840025 3:184081056-184081078 AGGCAGGAGCCCCACCCTCCTGG + Intergenic
966880144 3:184345435-184345457 GGGCAGGAGCCAGCCCCTCCAGG - Intronic
967094253 3:186163653-186163675 AGCCAGGAGCCCCATCCTCCTGG - Intronic
967649961 3:191973849-191973871 AGGCAGGAGCCTTGCCTTCCTGG - Intergenic
967791459 3:193553435-193553457 AGGAAGGAGCCCCTGCCTTCTGG + Intronic
968521236 4:1035731-1035753 AGGCAGCACCCCCGCCCGCCGGG + Intergenic
968538802 4:1151725-1151747 AGGCAGGAGCCCCACCCCTCTGG - Intergenic
968838442 4:2982170-2982192 GGGCAGGAGCCCCACACTACTGG - Intronic
968893528 4:3385293-3385315 AGGCAGGAACCCCTTCCTGCGGG - Intronic
969179124 4:5423916-5423938 AGGCGGGATTCCTGCCCTCCTGG + Intronic
969194073 4:5546984-5547006 AGGCAGGAGCCCCACCCCTGTGG + Intronic
969986538 4:11217420-11217442 AGGCAGGAGTCCCACCCTCTTGG + Intergenic
970959539 4:21856623-21856645 AGGCAGGAGCCCCACCTTCCCGG + Intronic
971557985 4:28037974-28037996 AGGAAGGAGCCACTCCCACCAGG + Intergenic
972072471 4:35038585-35038607 AGGCAGGAGTGCTGCCCTTCTGG + Intergenic
972158946 4:36198951-36198973 AGACAGGAGTCCTGCTCTCCTGG - Intronic
972203758 4:36747436-36747458 AGGCAGAAGCCCCACCCTCCTGG + Intergenic
972788085 4:42346103-42346125 TGGCACGAGCCCTGCCCGCCTGG + Intergenic
972931152 4:44072518-44072540 AGGTAGGAGTCCCGCCCCACTGG - Intergenic
972941475 4:44200275-44200297 AGGGAGGAGCCCCTCCTTCTTGG - Intronic
973225024 4:47774330-47774352 GGGCAGGAGCCCTGCACTCCCGG + Intronic
973639281 4:52887050-52887072 AGGCAAGAGCCTCATCCTCCTGG + Intronic
974116945 4:57590589-57590611 AGGCAGGAGTGCAGCCCTCAAGG - Intergenic
974278568 4:59759586-59759608 AGGCCGGATCCCCACCCTCCTGG - Intergenic
974436826 4:61867354-61867376 AGGCATGAGCCCACCACTCCTGG - Intronic
975040970 4:69743945-69743967 AGGCAGGAGCACTGCCTTCCTGG - Intronic
975040994 4:69744036-69744058 AGGCAGGAGCCCCACCCTCCTGG - Intronic
975254444 4:72216689-72216711 AAGCAGGAGCCCTGCTCTCCTGG - Intergenic
975469940 4:74754337-74754359 AGCCATGAGCCCTGCCCTCTAGG + Intronic
975597861 4:76067002-76067024 AGGCAGGAGCCCTGCCCTCCTGG - Intronic
976511199 4:85911134-85911156 AGGCAGGAGCCCCGCCCTCCTGG - Intronic
976734601 4:88296890-88296912 AGGCAGGAGCCCCACCCTCCTGG - Intergenic
977682888 4:99814905-99814927 ATGCTGGAGCCCATCCCTCCCGG - Intergenic
978219849 4:106256667-106256689 AGGCAGGAGCCCCACGTTCCCGG - Intronic
978600138 4:110418917-110418939 AGCCAGGACCCGCCCCCTCCAGG - Intronic
979090693 4:116478536-116478558 GGGCTGGAGCCCCGGCCTCCAGG - Intergenic
979575533 4:122287491-122287513 AGGCAGGAGCCACGCCTTAGTGG + Intronic
980180086 4:129392190-129392212 AGGTAGGAGCCCCACCCTCCTGG + Intergenic
980306390 4:131065611-131065633 AGGCAGGAGCTCCACTCTCCTGG - Intergenic
980562957 4:134501888-134501910 GGTCAGGAGCCCTGCCCTGCGGG - Intergenic
980574476 4:134666844-134666866 AGATGGGAGCCCCGCCCTCCTGG - Intergenic
980703046 4:136457375-136457397 TGGTAGGAGCCCCACCCTCCTGG + Intergenic
980731048 4:136824343-136824365 AGGCAGGAGCCCCACCCTCCAGG - Intergenic
980738153 4:136917651-136917673 AGGCAAGAGACCTGCCCTCGTGG + Intergenic
980740638 4:136946363-136946385 AGGTGGGAGCCCTACCCTCCTGG + Intergenic
980750208 4:137077545-137077567 AGGCAGGAATCCTGCCCTCCTGG - Intergenic
982180997 4:152748483-152748505 GGGCAGGAGCCCCAACCTCCCGG + Intronic
982545086 4:156724155-156724177 AGGCAGGAGCCCCGCCCTCCTGG + Intergenic
982610939 4:157574371-157574393 AGGCAGGAGCGCCACCTTCCTGG + Intergenic
983220303 4:165037599-165037621 AGGCATGAGCCACCACCTCCTGG + Intronic
983491754 4:168397950-168397972 AGGCAGGAGCCCCGCCCTTATGG + Intronic
983648582 4:170016591-170016613 CGACAGGAGCCCAGCCCTCTAGG - Intronic
983715341 4:170775928-170775950 AGGCAGGAGCTCTACCATCCTGG + Intergenic
984170309 4:176350819-176350841 GAGTAGGAGCCCCGCCCTCCAGG - Intergenic
984275720 4:177607242-177607264 GGTCCGGAGCCCTGCCCTCCGGG + Intergenic
984952931 4:185019960-185019982 TCGCAGGACCCCTGCCCTCCTGG - Intronic
985286048 4:188337078-188337100 AGGCAGCAGGACCGCCCTCCCGG - Intergenic
985451743 4:190066743-190066765 TAGCGGGACCCCCGCCCTCCGGG + Intergenic
985452731 4:190070035-190070057 TAGCGGGACCCCCGCCCTCCGGG + Intergenic
985453717 4:190073328-190073350 TAGCGGGACCCCCGCCCTCCGGG + Intergenic
985454706 4:190076621-190076643 TAGCGGGACCCCCGCCCTCCGGG + Intergenic
985455696 4:190079918-190079940 TAGCGGGACCCCCGCCCTCCGGG + Intergenic
985456679 4:190083212-190083234 TAGCGGGACCCCCGCCCTCCGGG + Intergenic
985457666 4:190086508-190086530 TAGCGGGACCCCCGCCCTCCGGG + Intergenic
985458654 4:190089805-190089827 TAGCGGGACCCCCGCCCTCCGGG + Intergenic
985459643 4:190093105-190093127 TAGCGGGACCCCCGCCCTCCGGG + Intergenic
985696673 5:1344882-1344904 AGCCGCGAGCCCCGCCCGCCCGG + Exonic
985916040 5:2919861-2919883 GTGCAGGAGCCCCACACTCCTGG + Intergenic
986496729 5:8349724-8349746 ACGCAGGAGCCACCTCCTCCAGG + Intergenic
986923442 5:12717010-12717032 AGGCAGGAGCCCTGTGCTCCTGG + Intergenic
987396659 5:17430769-17430791 AGGGAGGAGCCCAGCTCACCTGG + Intergenic
988346265 5:30041799-30041821 GGGCAGGAGCACCGCCCTCCTGG + Intergenic
988586496 5:32511848-32511870 AGGCAGGATCCCCTGCCCCCAGG - Intergenic
988705098 5:33718293-33718315 AAGCAGGGGCCCCAACCTCCAGG + Intronic
988935489 5:36078535-36078557 AGGCAGGAACCCTGCCCTCCTGG - Intergenic
989156914 5:38352940-38352962 AAGCATGAGCCTTGCCCTCCTGG + Intronic
990639008 5:57761668-57761690 AAGCAGGAGCCACGCCCTCCTGG + Intergenic
991359402 5:65803588-65803610 AGGCAGGAGCCCCACCCTCCTGG - Intronic
991359423 5:65803679-65803701 AGGCAGGAGCCCTACCCTCCTGG - Intronic
991359444 5:65803770-65803792 GGGCAAGAGCCTCACCCTCCTGG - Intronic
991575564 5:68099671-68099693 AGGCAGGAGGCCCTAACTCCCGG - Intergenic
992839033 5:80668766-80668788 AGGCAGGAGCCCCACCCTCCTGG - Intronic
994450043 5:99929909-99929931 AGGCAGGAGCCCTGCCCTCTGGG - Intergenic
994451474 5:99950162-99950184 GGGGAGGAGCCCTGCGCTCCTGG + Intergenic
994725823 5:103434290-103434312 AAGCAGGAGCCCCACCCTCCTGG + Intergenic
994891197 5:105639288-105639310 TAGCAGGAGCCCCACCCTACTGG + Intergenic
995745079 5:115394239-115394261 AGGCAGGAACCCCATGCTCCTGG - Intergenic
996183742 5:120451513-120451535 AGGCAAGAGACCTGCCCTCCTGG - Intergenic
996234533 5:121109027-121109049 AGGGAGGAGCCCCGCCCTTTTGG - Intergenic
996923969 5:128800536-128800558 GGCCAGGAGCCCTGTCCTCCTGG - Intronic
997960302 5:138316008-138316030 AGGCAGAAGCCCTGCCCTCCTGG + Intronic
997960329 5:138316101-138316123 AGGCAGGATCCCTGCCTTCCCGG + Intronic
998093043 5:139382079-139382101 AGGCAGGACCCCAGAGCTCCAGG + Intronic
998957511 5:147453249-147453271 AGCCGCGAGCCCCGCGCTCCTGG + Intronic
999451426 5:151681170-151681192 AGCCAAGAGCCAGGCCCTCCAGG + Intronic
999736709 5:154518394-154518416 AGGCAGGCACCCCTCCCTGCAGG - Intergenic
999738069 5:154527561-154527583 AGCCCAGAGCCCTGCCCTCCAGG - Intergenic
999799568 5:155020081-155020103 AGGCAGGAGCCCCGCCCTCCTGG - Intergenic
1000426133 5:161093473-161093495 AGGCAGGACCCCTGCCCTCCAGG + Intergenic
1000854353 5:166379846-166379868 GGGCAGGAGCCCCGTCCTCCTGG - Intergenic
1002072500 5:176688473-176688495 AGACAGGAACCCTGCCCTCCTGG - Intergenic
1002529857 5:179837831-179837853 AGGCAGCAGCCCCTGCCTCCAGG - Exonic
1002656110 5:180748830-180748852 AGGCAGGAGCCTCCTCCCCCAGG + Intergenic
1002710965 5:181194878-181194900 GGTCAGGAGCCCAGCTCTCCAGG - Exonic
1002827746 6:788482-788504 AAGCAGGGGACCCACCCTCCTGG - Intergenic
1002981690 6:2144325-2144347 AGACAGGAGGCCCGCCATGCAGG + Intronic
1003157236 6:3607145-3607167 AGGCGGGAGCCCGGCTCTGCAGG - Intergenic
1003171432 6:3724620-3724642 AAGCAGCTGCCCCGCCCTCCTGG + Intronic
1003923430 6:10855420-10855442 AGGAAGGAGCCCCACCCTCCTGG + Intronic
1004476812 6:15980982-15981004 AGGCAGAATCCCCGCCCTTAAGG + Intergenic
1004520688 6:16358734-16358756 AAGCAGGAGCCCCGCCCTCTTGG + Intronic
1004696917 6:18042678-18042700 AGGCAGGAACCCCACTCTCCTGG + Intergenic
1005332304 6:24761657-24761679 TGGTGGGAGCCCCACCCTCCTGG - Intergenic
1005775720 6:29129501-29129523 AGGCAGAAACCTCACCCTCCCGG + Intergenic
1005775736 6:29129582-29129604 TGCCAGGAGCCCTGCCCTTCTGG + Intergenic
1005960751 6:30691066-30691088 GTGCAGGAGCCCCGCCCTCCTGG - Exonic
1006113772 6:31764373-31764395 GGGCAGGAGCCCCACCCTACAGG + Intronic
1006407761 6:33855207-33855229 ATTCAGGAGCCCCAGCCTCCCGG - Intergenic
1006467260 6:34203078-34203100 CGACAGAAGCCCCGCCCTCTTGG - Intergenic
1006753888 6:36397778-36397800 AGGCAGGAGCCCAGGAATCCAGG + Intronic
1006867766 6:37222711-37222733 AGGCAGAAGTCCCGCCCTCTTGG - Intronic
1007309062 6:40930807-40930829 AGGGAGGAGCCAGGCCTTCCAGG + Intergenic
1007432028 6:41782026-41782048 AGAGATGAGCCCCGCCCTCAAGG - Intronic
1007630355 6:43269950-43269972 AGGCTGGGCCCCCCCCCTCCTGG + Intronic
1008330761 6:50241216-50241238 ATGCGGGAATCCCGCCCTCCCGG - Intergenic
1008639618 6:53448430-53448452 GGGCAGAAGCTCCACCCTCCAGG - Intergenic
1009643210 6:66363264-66363286 GGGCAGGAGCCCCATGCTCCTGG - Intergenic
1010233878 6:73558970-73558992 GGGGAGGAGCCCCATCCTCCAGG + Intergenic
1011185699 6:84673331-84673353 AGGCAGAATCCCTGCCCTCATGG - Intergenic
1011641964 6:89424215-89424237 AGACAGCTGCCCCACCCTCCTGG + Intergenic
1011801368 6:91019750-91019772 AGGCAGGAGCCAGGTCCTGCAGG - Intergenic
1012122245 6:95383890-95383912 AGGCAGGAGCCCTGCCCTCCTGG + Intergenic
1012752673 6:103183787-103183809 AGGCAGGAGCCCCACCCTCCTGG + Intergenic
1012889825 6:104885538-104885560 GGGCAGGAGCCCCATGCTCCTGG + Intergenic
1013048887 6:106512665-106512687 GGGCAGGAGCCGTGCCCTCGAGG + Exonic
1013375374 6:109509600-109509622 AGGCAGCAGCCTCATCCTCCTGG + Intronic
1013394639 6:109722945-109722967 AGGAAGGAGCCCTGCCTTCTTGG + Intronic
1013692907 6:112667271-112667293 AGGCAGAAGCCCCACCCTCCTGG + Intergenic
1014391562 6:120871951-120871973 AGGAAGGAGCCCTGCCCTCCCGG + Intergenic
1015663593 6:135603114-135603136 AGGCGGGAGGCTCACCCTCCTGG + Intergenic
1016076871 6:139805619-139805641 GGGCAGGAGCCCTGCCCTCCTGG - Intergenic
1016190585 6:141260711-141260733 AGGCAGGATCCCCACTGTCCTGG + Intergenic
1016190610 6:141260803-141260825 AGGCAGGATCCCTGCCATCCAGG + Intergenic
1016190627 6:141260882-141260904 AGGCAGGAGCTCCGCCCCTTTGG + Intergenic
1017054384 6:150424452-150424474 AGGCAGGAGCCCCACCCCTCAGG + Intergenic
1017522462 6:155214036-155214058 AGGAAGGAGCCCCGCCCTCCCGG - Intronic
1017955073 6:159170257-159170279 CGGCAGGAGGCCCGCGCGCCCGG + Intronic
1018775732 6:167013632-167013654 TGACAGGAGCCCAGCGCTCCAGG - Intronic
1018802576 6:167235671-167235693 GGGTAGGAGCCCCACCCTCCTGG - Intergenic
1018802598 6:167235757-167235779 AGGCAGGAGCCGTGCGCTCCTGG - Intergenic
1019007133 6:168808431-168808453 AGGCAGGAGCCCCTCACCCCTGG - Intergenic
1019024815 6:168950643-168950665 AGGCCAGAGCCACGGCCTCCAGG - Intergenic
1019277413 7:183086-183108 AGGCATGAGCTCCTCCTTCCTGG - Intergenic
1019898005 7:3998040-3998062 AGGCAGGATCCCTGCCCTCTTGG - Intronic
1019971047 7:4541110-4541132 AGGAATGAGCCCAGCCATCCAGG + Intergenic
1020114249 7:5466773-5466795 AGGCAGGAGCCCGGGACTCCTGG + Intronic
1020586656 7:10078557-10078579 AGGCAGGAGACCTACCCTTCTGG + Intergenic
1021021237 7:15600411-15600433 AGGCAGCAGCCCTGCCCTTCTGG - Intergenic
1021021258 7:15600501-15600523 AGGCAGGAGCCCCACCCTTCCGG - Intergenic
1021270142 7:18574934-18574956 GGGCAGAAGCCCCACCCTCCGGG - Intronic
1021561538 7:21972597-21972619 AGGCAGGATTCCTGCCCTCCTGG - Intergenic
1022742597 7:33137386-33137408 GGCCAGGAGCCCTGCGCTCCTGG - Intronic
1023700148 7:42884011-42884033 AGGCAGGAGCCCTGCCATCCTGG - Intergenic
1023768917 7:43536862-43536884 ACGGAGGAGCCACTCCCTCCTGG + Intronic
1023788993 7:43737278-43737300 AGGCAGGAAACCTGCCCTCCTGG + Intergenic
1023790601 7:43750220-43750242 AGGCTGGAGCCATGCCCTCCTGG - Intergenic
1024024441 7:45399257-45399279 GGTTGGGAGCCCCGCCCTCCCGG + Intergenic
1024786318 7:52911521-52911543 AGGCTGGAGCTCTTCCCTCCCGG - Intergenic
1025784083 7:64628307-64628329 ATGCATGAGCCCTGCCCTCTGGG + Intergenic
1025976995 7:66377489-66377511 AGGCAAGAGCCCGGCCCCCATGG + Intronic
1027128241 7:75572642-75572664 AGGCAGAAGCCTCACCCTGCTGG + Intronic
1027333868 7:77127361-77127383 AGTCAGGAGCCCCACCCTCCTGG - Intronic
1027735039 7:81920970-81920992 TGGCAGAAGCCCTGCACTCCTGG - Intergenic
1027924732 7:84446908-84446930 GGGCAGGAGCCCCGCACTCTTGG + Intronic
1028024487 7:85820828-85820850 AGGCAGGAACCCTGCGCTCTTGG + Intergenic
1028082640 7:86598487-86598509 AGGCAGGACAACCGCCCACCTGG + Intergenic
1028136651 7:87230142-87230164 GGGCAGGAGCCCTGCCCTCCTGG + Intergenic
1028527516 7:91801825-91801847 AGGCAGGAGCCCCACTCTTCTGG - Intronic
1028596003 7:92546941-92546963 AGGCAGGATCCCCACCCTCCTGG + Intergenic
1028816987 7:95157402-95157424 AGGCAGGAGCCTAACCCTCCTGG - Intronic
1029290391 7:99497996-99498018 AGGCAGTAGTCCCCCCTTCCTGG - Intronic
1029781924 7:102743953-102743975 AGTCAGGAGCCCCACCCTCCTGG + Intergenic
1029899176 7:104021922-104021944 AGGTGAGAGCCCTGCCCTCCTGG + Intergenic
1030721835 7:112880978-112881000 GGGAAAGAGCCCCACCCTCCTGG + Intronic
1031017037 7:116586263-116586285 AGGCAGGACCCCAGCCCTACAGG + Intergenic
1031248562 7:119350317-119350339 AGGCAGGAGTCTTGCTCTCCTGG + Intergenic
1031991403 7:128201424-128201446 CGGCAGGAGCCCCGCCCACCTGG - Intergenic
1032011528 7:128351014-128351036 AGGAAGCAGCCCCAGCCTCCCGG - Exonic
1032096586 7:128941213-128941235 GGGCACGAGCCCCGCCTCCCAGG - Intronic
1032687823 7:134253534-134253556 AGGCATGAGCCACGCCGCCCAGG - Intronic
1034210513 7:149358642-149358664 AGGCAACGGCCCCACCCTCCTGG - Intergenic
1034406377 7:150905540-150905562 AGACAGGAGCCACCCTCTCCAGG - Intergenic
1034411032 7:150942320-150942342 AGCCAGGTGCCCAGCCCTGCGGG + Intergenic
1034462911 7:151208146-151208168 AGGCAGGACCCCCCCTCCCCTGG - Intronic
1034481084 7:151320879-151320901 AGGCAGCAGTCCTGCCCTCCTGG + Intergenic
1034488538 7:151381029-151381051 GGGCAGGAGGCCCGCCGCCCTGG + Intronic
1035271315 7:157721747-157721769 AGGCAGAAACCCGGCTCTCCAGG - Intronic
1035316790 7:158001562-158001584 AGGCTGAAGTGCCGCCCTCCCGG - Intronic
1035320917 7:158028787-158028809 CTGCAGCTGCCCCGCCCTCCTGG - Intronic
1036907515 8:12719941-12719963 GGGCAGGAGCCCCACACTCATGG + Intergenic
1037116572 8:15236274-15236296 ACGCAGGAGCCCAGTTCTCCAGG - Intronic
1037150137 8:15626524-15626546 AGGCAGCAACCTTGCCCTCCTGG + Intronic
1038816750 8:30912319-30912341 GGGCGGGAGCCCCGCCGCCCCGG - Intergenic
1038818398 8:30930238-30930260 TGGCAGCAGCCCTGACCTCCTGG + Intergenic
1039210241 8:35205011-35205033 GGGCAGGAGCCCTGCACTGCTGG - Intergenic
1039848179 8:41341041-41341063 AGGCATGAGCCACCCCCTCTTGG - Intergenic
1041407453 8:57515765-57515787 AGGCGGGAGCCCAGCCCTGAAGG + Intergenic
1042101844 8:65282624-65282646 AGGCATGATTCCTGCCCTCCAGG - Intergenic
1042395947 8:68292485-68292507 AGGCAGGAGTCCCATCCTCCTGG + Intergenic
1042761054 8:72271817-72271839 ATGCAGTAGCCCTGCCCTGCAGG + Intergenic
1043195418 8:77287006-77287028 AGGCAGGAGCTCCACCCTCCTGG + Intergenic
1043549743 8:81357034-81357056 AGGCTGGAGGCCCTGCCTCCAGG - Intergenic
1043735126 8:83731406-83731428 AGGCACAAGCCCCACCCTTCTGG - Intergenic
1043798770 8:84579417-84579439 GGGCTGGAGCCCCACGCTCCTGG - Intronic
1044008897 8:86967355-86967377 AGACAGGAGCCTGGCCCTCCTGG - Intronic
1044259325 8:90098715-90098737 AAGCAGAAGCCCCTTCCTCCTGG - Intergenic
1047104799 8:121720406-121720428 AGGCAGGAGCCCTGCCCACCTGG - Intergenic
1048262344 8:132955695-132955717 GTCCAGGAGCCCCGCCCTCCAGG - Intronic
1048421814 8:134284576-134284598 AGGCAGAAGCCCTGCCCCACTGG - Intergenic
1048421831 8:134284657-134284679 AGGCAGGAACCCCACCCTCCTGG - Intergenic
1049021677 8:139961462-139961484 AGGCAAGAGCCCCACCCTACTGG + Intronic
1049236056 8:141513010-141513032 AGGCTGAAGCCCAGCCCTCCAGG - Intergenic
1049324274 8:142013964-142013986 GAGCAGGTGCCCCACCCTCCAGG + Intergenic
1049823882 8:144654746-144654768 AGGAGGAAGCCCAGCCCTCCTGG + Intergenic
1049823923 8:144654918-144654940 AGGCAGGAGCCCCACCCCAATGG + Intergenic
1049969275 9:807440-807462 AGGCTGTAGCGCTGCCCTCCAGG + Intergenic
1051001699 9:12290506-12290528 AGGCAGGAGCCCTGCCCCACTGG + Intergenic
1051029730 9:12659007-12659029 AGTCAGGAGCCCCACCCTGCTGG - Intergenic
1052707431 9:32010575-32010597 AGGCAGAAGCCCCGCCCTCCTGG + Intergenic
1052915705 9:33923132-33923154 AGGCAGGAGCCCACCACTCCAGG + Intronic
1053076470 9:35138754-35138776 AGGCAGGAGCCATGCCCTTCTGG + Intergenic
1053132300 9:35623030-35623052 TGACAGCAGCCTCGCCCTCCTGG - Intronic
1053153430 9:35757103-35757125 AGGCTGGAGCGCCGCCCGGCCGG - Exonic
1053462762 9:38283126-38283148 AGGCTGGATCCCTGACCTCCAGG - Intergenic
1055572531 9:77632010-77632032 AGGCAGGAGCCCTACCCTGCTGG + Intronic
1055776055 9:79768281-79768303 AGGCAGGAGAGCAGCCCTGCAGG - Intergenic
1055902306 9:81254965-81254987 AGGCATGAGCCACCCCCACCTGG + Intergenic
1056592531 9:87974815-87974837 GGGAAGGAGCCCGCCCCTCCCGG - Intergenic
1056843403 9:90017333-90017355 AGGCTGGGGCACCGTCCTCCAGG + Intergenic
1056922401 9:90802097-90802119 AGGCCTGAGCCCCTCTCTCCCGG - Intronic
1057468413 9:95337177-95337199 AGGCAGGATGCCCACCCTCCAGG + Intergenic
1057510937 9:95678941-95678963 AGGCAGGAACCCCGCCCTCCTGG - Intergenic
1057548381 9:96034748-96034770 GGACAGGGGCCCCACCCTCCTGG + Intergenic
1057582924 9:96303456-96303478 AGGGAGGAGCCATGCCCTACGGG + Intergenic
1058091742 9:100813693-100813715 AGGCAGGAGACTCACCCTCCTGG - Intergenic
1058091789 9:100813892-100813914 AGGCAGGATCCCTGCTTTCCTGG - Intergenic
1058415948 9:104788733-104788755 AGGCAGGAACCCTGCCTGCCAGG - Intronic
1059060650 9:111032443-111032465 AGGCAGGATTCCCACCCTCCAGG - Intronic
1059062171 9:111045013-111045035 AGCCAGAAGCCCAGCCCTTCAGG - Intergenic
1059433655 9:114264273-114264295 TTGGAGCAGCCCCGCCCTCCTGG + Intronic
1059565410 9:115379572-115379594 AGGCAGGAGCCCCACTCTCCTGG + Intronic
1059963689 9:119592495-119592517 AGGAATGATCCCTGCCCTCCTGG + Intergenic
1060408011 9:123382200-123382222 AGGCAGGAGCCCTGGACTCAGGG + Exonic
1060579703 9:124734277-124734299 AGGTCGGATCCCCGCCCTCATGG - Intronic
1061201413 9:129140558-129140580 AGACAAGAGCCCCTGCCTCCTGG - Intronic
1061248922 9:129415224-129415246 AGAAAGGAACCCCGCCCTGCAGG + Intergenic
1061832548 9:133304810-133304832 AGGAAGGGGCCCTGCCCACCTGG - Intergenic
1062035041 9:134379242-134379264 AGGCCCGAGCCCCGCCCTCAGGG - Intronic
1062119298 9:134825518-134825540 AGGCCGGACCCCAACCCTCCTGG + Intronic
1062165225 9:135104297-135104319 TGGCCAGAGCCCCGCCCTGCTGG - Intronic
1062170922 9:135134211-135134233 AGGGAGGAGGCCCGAACTCCAGG + Intergenic
1062184601 9:135211317-135211339 AGGCAGGAGCCCCACCCTCTTGG + Intergenic
1062266432 9:135688474-135688496 AGGCTGGACCCCCGTCCTGCAGG + Intergenic
1062266447 9:135688539-135688561 AGGCCGGAGCCCCGTCCTGCAGG + Intergenic
1062266462 9:135688605-135688627 AGGCTGGACCCCCGTCCTGCAGG + Intergenic
1062266475 9:135688671-135688693 AGGCTGGACCCCCGTCCTGCAGG + Intergenic
1062266488 9:135688737-135688759 AGGCTGGACCCCCGTCCTGCAGG + Intergenic
1062511244 9:136907342-136907364 GGGCAGAGGCCCTGCCCTCCTGG - Intronic
1062524640 9:136973310-136973332 AGGCAGGAGCCCCCATCTCAGGG + Intergenic
1062620114 9:137416836-137416858 GGGCAGGAGCCGCTCCCACCTGG + Intronic
1185451296 X:281726-281748 GGGAAGAAGCCCCGGCCTCCTGG - Intronic
1185859707 X:3566252-3566274 AGACAGGACCTCCTCCCTCCAGG + Intergenic
1187181319 X:16946476-16946498 AGGCACGGGGCCCGCCTTCCTGG + Intergenic
1188005336 X:25012829-25012851 TGGCAGGGGCCCCGGCCTCGGGG - Intronic
1188434768 X:30148097-30148119 GGGCAGAAGCCCCGCCCTCCTGG + Intergenic
1188756394 X:33968950-33968972 AGGCAGGAGCCCTGCCCTCCTGG + Intergenic
1189023760 X:37370473-37370495 AGGCAGGAGCTGTGCCCTCCAGG + Intronic
1189023784 X:37370564-37370586 AGGCTGGAGCCCTACCCTCCTGG + Intronic
1189083487 X:37997361-37997383 AGGCAGGAGTCCTGCCCTCCTGG + Intronic
1189291131 X:39886844-39886866 AGGCTGGGTCCCCGCTCTCCTGG - Intergenic
1189908645 X:45787410-45787432 GCGCAGGATCCCCGCCCCCCCGG - Intergenic
1190360670 X:49645410-49645432 AGGCGGGAGCCCCACCCTCCTGG - Intergenic
1190445001 X:50515181-50515203 GGGCAGGAGCCCTGACCTCCTGG - Intergenic
1190681612 X:52831114-52831136 AGGCAGGATCCCTGCCCTCCTGG + Intergenic
1190998683 X:55637098-55637120 AGGCAGGATCCCTGCCCTCCTGG + Intergenic
1191221097 X:57989456-57989478 AGGCAAAAACCCCTCCCTCCTGG + Intergenic
1192089676 X:68140608-68140630 AGCCGGGAGCCCAGCCCTTCAGG - Intronic
1192265432 X:69534176-69534198 AGGCAGGAGCCCTGCCCTCCTGG - Intergenic
1193108575 X:77704922-77704944 AGGCAGGAGCCCTGCCCCACTGG - Intronic
1193108596 X:77705003-77705025 AGGCTGGAGTCCCACCCTCCTGG - Intronic
1193108634 X:77705174-77705196 AGGCAGGAGACCCACCCTCCCGG - Intronic
1194205203 X:91003216-91003238 AAGCAGGAGCCCCACCCTCCCGG - Intergenic
1194379223 X:93174582-93174604 CAGCAAGAGCCCCACCCTCCCGG + Intergenic
1194380161 X:93181306-93181328 AGGGAGGAGCCCCACCCTACTGG + Intergenic
1195126386 X:101813335-101813357 AGGCGGGAGCCCCGCCCTCCAGG + Intergenic
1195454400 X:105051566-105051588 AGACAGGAGCCCTGCCCTCCTGG - Intronic
1197378242 X:125709170-125709192 AGGCAGCAGCCCCACCATCATGG + Intergenic
1197378266 X:125709261-125709283 AGGTGGGAGCCCCACCCTCCCGG + Intergenic
1197421122 X:126237920-126237942 AGGCAGCAGCCCCACCCCCTCGG + Intergenic
1197796147 X:130300087-130300109 AGGCAGGAGCCCCACCCTCCTGG - Intergenic
1197809201 X:130426687-130426709 AGGCAGGAGCCCCTCATTCCAGG + Intergenic
1198437397 X:136630528-136630550 AGGCAGGATCCCTGCCCTCAAGG - Intergenic
1198699595 X:139382639-139382661 AGGCAGGAGCCCCACCCTCCTGG - Intergenic
1199092165 X:143705250-143705272 AGGCAGGAGCCCTGTCCCCATGG + Intergenic
1199769275 X:150963915-150963937 AGGCAGGAGCCCCGGGTTCTAGG + Intergenic
1199861214 X:151801654-151801676 AGGCAGGAGCCCCAACCTCCTGG - Intergenic
1199874931 X:151921782-151921804 AGGGAGGACCCTGGCCCTCCTGG + Intronic
1200097807 X:153672339-153672361 AGGCTGGAGCTCTGCCTTCCTGG - Intronic
1200208194 X:154332792-154332814 GGGTAGGAGCCATGCCCTCCAGG - Intergenic
1200216688 X:154371262-154371284 AGGCTGCAGCACCGCCCCCCCGG - Exonic
1200280594 X:154773953-154773975 TGGCAGGAGCCGCCCCATCCGGG - Intronic
1200551021 Y:4578337-4578359 AAGCAGGAGCCCCACCCTCCTGG - Intergenic
1200806014 Y:7434608-7434630 AGACAGGACCTCCTCCCTCCAGG - Intergenic