ID: 1124650390

View in Genome Browser
Species Human (GRCh38)
Location 15:31469581-31469603
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124650384_1124650390 1 Left 1124650384 15:31469557-31469579 CCAGGAGGGCGGGGCTCCTGCCT 0: 10
1: 51
2: 99
3: 182
4: 611
Right 1124650390 15:31469581-31469603 CTTCGAAGCACAGGAGGCCTGGG No data
1124650383_1124650390 7 Left 1124650383 15:31469551-31469573 CCTTGTCCAGGAGGGCGGGGCTC No data
Right 1124650390 15:31469581-31469603 CTTCGAAGCACAGGAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124650390 Original CRISPR CTTCGAAGCACAGGAGGCCT GGG Intergenic
No off target data available for this crispr