ID: 1124650389

View in Genome Browser
Species Human (GRCh38)
Location 15:31469580-31469602
Sequence TCTTCGAAGCACAGGAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124650383_1124650389 6 Left 1124650383 15:31469551-31469573 CCTTGTCCAGGAGGGCGGGGCTC No data
Right 1124650389 15:31469580-31469602 TCTTCGAAGCACAGGAGGCCTGG No data
1124650384_1124650389 0 Left 1124650384 15:31469557-31469579 CCAGGAGGGCGGGGCTCCTGCCT No data
Right 1124650389 15:31469580-31469602 TCTTCGAAGCACAGGAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124650389 Original CRISPR TCTTCGAAGCACAGGAGGCC TGG Intergenic