ID: 1124650388

View in Genome Browser
Species Human (GRCh38)
Location 15:31469577-31469599
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124650388_1124650392 -5 Left 1124650388 15:31469577-31469599 CCTTCTTCGAAGCACAGGAGGCC No data
Right 1124650392 15:31469595-31469617 AGGCCTGGGTCTGCAGCTGTGGG No data
1124650388_1124650397 20 Left 1124650388 15:31469577-31469599 CCTTCTTCGAAGCACAGGAGGCC No data
Right 1124650397 15:31469620-31469642 GGGCGGCCACAGCGACTTTCAGG No data
1124650388_1124650395 0 Left 1124650388 15:31469577-31469599 CCTTCTTCGAAGCACAGGAGGCC No data
Right 1124650395 15:31469600-31469622 TGGGTCTGCAGCTGTGGGTTGGG No data
1124650388_1124650398 21 Left 1124650388 15:31469577-31469599 CCTTCTTCGAAGCACAGGAGGCC No data
Right 1124650398 15:31469621-31469643 GGCGGCCACAGCGACTTTCAGGG No data
1124650388_1124650391 -6 Left 1124650388 15:31469577-31469599 CCTTCTTCGAAGCACAGGAGGCC No data
Right 1124650391 15:31469594-31469616 GAGGCCTGGGTCTGCAGCTGTGG No data
1124650388_1124650396 3 Left 1124650388 15:31469577-31469599 CCTTCTTCGAAGCACAGGAGGCC No data
Right 1124650396 15:31469603-31469625 GTCTGCAGCTGTGGGTTGGGCGG No data
1124650388_1124650394 -1 Left 1124650388 15:31469577-31469599 CCTTCTTCGAAGCACAGGAGGCC No data
Right 1124650394 15:31469599-31469621 CTGGGTCTGCAGCTGTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124650388 Original CRISPR GGCCTCCTGTGCTTCGAAGA AGG (reversed) Intergenic