ID: 1124650391

View in Genome Browser
Species Human (GRCh38)
Location 15:31469594-31469616
Sequence GAGGCCTGGGTCTGCAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 984
Summary {0: 20, 1: 18, 2: 85, 3: 151, 4: 710}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124650384_1124650391 14 Left 1124650384 15:31469557-31469579 CCAGGAGGGCGGGGCTCCTGCCT 0: 10
1: 51
2: 99
3: 182
4: 611
Right 1124650391 15:31469594-31469616 GAGGCCTGGGTCTGCAGCTGTGG 0: 20
1: 18
2: 85
3: 151
4: 710
1124650388_1124650391 -6 Left 1124650388 15:31469577-31469599 CCTTCTTCGAAGCACAGGAGGCC No data
Right 1124650391 15:31469594-31469616 GAGGCCTGGGTCTGCAGCTGTGG 0: 20
1: 18
2: 85
3: 151
4: 710
1124650383_1124650391 20 Left 1124650383 15:31469551-31469573 CCTTGTCCAGGAGGGCGGGGCTC No data
Right 1124650391 15:31469594-31469616 GAGGCCTGGGTCTGCAGCTGTGG 0: 20
1: 18
2: 85
3: 151
4: 710
1124650386_1124650391 -2 Left 1124650386 15:31469573-31469595 CCTGCCTTCTTCGAAGCACAGGA No data
Right 1124650391 15:31469594-31469616 GAGGCCTGGGTCTGCAGCTGTGG 0: 20
1: 18
2: 85
3: 151
4: 710

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124650391 Original CRISPR GAGGCCTGGGTCTGCAGCTG TGG Intergenic
900288183 1:1911768-1911790 GTGGGGTGGGTTTGCAGCTGAGG + Intergenic
900303269 1:1988687-1988709 GAGTTCTGAGCCTGCAGCTGGGG - Intronic
900338946 1:2178780-2178802 GAGGCCTTGGTCCCCACCTGTGG + Intronic
900618797 1:3577623-3577645 GGGGCATGGGGCTGCTGCTGTGG + Intronic
900688357 1:3963647-3963669 AAGGCCTGAGTCTTTAGCTGGGG + Intergenic
900899851 1:5509041-5509063 GAGGTCTGGGTCCCCACCTGGGG - Intergenic
900977691 1:6027297-6027319 GGGGCCTGGGTGTGCGGCTATGG + Intronic
901231052 1:7641948-7641970 GAGGCCGGGGGCTGCGGGTGGGG - Intronic
901413257 1:9099769-9099791 GAGGCCTGCAGATGCAGCTGCGG + Intergenic
901493979 1:9610857-9610879 GAGGCCTGGCTGTGCGGCGGTGG + Intronic
901510445 1:9715814-9715836 GAGGGCTGGGTCAGCGGGTGGGG - Intronic
901691058 1:10973727-10973749 GAGGCCTGGATCTGCAGCTGCGG - Intronic
901936481 1:12630475-12630497 GAGGCCTGGGTCTGCAGCCAAGG - Intergenic
902087568 1:13875085-13875107 TAGGCCCAGGTCAGCAGCTGTGG - Intergenic
902372847 1:16016594-16016616 GGGGGATGGGTCTCCAGCTGTGG + Intronic
902375706 1:16029064-16029086 GAGGCTGGGGTCTGCCGCTGGGG + Intronic
902380660 1:16050816-16050838 GAGGCTGGGGTCTGCCGCTGGGG + Intronic
902775251 1:18670611-18670633 GATGCCTGGGGCTGCAGGTCTGG - Intronic
902809521 1:18880235-18880257 GACGCCCGGGTCTGCAGCTCAGG - Intronic
903082225 1:20820082-20820104 GAGGCTTGGGTCCGCAGCTATGG - Intronic
903163261 1:21504036-21504058 GGGGCCTGGGGATGGAGCTGTGG + Intergenic
903277017 1:22228783-22228805 GAGTCCCGGTGCTGCAGCTGGGG + Intergenic
903675428 1:25061747-25061769 GAGTCCTGGCTCTGAAGCTGAGG - Intergenic
903750284 1:25617059-25617081 GATGCCTGGGTCCGGAGCCGCGG - Intergenic
904003085 1:27349640-27349662 GCGGCCTTGGTCTGCAGAGGGGG - Exonic
904271211 1:29351343-29351365 GAAGCCTTGTTCTGCAGCTCAGG + Intergenic
904369992 1:30042320-30042342 TGGGTCTGGGTCTACAGCTGTGG - Intergenic
904551675 1:31324469-31324491 GATGCCTGGGTCTGCAGCCAGGG - Intronic
904614889 1:31744284-31744306 GTGGGCAGGGTCTGCAGGTGCGG - Exonic
905272498 1:36796103-36796125 GACGCCTGAGGCTGAAGCTGGGG + Exonic
905322317 1:37126820-37126842 CAGGCCTGGGACTGCAAGTGAGG + Intergenic
905839375 1:41162067-41162089 GAGGTCTGGGTTTGCAGCCTCGG - Intronic
905909656 1:41645133-41645155 GAGGCCTGGGATAGCAGCAGGGG - Intronic
906063122 1:42961103-42961125 GAGGACAGGTTCTGCAGCTGAGG + Intergenic
906503810 1:46362192-46362214 TAGACCTGGGGCTGCAGTTGGGG + Intronic
907761713 1:57367948-57367970 GATGCCTGGGTCCACAGCTGTGG - Intronic
909238403 1:73181213-73181235 GATGCCTGAGTCTTCAGCGGCGG + Intergenic
909734193 1:78935432-78935454 GAGGACTGGGTCAATAGCTGAGG + Intronic
909907730 1:81220645-81220667 GATGCCTGGGTCTGGAGCCATGG - Intergenic
912044389 1:105436813-105436835 GATGCCAGGGTCTGCAGCTGCGG - Intergenic
912362500 1:109106502-109106524 GAGGACTGGGTAAGCAGATGGGG - Intronic
913073235 1:115319733-115319755 GAGGGCTGGGTGCCCAGCTGAGG - Intronic
913366870 1:118048386-118048408 GAAGCCTGGGTCTGCTGAGGTGG - Intronic
914392836 1:147237292-147237314 GATGCCCAGGTCTGCAGCTGTGG + Intronic
914751148 1:150535861-150535883 GATGACTGGTTCTGCACCTGGGG + Intergenic
915014485 1:152720158-152720180 GGGGGCTGTGGCTGCAGCTGTGG + Exonic
915018703 1:152760282-152760304 GAGCCCTGGGTCTGGCACTGGGG - Exonic
915579287 1:156803823-156803845 CAGGGCTGGGCCTGCAGCTGTGG + Intergenic
915797486 1:158752248-158752270 GGTGCCTGGGTCCGCAGCCGTGG + Intergenic
915797540 1:158752473-158752495 GATGCCTGGGTCTGCAACAGTGG + Intergenic
916648940 1:166816970-166816992 GAGGGCCAGGTCTGCAGCTGAGG + Intergenic
916730773 1:167564889-167564911 GAGGCATGTGGCTGGAGCTGGGG - Intergenic
916824025 1:168427200-168427222 GAGAACTGGGTAGGCAGCTGGGG + Intergenic
916881698 1:169025069-169025091 GTTGGCTGGGTCTTCAGCTGGGG + Intergenic
916940531 1:169672318-169672340 CAGGGCTGGCTCTGCAGATGAGG - Intronic
917483366 1:175432392-175432414 GATTCCTGGTTCTGGAGCTGAGG - Intronic
918079132 1:181192239-181192261 GGGGCCTGTGGCAGCAGCTGAGG - Intergenic
919083377 1:192891996-192892018 GAGGCCCAGGTCTGCAGCCATGG + Intergenic
919165402 1:193885419-193885441 GAGGCCCAGGTCTGCAGCCAGGG + Intergenic
920122587 1:203669830-203669852 TAGGCCAGGCTCTGGAGCTGAGG + Intronic
920269418 1:204752104-204752126 GAGGCGTGGGTCTGTAGCTGCGG - Intergenic
921625283 1:217372734-217372756 GATGCCTGGGTCTGGAGCCATGG - Intergenic
921902180 1:220462953-220462975 GAGGCCTGGGTCTGCAGCTGTGG - Intergenic
922132606 1:222794895-222794917 GATGTCTGGGTCCGCAGCTGTGG - Intergenic
922132628 1:222794986-222795008 GAGGCCTGGATCTGCAGCCCTGG - Intergenic
922141792 1:222894633-222894655 GATGCCTGGGTCCGCAGCCATGG + Intronic
922569365 1:226624721-226624743 CAGGCCCCGGGCTGCAGCTGGGG + Intergenic
922752004 1:228074408-228074430 GGGGCCTGGCTGAGCAGCTGAGG + Exonic
922861182 1:228818229-228818251 GAGGCCTGGGTCTGCAGTCGTGG - Intergenic
923391252 1:233515733-233515755 GATGCCTGGGTCTGGAGCCGTGG - Intergenic
923551801 1:234970165-234970187 GACGGCGGCGTCTGCAGCTGGGG - Intergenic
924783910 1:247176854-247176876 GATGCCTGGGTCTGCAGCCATGG - Intergenic
1062770133 10:92523-92545 GATGCCTGGGTCCACAGCCGTGG + Intergenic
1062966571 10:1611897-1611919 GGTGCCTGGGGGTGCAGCTGGGG + Intronic
1063577525 10:7275139-7275161 CAGACCTGGGGCTGCAGCGGGGG + Intronic
1064010219 10:11729762-11729784 GATGCCTGGGTCCACAGCTGTGG - Intergenic
1064424903 10:15222039-15222061 GAGGCCTGCGATGGCAGCTGTGG + Intronic
1064683125 10:17832092-17832114 CTGGCCTGGGCCTGCACCTGAGG - Intronic
1065201563 10:23317373-23317395 GATGCCTGGGTCTGCAGCCATGG + Exonic
1066101641 10:32123024-32123046 GAGGCCCAGGTCTGCAGCTGAGG + Intergenic
1066422911 10:35278568-35278590 GAGGCATGTGTAGGCAGCTGAGG + Intronic
1067027608 10:42858154-42858176 GTGGCCTGGGTGTGATGCTGAGG + Intergenic
1067142438 10:43668503-43668525 GAGGCCTTGGTCTAGGGCTGAGG - Intergenic
1067421957 10:46159611-46159633 GATGCCTGACTCTGCAGCCGTGG + Intergenic
1067433867 10:46264034-46264056 AAGGCCTGGGTGCCCAGCTGAGG - Intergenic
1067439820 10:46302274-46302296 CAGGCCTGGGTGCCCAGCTGAGG + Intronic
1067507264 10:46865700-46865722 GATGCCTGACTCTGCAGCCGTGG + Intergenic
1067581972 10:47451856-47451878 GAGGCCTGGGTGCTCAGCTGAGG + Intergenic
1067693515 10:48519618-48519640 TGAGCCTGGGTCTGCCGCTGGGG - Intronic
1067832722 10:49619749-49619771 GTGGCCAGGGTCTGCTGCAGCGG - Exonic
1068129949 10:52884816-52884838 GTGGCTTGTGTCTGCAGTTGAGG + Intergenic
1068938326 10:62657499-62657521 GATGCCTGGGTCCAGAGCTGCGG - Intronic
1068967181 10:62924487-62924509 GAGGCCCAGGTCTGCAGCCGCGG + Intergenic
1069999545 10:72366121-72366143 GAGGCCTGGCTCTGCACCTGTGG - Intergenic
1070096319 10:73340888-73340910 GATGCCTGGGTATGCAGCTGTGG + Intronic
1070127578 10:73634559-73634581 GGGCTCTGGGTCTGGAGCTGGGG - Exonic
1070545748 10:77451174-77451196 GAGGGCTGTGGCTTCAGCTGAGG - Intronic
1072154878 10:92715131-92715153 GAGGCCTGGGTCTGTGGCCATGG + Intergenic
1072237848 10:93468637-93468659 GACACCAGGGTCTGAAGCTGAGG - Intronic
1072335660 10:94395772-94395794 GATGCCTGAGTCTGCAGCTGTGG + Intergenic
1072335682 10:94395899-94395921 GGAGGCTGGGTCTGCAGCAGCGG + Intergenic
1072356767 10:94619208-94619230 GAGGACTGAGTGTGCAGTTGTGG + Intergenic
1072744147 10:97928250-97928272 GAGGGAAGGGTCTGCAGGTGAGG + Intronic
1072753209 10:97999248-97999270 GATGCCTAGGTCTGCAGCTGGGG - Intronic
1072763910 10:98080824-98080846 GGGGCCTGGGGCTGGAGGTGAGG + Intergenic
1073260870 10:102189067-102189089 GAGGCCTGTATCTGGAGCTGTGG + Intergenic
1073293648 10:102425473-102425495 AAGGTCTGGGACTGCTGCTGGGG - Intronic
1073930264 10:108566916-108566938 GAGGCCTGGGTCCCCAACTAAGG - Intergenic
1074761512 10:116670262-116670284 GGCGCCTGGGTCTGCAGGTCTGG + Intronic
1074772334 10:116742270-116742292 GGGGCCGGGGTCAGCAGCAGCGG - Intronic
1074991644 10:118713331-118713353 GATGCCTGAGTCCACAGCTGTGG + Intronic
1075210411 10:120486134-120486156 GAGGCCAGGGCCTGCTTCTGTGG + Intronic
1075346455 10:121685615-121685637 GAGTCCTGGGGCTGGAGCTGGGG + Intergenic
1075573002 10:123558920-123558942 GCCGCCTGGGTCTGCAGCAGAGG - Intergenic
1075631527 10:124003498-124003520 GAAGCCTGGGGCTGGTGCTGAGG + Intergenic
1076334012 10:129692864-129692886 GAGGTCTGGGGCTGCAGCTGAGG - Intronic
1076570908 10:131432355-131432377 TAGGTCTGGGTCTTCAGATGAGG + Intergenic
1076757319 10:132579279-132579301 GGTGTCTGGGGCTGCAGCTGTGG + Intronic
1076858130 10:133127434-133127456 AAGGCCTGGGCCTGGACCTGGGG + Intronic
1076978429 11:192666-192688 GTGATCTGGGTCTGCATCTGGGG - Intronic
1077110767 11:861049-861071 GAGGCCTCTGTCTGAAGGTGGGG + Intronic
1077171509 11:1168369-1168391 GAGGCCTTTCCCTGCAGCTGCGG - Intronic
1077278270 11:1728128-1728150 GGGGCCAGGGTCTGCCACTGGGG + Intergenic
1077292352 11:1803782-1803804 GAGGCCTCGGTCAGCAGCACCGG + Intergenic
1077298946 11:1838446-1838468 GAGGCCTGGACCTCCAGATGTGG - Intergenic
1077343805 11:2037374-2037396 GAGGAAGGGGTCTGCAGCTGGGG + Intergenic
1077467396 11:2739931-2739953 GAGGCCTGGGTGTGCAGGTGGGG + Intronic
1077508059 11:2941254-2941276 GAGCCCTGGGCCTGCAGAAGGGG - Intergenic
1077551245 11:3201220-3201242 CAGGCATGGGGCTGCAGCAGGGG + Intergenic
1078345106 11:10541015-10541037 GAAGCCTGGCTCGGCAGCGGAGG + Intronic
1078464193 11:11538460-11538482 GAGGCCTGGGCCTGCAGGGTGGG + Intronic
1079249050 11:18773827-18773849 CTAGCCTGGGACTGCAGCTGGGG + Intronic
1079470455 11:20773195-20773217 GAACCCTGGTGCTGCAGCTGGGG - Intronic
1079733162 11:23961851-23961873 GAGGCCCGGGTCTGCAGCCCTGG - Intergenic
1079882437 11:25944260-25944282 CAGGTCTGTGTCTGCAGCTGTGG - Intergenic
1079882475 11:25944443-25944465 CAGGCGTGTGTCAGCAGCTGTGG + Intergenic
1080029579 11:27646726-27646748 GAGGGCTGAGTCTACAGATGAGG - Intergenic
1080584138 11:33666191-33666213 GAGGCCTGGGTCTGCAGTCATGG + Intronic
1080616670 11:33950345-33950367 GAGGCCTGGATTTTCAGCAGGGG + Intergenic
1081654671 11:44849532-44849554 TAGGCCTGGGGGTGCAGATGGGG + Intronic
1082750165 11:57006311-57006333 GATGCCTGAGTCTGCAGCTGTGG + Intergenic
1082795430 11:57375645-57375667 GAGGCCTGGGGCTGCAGAACTGG + Intergenic
1083174151 11:60938908-60938930 TAGCCCTGGGCCCGCAGCTGAGG + Intronic
1083514188 11:63241443-63241465 GAGGCATGGGGATGCACCTGTGG - Intronic
1083827207 11:65210575-65210597 GAGGCCTGGGTCTGGGTTTGGGG + Intronic
1083894631 11:65613869-65613891 GAGGCGTGGGTCTGGGGCTGAGG - Exonic
1084045889 11:66567690-66567712 GGGGCCTGGATCTGGATCTGGGG + Intronic
1084641644 11:70429879-70429901 CAGGTGTGGTTCTGCAGCTGGGG + Intronic
1084708464 11:70829569-70829591 CAGGCCTGGGTCTTCAGATCTGG - Intronic
1085471112 11:76758711-76758733 GAGCAGTGGGTCTGGAGCTGGGG + Intergenic
1085522011 11:77144526-77144548 GAGGCTGGGGTTTGCATCTGTGG + Intronic
1086092632 11:83020108-83020130 GAGGCCTGGGTCTGCAGCCATGG - Intronic
1086092651 11:83020189-83020211 GATACCTGGGTCTGCAGCCGTGG - Intronic
1086696788 11:89856653-89856675 GAGGCCAGGGACTGGGGCTGAGG + Intergenic
1086709370 11:89987837-89987859 GAGGCCAGGGACTGGGGCTGAGG - Intergenic
1086983894 11:93227544-93227566 GAGCCATGGTTCAGCAGCTGTGG - Intergenic
1087026869 11:93658663-93658685 GAGGTCTGGGTCTGTACCAGAGG + Intergenic
1087036135 11:93758378-93758400 GAGACCCAGGTCTGCAGCCGCGG - Intronic
1087385925 11:97468339-97468361 GAGGCCTGGGACTGAGGCTCTGG - Intergenic
1088328927 11:108629583-108629605 GATGCCCGGGTGGGCAGCTGTGG + Intergenic
1088502033 11:110492269-110492291 GACAGCTGGCTCTGCAGCTGTGG + Intergenic
1088650982 11:111958131-111958153 GATGCCTGGGTCCACAGCTAGGG - Intronic
1088651030 11:111958318-111958340 GATGCCTGGGTCCACAGCTGTGG - Intronic
1088670203 11:112133042-112133064 GGATCCTGGGTCAGCAGCTGTGG + Intronic
1089093712 11:115900263-115900285 GAGCCATGTGACTGCAGCTGAGG + Intergenic
1089125115 11:116171438-116171460 GATGCCTGAGTGTGCGGCTGGGG + Intergenic
1089172852 11:116527502-116527524 GAGGCCTGGGTCTGCAGGTGTGG - Intergenic
1089607330 11:119648915-119648937 GGGGCTTGGGTCTGAGGCTGGGG + Intronic
1089785332 11:120903416-120903438 GAGGCCTGAGCCTGGAGGTGAGG - Intronic
1089822639 11:121241852-121241874 GAGGCCCAGGCCTGCAGCCGGGG + Intergenic
1089823032 11:121246140-121246162 GAGGCCTGGGCCTGCAACCATGG - Intergenic
1090514753 11:127412765-127412787 GATTCCTGGGTCCACAGCTGTGG + Intergenic
1090514771 11:127412845-127412867 GAGGCCTGGGTCTGCAGCCGAGG + Intergenic
1090725894 11:129526961-129526983 GAGGCTTGGGTCTGGAAATGAGG - Intergenic
1090743871 11:129691644-129691666 GAGACCTGGGTTTGCCTCTGGGG + Intergenic
1090920096 11:131199286-131199308 GAGGCCTGGCTCCCCAGCTCGGG + Intergenic
1091237353 11:134031146-134031168 CAGGCCAGGGTCAGGAGCTGTGG + Intergenic
1091273125 11:134331894-134331916 GAGGCCTAGGGCTGCAGGCGCGG + Exonic
1091296648 11:134478418-134478440 GAGGCCTGAGCCTGGGGCTGGGG + Intergenic
1091317381 11:134624096-134624118 GAGGCTTGGGACTTCAGTTGTGG - Intergenic
1202826791 11_KI270721v1_random:92563-92585 GAGGAAGGGGTCTGCAGCTGGGG + Intergenic
1091557615 12:1586830-1586852 GAGAACTGGGTCTGCAGCCGTGG - Intronic
1092137430 12:6159610-6159632 TACACCTGGGCCTGCAGCTGCGG + Intergenic
1092501252 12:9050509-9050531 GAAGCCTGGGTCTGCAGCTGAGG - Intergenic
1092501293 12:9050681-9050703 GAGGCCCAGGTCTGCAGCTGAGG - Intergenic
1092507973 12:9124346-9124368 GAGGCCGCGGTCTGCAGCCTCGG - Intergenic
1092910057 12:13138770-13138792 GAGGCCAGGGTCAGCAACTTAGG - Intronic
1093135142 12:15440371-15440393 GAGGACTGAGGCTCCAGCTGTGG + Intronic
1093183140 12:15989098-15989120 AATGCCTGGGTCTGGAGATGTGG + Intronic
1094675041 12:32611861-32611883 AATGCCTGAGTCGGCAGCTGCGG - Intronic
1095042211 12:37455595-37455617 GATGCCTGAGTCTGCAGCATGGG - Intergenic
1095145354 12:38720845-38720867 GAGGTCTGAGTCTGTAGCCGTGG - Intronic
1095145375 12:38720943-38720965 GATGCCTGAGCTTGCAGCTGTGG - Intronic
1095444191 12:42268009-42268031 GATGCCTGGGTCCGCAGCTGTGG + Intronic
1095704547 12:45222601-45222623 GAGGCCTGCTTCTGCTTCTGAGG - Intronic
1095978050 12:47953132-47953154 CAGGCAGGGGTCTGCACCTGTGG - Intergenic
1096172065 12:49479486-49479508 GATGCCTGAGTGTGCAGCTATGG + Intronic
1096244190 12:49975231-49975253 GAGCCCAGGCTCTGCAGCCGTGG - Intronic
1096828895 12:54299704-54299726 GAGCCCTGGGGCAGCAGCTAAGG - Intronic
1097076377 12:56397623-56397645 GAGGCCTGGGTCTGCAGCTGCGG + Intergenic
1097078668 12:56413447-56413469 GATGCCTGGATCCACAGCTGTGG + Intergenic
1097397675 12:59095331-59095353 GAGGACTGGGCCTTCAGCTGGGG + Intergenic
1097536226 12:60873356-60873378 GATGCCCGGGTCTAGAGCTGTGG + Intergenic
1097684135 12:62676469-62676491 GATGCCTGGGTCTGCAGCCATGG - Intronic
1098465751 12:70784051-70784073 GATGCCTGGGTCTGCGGTTTGGG + Intronic
1098597936 12:72295059-72295081 GATGCTTGAGTCCGCAGCTGTGG + Intronic
1098987211 12:77025661-77025683 GAGGGCTGACTCTGAAGCTGAGG + Exonic
1099233902 12:80059204-80059226 CAGGTCTGAGGCTGCAGCTGGGG + Intergenic
1099682181 12:85843744-85843766 GAGGCCCGGGTCCGCAGCCATGG - Intergenic
1099911920 12:88844596-88844618 GAGGCCTGTGTCTGCGGCCATGG + Intergenic
1099943364 12:89217001-89217023 GAGGCCAGGCTGTTCAGCTGTGG - Intergenic
1100847775 12:98678542-98678564 GAGGCCCGAGCCTGCAGCTGTGG - Intronic
1100985451 12:100198827-100198849 CAGGCGTGGGCCTGCACCTGTGG + Intergenic
1101086167 12:101239107-101239129 GAGGCTTGGGTCTGCAGCGGTGG - Intergenic
1101109655 12:101473285-101473307 GAGACCTGTGTGTGCAGTTGAGG - Intergenic
1101848504 12:108383207-108383229 GTGGGCTTGGTCTGCAGCCGTGG - Intergenic
1101940450 12:109095926-109095948 GAGACCTGGGTAGGAAGCTGGGG + Intergenic
1101962227 12:109258840-109258862 GAGCCCTGGCTCTGGTGCTGGGG + Intronic
1102261206 12:111444637-111444659 GGGGGCTGTGTCAGCAGCTGTGG - Intronic
1102685056 12:114718174-114718196 CTCACCTGGGTCTGCAGCTGAGG + Intergenic
1103173566 12:118843299-118843321 GATGCCCGGGTCTGCAGCCATGG - Intergenic
1103283929 12:119784657-119784679 GTGGCCTGGGTCCTCACCTGTGG - Intronic
1103713970 12:122932395-122932417 GAGGCCCTGCCCTGCAGCTGTGG + Intronic
1103828103 12:123756480-123756502 CAGGCCTGGTTCTGCCACTGAGG - Intronic
1104216667 12:126740591-126740613 CAGGCCTGGGGCTCCAGCTCAGG + Intergenic
1104579142 12:129997003-129997025 GTGGGCTGGGTCTGTGGCTGTGG - Intergenic
1104805259 12:131585904-131585926 GGGGCCAGGGTCTGGAGCAGTGG - Intergenic
1104876379 12:132037876-132037898 GGGGCTTAGGTCTCCAGCTGAGG + Intronic
1104931652 12:132342317-132342339 CAGGCCTCGGTTTGCAGATGCGG + Intergenic
1105041763 12:132966726-132966748 GATGCCTGGGTCTGCAGTCATGG - Intergenic
1105271936 13:18884756-18884778 GAGGCCAGGGTGGGCAGATGAGG - Intergenic
1105424355 13:20282433-20282455 GAGGCCCAGGTCTGCAGCAGTGG - Intergenic
1105706682 13:22971633-22971655 GAGGCTGGGGTCTGTGGCTGTGG + Intergenic
1106308802 13:28535134-28535156 AATGCCTGGGTCTGCAGCCCTGG - Intergenic
1106558303 13:30828626-30828648 GAGGCCCTGTTCTGCACCTGAGG - Intergenic
1106571905 13:30934892-30934914 AAGGCCCAGGTCTGCAGCCGTGG - Intronic
1106576456 13:30979570-30979592 GAGGCCTGGGTCTGCAGCTGTGG + Intergenic
1106620145 13:31364831-31364853 GAGGCCTGGGTCTGCACCTGTGG - Intergenic
1106620173 13:31364955-31364977 GAGGTCCAGGTCTGCATCTGTGG - Intergenic
1106709532 13:32315396-32315418 CAGGCCTGGGTGGGCCGCTGCGG - Intergenic
1107228947 13:38085890-38085912 GATGCCTGGGTCTGGAGCCTTGG - Intergenic
1107234826 13:38155563-38155585 GAGGCCTGGGTCTGCAGCTGCGG + Intergenic
1107513479 13:41107499-41107521 GAGGCCCAGACCTGCAGCTGCGG - Intergenic
1107875988 13:44790504-44790526 CAGGTCTGGGTCTGCAGCTGCGG + Intergenic
1108088169 13:46818031-46818053 GAGGCCTGGGTCTGCAGCTGTGG - Intergenic
1108240456 13:48458028-48458050 GATGCCTGGGTCCGCAGCGGTGG + Intronic
1108292560 13:48976077-48976099 GAGAGCTGACTCTGCAGCTGAGG + Intronic
1108644606 13:52414504-52414526 ATCCCCTGGGTCTGCAGCTGAGG + Exonic
1108844443 13:54660395-54660417 GATGCCTGGGTCTGCAGCCATGG + Intergenic
1109030098 13:57179862-57179884 GATTCGTGGGTCTGCAGCTATGG + Intergenic
1109426105 13:62167922-62167944 GAGGCCCAGGTCTGCAGGTTAGG - Intergenic
1109470530 13:62798990-62799012 AATGCCTGGTTCTGCAGCCGTGG - Intergenic
1111000034 13:82165979-82166001 GAGGCCTGGGTCTGCAGCTGCGG + Intergenic
1111141751 13:84127801-84127823 GATGCCATGGTCTGAAGCTGCGG + Intergenic
1111253682 13:85639125-85639147 GATGCCTGGGTCTACGGCCGTGG + Intergenic
1111512750 13:89287652-89287674 GATGCCTGAGTCTGCAGCCATGG + Intergenic
1111512801 13:89287852-89287874 GAGGCCCAGGTCTGCAGCCATGG + Intergenic
1111741173 13:92207391-92207413 CAGGACTAGGGCTGCAGCTGTGG - Intronic
1111800574 13:92975147-92975169 GAGGCCCAGGTCTGCAGCCATGG + Intergenic
1112247448 13:97747719-97747741 GAGGCCTGGGTTGGGTGCTGGGG - Intergenic
1112611684 13:100961207-100961229 GAGCCCTGGGTGTGCAGCCAGGG - Intergenic
1113563743 13:111304750-111304772 GAGGCCAGGTTCTGCAGCATGGG - Intronic
1113750918 13:112775984-112776006 GAGGGCTGGGAGGGCAGCTGTGG - Intronic
1113930116 13:113963696-113963718 GAGGACAGTGGCTGCAGCTGAGG - Intergenic
1114418090 14:22557338-22557360 GGGGCCTGGGCCGGCAGCAGGGG + Intronic
1114980622 14:28158615-28158637 GATGCCGGGGCCTGCAGCCGTGG + Intergenic
1115484856 14:33900969-33900991 GATGCCTGGGTATGCAACTGTGG - Intergenic
1116388586 14:44363157-44363179 GGTGCCTGGGTCTGGAGTTGTGG - Intergenic
1116448637 14:45039762-45039784 AATGCCCAGGTCTGCAGCTGTGG + Intronic
1118213674 14:63788397-63788419 GAGGCCTGGGTCTGCAGCAGTGG + Intergenic
1118522246 14:66597621-66597643 AATGCCTGGGTCTGCAGCTGTGG + Intronic
1118710439 14:68514502-68514524 GAAGCCGGGGCCTGGAGCTGGGG - Intronic
1119036065 14:71231346-71231368 GATGCCTGGGTCTGTAGCCACGG - Intergenic
1119265036 14:73259441-73259463 GAGGACTGTGTCTGCAGTCGTGG - Exonic
1119484554 14:74979309-74979331 GAGGCCTGGCTGTGCAGCCCGGG - Intergenic
1119724382 14:76913438-76913460 GAGCCCTGGGTCAGCTCCTGGGG - Intergenic
1120589968 14:86363695-86363717 GATGCCAGGGTCTGCAGTTGTGG - Intergenic
1120745357 14:88146901-88146923 GAGGCCTGGGACTGCTGCAGTGG - Intergenic
1121018473 14:90563269-90563291 GTGGCCTGGAGCTGCACCTGTGG - Intronic
1121274037 14:92655934-92655956 GAGGGCTGAGTCTGCAGTTCTGG + Intronic
1121323622 14:93007177-93007199 GGGGCGTGGGGCTGCTGCTGAGG - Intronic
1121528103 14:94633448-94633470 GATGCCTGGGTCTGGAGTTGAGG + Intergenic
1121695407 14:95908288-95908310 GAGGCCTGAGTCTGCAGCCATGG + Intergenic
1121973966 14:98385530-98385552 GAGGCCCAGGTCTGCAGCTGCGG - Intergenic
1122500774 14:102197924-102197946 CAGCACTGGGTCTGCAGCAGTGG + Intronic
1122644961 14:103188111-103188133 GAGGCCAGGGCAGGCAGCTGTGG + Intergenic
1122919985 14:104876043-104876065 GAGGCCTGGGGCAGCAGCAGAGG + Intronic
1122961575 14:105096304-105096326 GACCCCTGGGTCTGCCTCTGTGG - Intergenic
1123042589 14:105496471-105496493 GGGGCCTGGGGCTCCAGCAGTGG - Intronic
1123053932 14:105560455-105560477 GAGGCCAGGGACTGCGGATGGGG - Intergenic
1202940735 14_KI270725v1_random:143320-143342 GATGCCTGAGTCTGCAGCATTGG - Intergenic
1123427262 15:20182988-20183010 GTGGCCTGGGTGTGATGCTGAGG + Intergenic
1123431299 15:20219304-20219326 GAGGCCCGGGTCTGCCGGAGAGG + Intergenic
1123536499 15:21189538-21189560 GTGGCCTGGGTGTGATGCTGAGG + Intergenic
1123984372 15:25632235-25632257 GAATCCTTGGGCTGCAGCTGAGG - Intergenic
1124650391 15:31469594-31469616 GAGGCCTGGGTCTGCAGCTGTGG + Intergenic
1125238978 15:37550761-37550783 GAAGCTTGGATCCGCAGCTGCGG + Intergenic
1125238987 15:37550823-37550845 GAGGCCTGCGTCTGCAGCCGCGG + Intergenic
1125554054 15:40569603-40569625 CGGGCCTGGGGCTGCAGCCGAGG - Exonic
1125811854 15:42548720-42548742 GGGTCCTGGGTCTTCACCTGCGG - Exonic
1125826886 15:42684322-42684344 GAGGCAAGCGTCTGGAGCTGAGG - Exonic
1126292729 15:47099927-47099949 GATGCCTGAGTCTGCAGCATTGG + Intergenic
1126467366 15:48973221-48973243 AAGGCCTGGGACTCCAGCTTTGG + Intergenic
1127800451 15:62472884-62472906 CAGGCCTCTGTGTGCAGCTGAGG + Intronic
1128064906 15:64758576-64758598 CAGGGCTGGGTCTGCTCCTGTGG - Intronic
1128145172 15:65328978-65329000 GAGGCCAGGGCCTCCATCTGGGG + Exonic
1128223015 15:65982098-65982120 CAGGGCTGGGCGTGCAGCTGCGG + Intronic
1128300973 15:66566063-66566085 AGGGCCTGAGTCAGCAGCTGGGG + Intergenic
1128501490 15:68229961-68229983 GAGGCCTGGGTGTTGGGCTGGGG + Intronic
1128554085 15:68618522-68618544 GAGGCGTGAGTGCGCAGCTGAGG + Intronic
1128757195 15:70191147-70191169 GAGGTGGGTGTCTGCAGCTGAGG - Intergenic
1129144030 15:73632266-73632288 GAGGCCTGGGTATAGAGATGGGG - Intronic
1129324608 15:74793485-74793507 GAGGGCTGGCTCAGCAGCTCAGG + Intronic
1129379354 15:75155475-75155497 GAGGCCTGGGCATGGAGATGTGG - Intergenic
1131006451 15:88982568-88982590 GGGGCCTGGGGCTGGGGCTGCGG - Intergenic
1131398509 15:92105823-92105845 GAGGACTGCATCTGCCGCTGTGG - Intronic
1131712814 15:95074366-95074388 GAGGCCTGGAGGTGTAGCTGAGG + Intergenic
1131999397 15:98163740-98163762 GATGCCTGGGTCTGCAGCCTCGG + Intergenic
1132305246 15:100807417-100807439 GATGCCTGGGTCCACAACTGTGG - Intergenic
1132473673 16:121278-121300 GAGGCCAGGGTCTGCAGAGACGG + Intronic
1132600060 16:769249-769271 GAGGGCTGGGGCTGGGGCTGGGG - Intergenic
1132703368 16:1231222-1231244 GGGAGCTGGGTCTGGAGCTGGGG - Intergenic
1132864400 16:2086398-2086420 GAGGCCTGGGGCAGCAGGAGCGG - Intronic
1133279912 16:4659426-4659448 GAGCCATGGGTTTGCAGGTGAGG + Intronic
1134021127 16:10922343-10922365 GTGGCCTTGGTCTGGAGCTGGGG + Intronic
1134078528 16:11308968-11308990 GAGGCCTGAATCTGCAGCTGTGG + Intronic
1135684818 16:24490422-24490444 GAGGACAGGGAGTGCAGCTGGGG - Intergenic
1135716754 16:24777133-24777155 AAGGCCTGTGGCTGCTGCTGTGG - Exonic
1135871473 16:26155384-26155406 GAGGCCTGAGTCTGCAGCTGGGG - Intergenic
1135984468 16:27173892-27173914 GAGGCTGGGATCTGCAGCAGCGG - Intergenic
1136274684 16:29172083-29172105 GAGCCCTGGGTCTGCAGATTTGG + Intergenic
1136299782 16:29326391-29326413 AGGGCCTGCGGCTGCAGCTGTGG - Intergenic
1136452295 16:30360137-30360159 GAGGGCTGATGCTGCAGCTGTGG - Intronic
1136857030 16:33666824-33666846 GTGGCCTGGGTGTGATGCTGAGG - Intergenic
1136872924 16:33824742-33824764 GAGGCCCGTGTCTTCAGCCGCGG + Intergenic
1136997159 16:35198447-35198469 GCGGCCTGGATCAGCTGCTGTGG + Intergenic
1137238412 16:46633929-46633951 GAGGCCTGGGTCTGCAGCCCTGG + Intergenic
1137256240 16:46777900-46777922 GACGTCTGGGTCTGCAGCTGGGG - Intronic
1137282819 16:46992621-46992643 GAGGCACAGGTCTGCAGCCGAGG + Intergenic
1137291670 16:47055733-47055755 GAGGTCTGGGTCTGCAGCCACGG + Intergenic
1137343794 16:47636455-47636477 GATGCCTGGGTCTGGAGCTGCGG - Intronic
1137379188 16:47981837-47981859 GAGGCCTGGGTCAGGAGGAGGGG - Intergenic
1137649803 16:50110125-50110147 GAGGCCAGGATCTGTGGCTGTGG - Intergenic
1137825352 16:51489866-51489888 GAGGCCCAGGTCTGCAGCCGTGG + Intergenic
1137977172 16:53041863-53041885 CAGGCCTGGGCTTGCAGCTGGGG - Intergenic
1138086054 16:54134787-54134809 GAGGTCGGGGTGTGGAGCTGTGG + Intergenic
1138178983 16:54929979-54930001 GAGGCGTGGGAGTGGAGCTGGGG + Intergenic
1138615541 16:58162694-58162716 GTGGCATGGCCCTGCAGCTGGGG + Intronic
1139390081 16:66601818-66601840 GATGCCTGAGCCTGCAGCTGTGG + Intergenic
1139672805 16:68503210-68503232 AAGGCCTGTCCCTGCAGCTGGGG - Intergenic
1139678333 16:68540209-68540231 GGGCCCTGGGTCAGAAGCTGGGG - Intronic
1139917694 16:70438646-70438668 GAGGGCTGGGGCTGGGGCTGGGG + Intronic
1140103391 16:71938098-71938120 GATGCCCAGGTCTGCAGCTGTGG - Intronic
1140419643 16:74807725-74807747 AAGGCCTAGGTCTGCAGTTTGGG + Intergenic
1141005475 16:80347984-80348006 AGGGCCTGGTTCTGCTGCTGGGG + Intergenic
1141339421 16:83189248-83189270 GAGGCCTGAGCTTGCAGCTGAGG - Intronic
1141554134 16:84826031-84826053 GAGACCTGGATCAGAAGCTGTGG + Intronic
1141620900 16:85236009-85236031 TGGGCCTGGGGCTGCGGCTGGGG + Intergenic
1141692162 16:85602558-85602580 GAGGCCGGGTTCTGGAGCAGCGG - Intergenic
1141704633 16:85658132-85658154 AAGACCTGTGTCTGCAGCCGGGG - Intronic
1142078978 16:88137841-88137863 GAGCCCTGGGTTTGCAGATTTGG + Intergenic
1142222480 16:88862332-88862354 CAGCCCGGGGTGTGCAGCTGTGG + Exonic
1203099246 16_KI270728v1_random:1291312-1291334 GAGGCCCGTGTCTTCAGCCGCGG - Intergenic
1203118605 16_KI270728v1_random:1515299-1515321 GTGGCCTGGGTGTGATGCTGAGG - Intergenic
1142465857 17:137157-137179 GTGATCTGGGTCTGCATCTGGGG - Intergenic
1143020287 17:3914059-3914081 GAAGCCTGGGCCTGCAGCCCTGG + Intronic
1143089326 17:4439732-4439754 GAGCCCTGGCTCTGGAGCCGGGG + Intronic
1143456599 17:7071836-7071858 GGGGGCTGGGTTTGCAGGTGAGG + Intergenic
1143476116 17:7204827-7204849 GAGGGAGGGGCCTGCAGCTGGGG - Intronic
1143764319 17:9127557-9127579 GAGGCCAGGCTTTGCTGCTGAGG + Intronic
1143948772 17:10616808-10616830 GATGCCTGGGGCTGCACCTCCGG + Intergenic
1144093723 17:11881297-11881319 GTGGCCTGAGCCTGCAGCTCAGG - Exonic
1144312205 17:14024049-14024071 GGGGCCTGGGTGTCCACCTGAGG - Intergenic
1144332560 17:14237295-14237317 GGGGCCTGGGTGTCCACCTGAGG + Intergenic
1144498267 17:15764218-15764240 GGGGCCTGGGTGTCCACCTGAGG - Intergenic
1144714408 17:17424162-17424184 GATGCCTGGGTCCACAGCAGTGG - Intergenic
1144792129 17:17866359-17866381 GGGGCCAGGGTCTCCAGCCGTGG - Exonic
1145161648 17:20579260-20579282 GGGGCCTGGGTGTCCACCTGAGG - Intergenic
1145273473 17:21416822-21416844 GAGGCCGGGGGCTGCCGCTCTGG - Exonic
1145311664 17:21704266-21704288 GAGGCCGGGGGCTGCCGCTCTGG - Exonic
1145347195 17:22048637-22048659 GGGGCCTGGGTGTCCATCTGAGG + Intergenic
1145368532 17:22286869-22286891 GGTGCCTGGGTCTGCAGCTGTGG - Intergenic
1145747779 17:27332874-27332896 GAGGCGTGGCTCTGCAGTCGCGG + Intergenic
1145888283 17:28397554-28397576 GAGGCCTAGGTCTGGATCTGGGG - Exonic
1145939768 17:28737237-28737259 GAGACCAGGGGCTGGAGCTGGGG + Intronic
1146086837 17:29838023-29838045 GATGCCTGGGTCTGCAGCCGAGG - Intronic
1146459307 17:33033226-33033248 GAGGCCTGGGTCTGCAGCTGTGG - Intronic
1146459340 17:33033376-33033398 GAGGCCCAGGTCTGCAGCCGTGG - Intronic
1146761423 17:35482481-35482503 GAGGCCTGGGTCTACAGTGGTGG - Intronic
1146908251 17:36631707-36631729 GAGCCCTGGGGCTGGAACTGAGG + Intergenic
1147158623 17:38558386-38558408 GACTCCTGGTTCTGTAGCTGCGG + Exonic
1147661865 17:42121137-42121159 GCCGGCTGGGGCTGCAGCTGGGG + Exonic
1148111937 17:45149404-45149426 CAGGCCTGGGTCTGCAAGGGAGG - Exonic
1148219791 17:45853270-45853292 AAGGACTGGGTCTGGACCTGGGG - Intergenic
1148548173 17:48532496-48532518 GAGGCCTGGGGCCGAAGCTAGGG + Intergenic
1148578413 17:48727088-48727110 AAGGCCTGGGTCTGCATGGGTGG - Intronic
1148640531 17:49183985-49184007 GAGGCCCAGGTCTGCAGTTGCGG + Intergenic
1148796477 17:50199688-50199710 GGGGCCTGGGGCTGGGGCTGGGG - Intronic
1149085355 17:52709914-52709936 GAGGCCCAGGTCTGTAGCTGTGG - Intergenic
1149088567 17:52750949-52750971 GAGGCCAGGATCTGCAGCTGTGG - Intergenic
1150228062 17:63534493-63534515 GAGGCCTGGGGGTGCAGCCTTGG - Intronic
1150631636 17:66884498-66884520 GAGGCCTGGTTGGGCAGCAGGGG - Exonic
1150851529 17:68708060-68708082 CAGGGCTGGGTCTGCAGCCCCGG + Intergenic
1150950820 17:69801110-69801132 GAGGCCTGGGTCTGCAGCCATGG - Intergenic
1150952662 17:69821165-69821187 AATGCCTGGGTCTGCAGCTGTGG - Intergenic
1151121465 17:71797542-71797564 GTGGCCTTGGACTGCAGCAGTGG - Intergenic
1151317978 17:73335574-73335596 GAAGCCCAGGCCTGCAGCTGTGG - Exonic
1151317979 17:73335583-73335605 CAGGCCTGGGCTTCCAGCTGTGG + Exonic
1151363460 17:73602368-73602390 CAGGTCTGTGTGTGCAGCTGAGG - Intronic
1151395428 17:73819786-73819808 GATGCCTGGGTCTGCAACCCTGG + Intergenic
1151876071 17:76868857-76868879 CAGGCCTGGGCGTGCAGCGGAGG - Intronic
1151954837 17:77375000-77375022 GAGGTCTGGGTCTGCAGAGCTGG + Intronic
1152163050 17:78681441-78681463 GATGCCTGGGACTGCAGCTGTGG + Intronic
1152413245 17:80141897-80141919 CAGGCCTTGGAGTGCAGCTGTGG - Intronic
1152418422 17:80178104-80178126 GAGGCCGGGGTGGGCAGGTGAGG - Intronic
1152465621 17:80464553-80464575 GAGTCCGAGGGCTGCAGCTGGGG + Intergenic
1152488784 17:80614488-80614510 CAGGCCTGTGTCTGTAGGTGAGG + Intronic
1152733944 17:81987569-81987591 GTGGCCTGGGGCTGCCACTGGGG + Intronic
1152998731 18:433391-433413 GATGCCTGGGGCTTCATCTGAGG + Intronic
1153456388 18:5287225-5287247 GAGGTCTAGGTCTACAGCTGAGG + Intergenic
1153771498 18:8420521-8420543 GAGTCCTTGGTTTGCAGTTGCGG + Intergenic
1153869325 18:9302751-9302773 GACAGCTGGCTCTGCAGCTGTGG - Intergenic
1153983103 18:10329289-10329311 GAGGGCTGAGTCTGAAGCTGGGG + Intergenic
1154317968 18:13320939-13320961 CACGCCTGTGTCTGCAGGTGGGG + Intronic
1155120795 18:22816741-22816763 GAGGCCCAGGTCTGCAGCCTCGG + Intronic
1156008531 18:32470749-32470771 TGGCCCTGGGTCTGCAGCTGCGG + Intergenic
1156298960 18:35818388-35818410 GAGGCCCGGGTCCACAGCTGGGG + Intergenic
1158669300 18:59460642-59460664 GAGGCGTGGGCCAGGAGCTGTGG + Intronic
1158773735 18:60552856-60552878 GAGGCCCAGGTCTGCAGCTGAGG - Intergenic
1158945260 18:62442313-62442335 GAGGCCTCGGTCAGCAGCAGGGG - Intergenic
1159071412 18:63627153-63627175 GAAGCCTGGGTCTGCAGGAGTGG - Intergenic
1159186614 18:64983773-64983795 GATGCCTGAGTCTGCAGCCACGG - Intergenic
1159623768 18:70669164-70669186 GATGCCTGGGTCCACAGCTGAGG - Intergenic
1159897679 18:74012355-74012377 GAGGCCTGGGCCTGGGCCTGGGG + Intergenic
1160083673 18:75754225-75754247 GATGCCTAGGTCTGCAGCTATGG + Intergenic
1160515874 18:79478898-79478920 GAGGCCTGGGTCTGCGGGGACGG + Intronic
1160973473 19:1780589-1780611 GAGGGCTGGGCCTGGGGCTGAGG + Exonic
1161173318 19:2824260-2824282 GAGGCCCAGGTCTGCAGCTGCGG + Intronic
1161318987 19:3632440-3632462 GAGGCCTGGCCCTCCAGCTGTGG + Exonic
1161344457 19:3761204-3761226 GAGGTCTGGGTCTCCAGCCTGGG - Intronic
1161487293 19:4543195-4543217 AGGGCTTAGGTCTGCAGCTGTGG + Exonic
1161606977 19:5220501-5220523 GAGGCCTGAGTCAGCAACTGTGG - Intronic
1161781689 19:6297393-6297415 GAGGCCCGGCTCTGCAGCTGTGG - Intergenic
1161933267 19:7355483-7355505 GAAGCCTGGGGCTTCAGCAGGGG - Intronic
1162231468 19:9270558-9270580 GAGGCCTGGGTCTGCATCCATGG - Intergenic
1162231508 19:9270730-9270752 GAGCCCCAGGTCTGCAGCTGTGG - Intergenic
1162571815 19:11478812-11478834 GGGGCCAGGGGCCGCAGCTGGGG - Intronic
1162572552 19:11481454-11481476 GAGGCCTGGGTCCCCAGATTTGG + Intronic
1162575298 19:11495647-11495669 GAGCCCTGGCTTGGCAGCTGGGG - Intronic
1162927655 19:13938284-13938306 GTGGCATGGGTCTGGAGATGGGG - Exonic
1163118266 19:15200782-15200804 GGGGCCGGGGGCTGCAGGTGAGG - Exonic
1163636936 19:18441328-18441350 AGGTCCTGGGCCTGCAGCTGTGG - Intergenic
1163832075 19:19551854-19551876 GAGGCCTGGGTCCCCAGCCTCGG + Intergenic
1165027092 19:32969885-32969907 AAGGCCTGGGTCTGCAGCAGCGG + Intronic
1165889381 19:39101285-39101307 CAGGAGTGGATCTGCAGCTGTGG + Exonic
1165946495 19:39445957-39445979 GAGGCCGAGGTCTGTGGCTGGGG + Exonic
1166700700 19:44879857-44879879 CAGTGCTGGGGCTGCAGCTGTGG + Intronic
1166708045 19:44919410-44919432 GAGGGCAGGGTCTGCAGGAGAGG + Intergenic
1166759584 19:45216181-45216203 GAGGCCTGGGACTCCTGCAGGGG + Exonic
1166897374 19:46032482-46032504 GATGCCTGGGTCTGCAGCCATGG - Intergenic
1167042803 19:47032541-47032563 GAAACCTGGGTCTCCACCTGAGG - Intronic
1167079898 19:47271508-47271530 GGGGCCTGGGGCTCCAGCAGGGG - Exonic
1167234936 19:48308714-48308736 AAGGCCTGGGTCTGCAGCTGTGG - Intronic
1167234974 19:48308887-48308909 GAGGCCCGGGTCTGTAGCTGCGG - Intronic
1167346134 19:48946762-48946784 GATGCCTGGGTCTACAGCCCCGG - Intergenic
1167438113 19:49491550-49491572 GAGGCCAGGGGCTGGTGCTGAGG + Intronic
1167492320 19:49799865-49799887 GACTCCTGGGTCTCCAGATGGGG + Intronic
1167515576 19:49921488-49921510 CAGGCCATCGTCTGCAGCTGGGG - Intronic
1167603314 19:50466979-50467001 GAGGCCTTGGCCTGCAGTTAGGG + Intronic
1167648890 19:50719283-50719305 CTGGCCTGGGTGTGCGGCTGGGG - Intronic
1167687178 19:50963580-50963602 GAGCCCTTGGGCTGCAGTTGAGG + Intronic
1167745845 19:51351490-51351512 GGGGCCAGGGCCTCCAGCTGGGG - Intronic
925048094 2:789753-789775 GATGCCTGGGTCCACAGCCGTGG - Intergenic
925141695 2:1554882-1554904 GAGCCCTGGGCATGGAGCTGGGG + Intergenic
925437854 2:3856816-3856838 GTGGGCTGGGTCTGGAGCAGAGG + Intergenic
926111718 2:10188118-10188140 AAGCCCTGGGGCTGCAGCTCGGG - Intronic
926194221 2:10752371-10752393 GTGGCCAGCGTCTGCAGCAGTGG + Intronic
926554451 2:14341332-14341354 GATGCCCAGGTCTGCAGCTGTGG - Intergenic
926625286 2:15085499-15085521 TGGGCCTGGGCCTGCATCTGGGG - Intergenic
926859389 2:17292237-17292259 GATGCCTGGGTCTGCAGCTGCGG + Intergenic
927072787 2:19548049-19548071 GAGGCCTGGACCTGCAGCTGTGG - Intergenic
927642707 2:24855496-24855518 GAGGCCTGGGTGCCCAGATGTGG + Intronic
928255797 2:29721239-29721261 GAGCCCTGGAGCTGAAGCTGAGG - Intronic
928444700 2:31322595-31322617 GAGGCCTGGCACTGAAGCAGGGG + Intergenic
928586906 2:32769035-32769057 GAGGCCTGAGCATGCAGATGGGG + Intronic
928840349 2:35598542-35598564 GATACCTGGGTCTGCAGTTAGGG - Intergenic
928840396 2:35598732-35598754 GATACCTGGGTCTGCAGCTGAGG - Intergenic
930005348 2:46892138-46892160 CAGGCCTAGCTCTGAAGCTGTGG + Intergenic
930728908 2:54709258-54709280 GATGCCTGGATCCGCAGCCGCGG - Intergenic
931159007 2:59667498-59667520 GAGTCTTAGGTCTGCAGTTGTGG - Intergenic
932485218 2:72080597-72080619 GATGCCTGGGTCTGCAGCTCTGG - Intergenic
932501722 2:72188092-72188114 GAGGCCCAGGTCTGCAGCTGTGG + Intronic
932804292 2:74769521-74769543 GAAGCCTGGGTCTCCAGCAAGGG - Intergenic
933092999 2:78145560-78145582 GGGGCCAGGGTCTGCAGTGGTGG - Intergenic
933474042 2:82766285-82766307 GAGTTCTGGGTCTGCAGAAGTGG - Intergenic
933520316 2:83363689-83363711 GAGGCCAAGGTCTGCAGATCAGG - Intergenic
933749168 2:85592045-85592067 AAGGCCTTGGTTTGAAGCTGTGG + Intronic
933750387 2:85599370-85599392 GAGGCCTGAGACTGCAGAAGGGG - Intronic
933985537 2:87589066-87589088 GAGGCCTGCCACTGCAGGTGGGG + Intergenic
934575913 2:95401577-95401599 GAGACATGGGTCTGGAGCTTGGG - Intergenic
934638090 2:96009434-96009456 GAGACGTGGGTCTGGAGCTTGGG - Intergenic
934795567 2:97095976-97095998 GAGACGTGGGTCTGGAGCTTGGG + Intergenic
934954656 2:98607717-98607739 GAGACCTGTGTCTGTAGCCGGGG + Intronic
935696944 2:105778293-105778315 GAGGCATGTGTCTCCAGCAGAGG + Intronic
936290235 2:111217274-111217296 GAGGCCCAGGTCTGCACTTGTGG + Intergenic
936290287 2:111217514-111217536 GAGGCCTGGGTTGCCAGCTGTGG + Intergenic
936308306 2:111361734-111361756 GAGGCCTGCCACTGCAGGTGGGG - Intergenic
936514946 2:113175459-113175481 GAGGCCTCTGTCTGAACCTGGGG - Intronic
936826345 2:116586502-116586524 TAGGCCAGGGATTGCAGCTGGGG - Intergenic
937167691 2:119836633-119836655 GATGCCCAGGTCTGCAGCCGTGG - Intronic
937868539 2:126771496-126771518 GAAGCCCGAGACTGCAGCTGAGG + Intergenic
938073230 2:128319027-128319049 GGGACCTGGGTCTGCTGCGGTGG + Intergenic
938096528 2:128467554-128467576 GATGCCTGGCTCTGCAGCTGTGG + Intergenic
938180777 2:129179729-129179751 GATGCCCGGGTCTGCAGCCATGG + Intergenic
938195050 2:129319470-129319492 GAGGCCTGGGTCTGCAGCTGTGG + Intergenic
938288298 2:130136434-130136456 GAGGCCTGGGGCTGCAGTTGGGG - Intergenic
938450198 2:131411641-131411663 GTGGCCTGGGGGAGCAGCTGGGG - Intergenic
938490634 2:131759202-131759224 GAGGGCTGGGTGTCCACCTGGGG + Intronic
939376517 2:141375548-141375570 CAGCCCTGGGACTGGAGCTGTGG - Intronic
940174531 2:150863873-150863895 CAGTCCTGGGTGTGCAGCTATGG - Intergenic
940422926 2:153499871-153499893 GATGCCTGGGTGCACAGCTGCGG + Intergenic
941151313 2:161918938-161918960 GATGCCTGGGTCTGCAGCAATGG - Intronic
941933626 2:170966082-170966104 GAAGCCTGTTTCTGCGGCTGTGG + Exonic
942461302 2:176170712-176170734 AGGGCCTGAGCCTGCAGCTGAGG - Intronic
943064480 2:183071769-183071791 GAGATCTGGGACTGCAGCTCCGG + Intergenic
943820573 2:192315352-192315374 GGGGCCAGGGTCTCCAGCTGCGG + Intergenic
943858314 2:192827987-192828009 GATACCTGGGTCTGCAGCCATGG - Intergenic
943950582 2:194129149-194129171 GATGCCTGGGTCCTCAGCTGTGG + Intergenic
943961078 2:194264718-194264740 GAGGCCTGGGTCTGCAGCTTTGG - Intergenic
944383712 2:199141339-199141361 GATGCCTGAGTCTGCATCTGTGG - Intergenic
945146901 2:206747955-206747977 GAGGTCCAGGTCTGCAGCTCTGG + Intronic
946739750 2:222789988-222790010 GGGGCCTGGGTCAGCAGATGGGG + Intergenic
947636876 2:231684714-231684736 GAGGCCTCAGTCTTCTGCTGGGG + Intergenic
947659401 2:231855469-231855491 AAGGCCTGGGGCTGGAGTTGGGG + Intergenic
948434429 2:237943692-237943714 GATGCCTGGGTCTGGAGCTGAGG - Intergenic
948476174 2:238221310-238221332 GATGCCTGAGTCTGCAGCCGCGG + Intergenic
948575609 2:238947477-238947499 GAGGCCCGGGTCTGCAGCTTTGG + Intergenic
948690167 2:239696991-239697013 GGGGCCTGGGTCTGTTGCGGTGG - Intergenic
948744306 2:240075207-240075229 GAGGCCTGCCTTTGCAGATGCGG + Intergenic
948845963 2:240682962-240682984 GGGAGCTGGGGCTGCAGCTGTGG - Intergenic
948847894 2:240691767-240691789 GGGAGCTGGGGCTGCAGCTGTGG + Intergenic
948894463 2:240921826-240921848 CAGGCCTGGGGCCTCAGCTGTGG - Intronic
1168829233 20:835561-835583 TAGGCCTAGGTCTGCACTTGAGG - Intronic
1168853082 20:989833-989855 GAGGCCCGCGTCTCCAGCTGGGG - Intronic
1170043965 20:12066057-12066079 GATGCCTGGGTCTGCAGCCGTGG + Intergenic
1170315047 20:15032219-15032241 GATTCCTGGGTCCGGAGCTGTGG + Intronic
1170494912 20:16915151-16915173 AATGCCTGGGTCTGCAGCCCTGG - Intergenic
1171492315 20:25529813-25529835 GAGGTCTGGCTCTGTTGCTGAGG - Intronic
1171520367 20:25770876-25770898 GGGGCCTGGGTGTCCATCTGAGG - Intronic
1171520814 20:25772863-25772885 CAGGCCTGGGTGTCCATCTGGGG + Intronic
1171556108 20:26083628-26083650 CAGGCCTGGGTGTCCATCTGGGG - Intergenic
1171556552 20:26085617-26085639 GGGGCCTGGGTGTCCATCTGAGG + Intergenic
1172443410 20:34980756-34980778 GAGGTCGGGGTCTGCGGTTGGGG - Intronic
1172632176 20:36385903-36385925 GAGGCTTAGCTCTGCAGCTCTGG + Intronic
1172648250 20:36484779-36484801 GAGGTCTGGGGCAGCTGCTGCGG + Intronic
1172676552 20:36676892-36676914 GAGGCCTGGGTCTGCGGCTCTGG - Intronic
1172896337 20:38302920-38302942 GAGGCCTGAGGCTGCTGCAGAGG + Intronic
1173117819 20:40262950-40262972 GAGGCCTAAGTCAGCAGCAGCGG - Intergenic
1173207706 20:41007554-41007576 GATGCCTGGGTCTGCAGCCCTGG + Intergenic
1173868678 20:46328753-46328775 TAGGACTGACTCTGCAGCTGAGG + Intergenic
1174293219 20:49524067-49524089 GGGCCCTGGTGCTGCAGCTGTGG - Exonic
1175224200 20:57435408-57435430 GAGGCGGGGTTCTGCATCTGAGG + Intergenic
1175270959 20:57733972-57733994 GAGGAAGGGGCCTGCAGCTGAGG - Intergenic
1175879042 20:62246087-62246109 GAGGCCTGGACCTGCGCCTGGGG + Intronic
1175994335 20:62805388-62805410 GCGGCCTGGGGCTGGGGCTGGGG + Intronic
1176080855 20:63272505-63272527 GGGGCCTGGGGCGGGAGCTGCGG - Intronic
1176099475 20:63358448-63358470 CAAGCCTGGGTCTGCCGCTGAGG - Intronic
1176108342 20:63399861-63399883 GGGGCCTGGGCCTGCCGCTGGGG - Intergenic
1176299350 21:5091193-5091215 GGGTCCTGGGTGTGGAGCTGAGG + Intergenic
1176582420 21:8543622-8543644 GAGGCCTGAGTCTGCAGCATTGG + Intergenic
1176616416 21:9030691-9030713 AGGGCCTGGGTGTCCAGCTGGGG + Intergenic
1176654496 21:9577145-9577167 GGGGCCTGGGTGTCCATCTGAGG - Intergenic
1176654676 21:9577968-9577990 CAGGCCTGGGTGTCCATCTGGGG + Intergenic
1177037519 21:16061340-16061362 GATGCCTAGGTCTGAAGCCGTGG + Intergenic
1177259488 21:18711733-18711755 GATGCCTAGTTCTGCAGGTGTGG - Intergenic
1177357910 21:20032074-20032096 GATGCCTGGGTCTGCAGCTGTGG + Intergenic
1177396161 21:20538380-20538402 GATGCCTGAGTCTGCAGCCCTGG + Intergenic
1178668113 21:34566531-34566553 AAGGCCTGGGTCTTCAGGTGAGG - Intronic
1178947276 21:36959096-36959118 GATGCCCAGGTCCGCAGCTGTGG - Intronic
1179028636 21:37701101-37701123 GCTGCCTGGGTCTGTAGCTTAGG + Intronic
1179407262 21:41136395-41136417 GATGCCTGGGTCTGGAGCTGTGG - Intergenic
1179857676 21:44170754-44170776 GGGTCCTGGGTGTGGAGCTGAGG - Intergenic
1179950378 21:44706093-44706115 TAGGCCTCGATCTGCAGCTGGGG - Intronic
1180042290 21:45287082-45287104 GCGGCCCGGGTCTGCAGGCGGGG - Intronic
1180048508 21:45320766-45320788 CAGACCAGGCTCTGCAGCTGCGG + Intergenic
1180172600 21:46067585-46067607 GGGGCCTGGGACTCCAGCTCAGG + Intergenic
1180180736 21:46117710-46117732 CAGGCCTGGATCTGCTGCTCAGG - Intronic
1180180850 21:46118134-46118156 GAGGCCTCGGTGAGCAGCGGCGG - Intronic
1180188825 21:46153211-46153233 GAGGGCTGGTGCTGCCGCTGGGG - Intronic
1180265252 22:10520670-10520692 GAGGCCTGAGTCTGCAGCATTGG + Intergenic
1180725218 22:17941905-17941927 AAGGCCTGGGGCTGCAGCACAGG + Intronic
1180941034 22:19659548-19659570 GGGGCCTGGGTGTCCAGCTGAGG - Intergenic
1180951988 22:19724605-19724627 GTGGTCTGGGCCTGCAGGTGGGG - Exonic
1181174112 22:21026408-21026430 GGGGCCTTGGCCTGCAGATGAGG - Exonic
1181439876 22:22930275-22930297 CAGGCCTGGGTCCCGAGCTGAGG - Intergenic
1182146687 22:28001052-28001074 GAGGCCTGGCTGAGCACCTGAGG - Intronic
1182147133 22:28003483-28003505 CAGGCCTGGGGCTGGGGCTGGGG - Intronic
1182307807 22:29383239-29383261 CAGCCTTGGGTCTGCTGCTGTGG - Intronic
1182766007 22:32759185-32759207 TAGGCCTGGGAATGCAGCAGTGG - Intronic
1183087260 22:35494003-35494025 CTGGCCTGGTTGTGCAGCTGGGG - Intergenic
1183267600 22:36838842-36838864 GAGGCCAGGCTGAGCAGCTGGGG + Intergenic
1183361364 22:37384820-37384842 GTGCCCAGGGGCTGCAGCTGAGG - Intronic
1183456683 22:37926783-37926805 GAGCCCTGGGACCCCAGCTGAGG + Intronic
1183472131 22:38015265-38015287 GGGGCCTGAGGCTCCAGCTGAGG + Intronic
1183508225 22:38220918-38220940 GAGGCCTGGGTCAGGAGGGGAGG + Exonic
1183953895 22:41367988-41368010 GGAGCCTGGGTCTGAAGCAGAGG + Intronic
1184054489 22:42035302-42035324 GATGCCTGGGTCTGCAGCCACGG + Intronic
1184054515 22:42035395-42035417 GATGCCTGGGTCTGCAGCCACGG + Intronic
1184147334 22:42619309-42619331 GAGGCCTGGGCCTGGCCCTGAGG + Exonic
1184457030 22:44616650-44616672 CACGCCTGTGTCTGCACCTGGGG - Intergenic
1184494481 22:44829909-44829931 GAGGCCTGTGTGGGCACCTGGGG + Intronic
1184549744 22:45198138-45198160 GAGGCCTGGGTCTGGGCCAGAGG - Intronic
1184557182 22:45239948-45239970 AGGGCCTGGGACTGCAGGTGTGG - Intronic
1184561022 22:45262998-45263020 GAGGCCCCGGTCTGCAGCTGTGG + Intergenic
1184561048 22:45263089-45263111 GATGCCTGGGTCCACAGCCGTGG + Intergenic
1184869524 22:47226380-47226402 GATGCCTGGGTCTGCAGCCGCGG + Intergenic
1184869550 22:47226471-47226493 GATGCCTGGGTCTGTAGTTGTGG + Intergenic
1185013657 22:48331292-48331314 GAAGCCTGGGTAGGCAGGTGGGG - Intergenic
1185032058 22:48449429-48449451 GGGCCCTGGGTCTGCAGCACAGG - Intergenic
1185102856 22:48850796-48850818 CAGCCCTCTGTCTGCAGCTGGGG - Intronic
1185171876 22:49299069-49299091 GAGGCCTGCGTGAGGAGCTGCGG - Intergenic
1185236889 22:49719025-49719047 GAGGCCAGGGGATGCAGCTCTGG - Intergenic
1185384202 22:50524310-50524332 GAGGCCAGGCCCTGCATCTGAGG - Exonic
950128770 3:10527664-10527686 GAAGCCTGGGTCTCCAGTTCAGG - Intronic
950432875 3:12961116-12961138 GAGGCCAGGCTCTGCAGCTTTGG + Intronic
951136325 3:19107754-19107776 GATGCCTGGGTCTGCAGCCATGG + Intergenic
951590478 3:24259057-24259079 CAGGCGTGGGTCTGCAGTGGGGG - Intronic
952269485 3:31817514-31817536 AGGCCCAGGGTCTGCAGCTGTGG + Intronic
953289731 3:41649410-41649432 GGTGCCAGGGTCTGGAGCTGTGG - Intronic
953880954 3:46691082-46691104 GGGGCCTGGGTCTGCCTCAGGGG - Intronic
953930153 3:47001914-47001936 TAGGCCTGGGCATGCAGCTGTGG - Exonic
954133975 3:48573609-48573631 AAGGCCTGGCTCATCAGCTGTGG + Intronic
954710519 3:52503125-52503147 GAGGCCAGGGACTTCAGCTCAGG + Intronic
956990088 3:74752284-74752306 GGGGCCCAGGTCTGCAGCCGTGG + Intergenic
957136379 3:76294230-76294252 GATGCCTGGATCTGCAGCTGTGG + Intronic
957156389 3:76550607-76550629 GATGCCTGGGTCTGGAGCTGTGG - Intronic
957417762 3:79928989-79929011 GATGCTGGGGTCTGGAGCTGTGG - Intergenic
957625770 3:82650591-82650613 GAGGCCTAGGTCTGCAGCCATGG - Intergenic
957705018 3:83769989-83770011 GAGGCCTGATTCTGCAGCTGTGG - Intergenic
957775977 3:84757406-84757428 TATGCCCAGGTCTGCAGCTGTGG + Intergenic
958636144 3:96750092-96750114 GAGGCCTGGGTATGTAGCCAGGG - Intergenic
959484166 3:106908531-106908553 AATGCCTGGGTCTGCAGCTCTGG - Intergenic
959825041 3:110784080-110784102 CAGGCCTGGGACATCAGCTGTGG + Intergenic
960333757 3:116392254-116392276 GATGCCTGAGTCTGCAGCTGTGG - Intronic
960605293 3:119498572-119498594 GAGGCCGGGGACTGAAGGTGTGG + Exonic
960634382 3:119768715-119768737 GAGGCCAGGGTCTACAGCCATGG + Intergenic
960847957 3:122022135-122022157 GCGTCCTGGGGCGGCAGCTGAGG - Exonic
960952522 3:123008871-123008893 GAGGCCTGCAGCTGGAGCTGGGG + Intronic
960989647 3:123302064-123302086 AGGGCCTGTGACTGCAGCTGAGG - Intronic
961334062 3:126159708-126159730 GGGTCCAGGGTCAGCAGCTGGGG + Intronic
961386648 3:126526674-126526696 GAGCCCTGGGGCTGAGGCTGTGG - Intronic
961552485 3:127677213-127677235 GAGGCGGGGGTCTGCAGGTGGGG - Exonic
961606951 3:128102863-128102885 GAACCCTGGGTTTGCTGCTGTGG - Intronic
961749166 3:129085546-129085568 GGGGCCTGGGGCTCCAGCTCAGG + Intergenic
961756234 3:129128739-129128761 GGGGCCTGGGGCTCCAGCTCAGG - Intronic
962010709 3:131387692-131387714 GAGGACTGGGACTGTAGGTGAGG - Intronic
962105341 3:132383361-132383383 GATGCCTGGGTCCACAGCTGTGG + Intergenic
962105359 3:132383445-132383467 GAGGCCCAGGTCTGCAGCCACGG + Intergenic
962814699 3:138987687-138987709 GAGGCCTGAGTCAGAAGCTAAGG - Intergenic
962824630 3:139088985-139089007 GATGCCTGAGTCTGCAGCCATGG + Intronic
963199080 3:142568646-142568668 GATGCCTGGGTTTGCAGCCGTGG - Intronic
965924395 3:173959082-173959104 GATGCCTGGGTCTGCAGCTGTGG + Intronic
966220265 3:177544504-177544526 GAGGCCTGGGTCAGCCCCTTTGG + Intergenic
966840037 3:184081100-184081122 GATACCTGGGTCTGCAGCCATGG - Intergenic
967444938 3:189555279-189555301 GATGCCTGGGTGTGCAGCCCTGG + Intergenic
967649936 3:191973712-191973734 GATGCCTGAGTCTGCAGCTATGG + Intergenic
968086517 3:195876412-195876434 TGGGCCTGGGTGTGCATCTGTGG - Intronic
968507703 4:979290-979312 GAGGCTTGGATCAGCACCTGGGG - Intronic
968538771 4:1151592-1151614 GATGCCTGGGTCTGCAGCCATGG + Intergenic
968612366 4:1563125-1563147 CAGTCCTGGGTCTGCAGCTCTGG - Intergenic
968660676 4:1797576-1797598 TGGGCCAGGGCCTGCAGCTGAGG + Intronic
968747216 4:2366338-2366360 GAGGCCTGGGCTTGCTTCTGAGG - Intronic
968838432 4:2982127-2982149 GATGCCCAGGTCAGCAGCTGTGG + Intronic
969194085 4:5547028-5547050 GATTCCTGAGTCTGCAGCTGTGG - Intronic
969262764 4:6044015-6044037 AAGGCCTGGGGCTGAGGCTGGGG - Intronic
969319446 4:6402888-6402910 GAGGCCTCTGTCTGCCGTTGAGG - Intronic
969642516 4:8407491-8407513 GAGGCCGGGGTCTGAAATTGAGG - Intronic
969986530 4:11217384-11217406 GAGGCCTGGGTCTGCAGCCATGG - Intergenic
971867251 4:32189318-32189340 GATGCCTAGGTCCACAGCTGTGG - Intergenic
972106363 4:35494024-35494046 GATGTCCAGGTCTGCAGCTGTGG - Intergenic
972128457 4:35800793-35800815 GATGCCTGGGTCAGCAGCCATGG - Intergenic
973534625 4:51868202-51868224 GATGCCTGGGTCCGCAGCCATGG + Intronic
974235714 4:59179392-59179414 GATATCTGGGTCTGCAGCTGAGG - Intergenic
974278577 4:59759623-59759645 GAGGCCTGGGTCTACAGCAGTGG + Intergenic
974644279 4:64671986-64672008 GATGCCCAGGTCTGCAGCAGTGG + Intergenic
975863990 4:78707192-78707214 AAGGCCTCTTTCTGCAGCTGGGG - Intergenic
976129575 4:81870536-81870558 GGTGCCCAGGTCTGCAGCTGCGG - Intronic
976590187 4:86842313-86842335 GAATCCTTTGTCTGCAGCTGAGG + Intronic
977471786 4:97452170-97452192 GATGCCTGAGTCTGCAGCCAGGG - Intronic
978249176 4:106610246-106610268 GAGGCTCGGATCTACAGCTGTGG - Intergenic
978712344 4:111799686-111799708 GAGGTCTGACTCTGCATCTGCGG - Intergenic
980180122 4:129392334-129392356 GAGGCCTGGGTCCACAGCCGTGG - Intergenic
980703058 4:136457419-136457441 GATGCCTGGTTCTGCAGTTGTGG - Intergenic
980740649 4:136946406-136946428 GATGCATGGGTCTGCAGCCATGG - Intergenic
980750215 4:137077582-137077604 AAGCCCTGGGTCTGCAGCTGAGG + Intergenic
982181009 4:152748525-152748547 GATGCCCGGGTCTGCAGCTGTGG - Intronic
983125968 4:163950512-163950534 GATGTCTGGGTCTGCAGCCCTGG + Intronic
983491767 4:168397994-168398016 GAGGCCCGGGTCTGCAGCCATGG - Intronic
984170297 4:176350776-176350798 GATGCCTGGGTCCGCAGCCCTGG + Intergenic
984325088 4:178241608-178241630 GATGCCTGGGTCCACAGCTGCGG - Intergenic
984476592 4:180243005-180243027 GAGGCCTGAGTATGGAGCTCTGG + Intergenic
986408960 5:7457386-7457408 CAGACCAGGCTCTGCAGCTGAGG - Intronic
987112160 5:14698607-14698629 GAAGCCTGGCTCTGTTGCTGTGG + Exonic
988073842 5:26326493-26326515 GATGCCCGGGTCCGCAGCCGTGG + Intergenic
988575876 5:32424075-32424097 AAAGCCTAGGTCAGCAGCTGTGG + Intronic
988935478 5:36078491-36078513 TTAGCCTGGATCTGCAGCTGTGG + Intergenic
989339061 5:40354215-40354237 GATGGCTGGGTTTGCAGCTGGGG - Intergenic
989741462 5:44778534-44778556 GAGGCCAGGCTATGCAGGTGAGG - Intergenic
990008091 5:50965938-50965960 GAGGCCTGGGTCCTCCACTGTGG + Intergenic
990639045 5:57761815-57761837 GAGGCGCAGGTCTGCAGATGTGG - Intergenic
991359389 5:65803545-65803567 GATGCCTGGGTCCGCAGCCATGG + Intronic
992162109 5:74013844-74013866 GAGGCATGGATCTGGAGCTGGGG + Intergenic
994245671 5:97472264-97472286 GGGGCCAGGGTCTGGAGCGGAGG + Intergenic
994851100 5:105056806-105056828 GATGCCTGGGTCTGCAGCTGTGG - Intergenic
994891206 5:105639331-105639353 GATGCCTGGGTCTGCAGCCATGG - Intergenic
995331974 5:110956503-110956525 GATGCCTGGGTCTGCAGCCATGG - Intergenic
995745046 5:115394103-115394125 GAGGCTGGGGTCTGCAGGGGTGG + Intergenic
996234520 5:121108983-121109005 GATGCCTGAGTCTGCAGCGGCGG + Intergenic
996835508 5:127787359-127787381 GAGGCCTGGGCTGGCAGGTGAGG - Intergenic
997526260 5:134555121-134555143 GGGGCCTGGGGTGGCAGCTGGGG - Intronic
997596285 5:135109288-135109310 GAGGCCTCGGAGTCCAGCTGAGG + Intronic
997608113 5:135191299-135191321 GAGGCCTGAGGGGGCAGCTGCGG + Intronic
997977967 5:138451260-138451282 CAGGCCTGGGACTGCCACTGTGG - Intergenic
999389846 5:151182072-151182094 AGGGCCTGGGGCTGAAGCTGGGG + Exonic
999859814 5:155633442-155633464 GAGGCCCAGGTCTGCAGCCATGG - Intergenic
1000849651 5:166324283-166324305 AAGGCCTGGGTTTTCTGCTGGGG + Intergenic
1001649281 5:173303932-173303954 GATGCCAGAGTCTGCAGTTGAGG - Intergenic
1001982096 5:176044623-176044645 GAGGCCTGGGCGTTCACCTGGGG + Intergenic
1001982388 5:176046109-176046131 GAGGCCTGGGTGTCCACGTGGGG - Intergenic
1001982885 5:176048314-176048336 GAGGCCTGGGTGTTTAGGTGTGG + Intergenic
1002234578 5:177795743-177795765 GAGGCCTGGGTGTTTAGGTGTGG - Intergenic
1002235073 5:177797948-177797970 GAGGCCTGGGTGTCCACGTGGGG + Intergenic
1002235365 5:177799434-177799456 GAGGCCTGGGCGTTCACCTGGGG - Intergenic
1002307219 5:178290869-178290891 AGGGCCTGGGGCTGCAGCTGAGG + Intronic
1002319730 5:178367859-178367881 GTGGCCTGGGTCAGGCGCTGTGG + Intronic
1002484146 5:179523347-179523369 GAGCACTGGGTCTGCAGCTGTGG + Intergenic
1002500419 5:179644134-179644156 GAGCACTGGGTCTGCAGCTGTGG - Intronic
1002641519 5:180632839-180632861 GAGGTCTGGGTCTGGAACTCTGG + Intronic
1002678112 5:180935626-180935648 GATGCCTGGGTCTGGAGCTGCGG + Intronic
1002688931 5:181037178-181037200 GAGGCTGAGGTCTGCAGCTGTGG - Intergenic
1002841653 6:911748-911770 AGGGCCTGGACCTGCAGCTGGGG + Intergenic
1003284842 6:4725480-4725502 GAGGCCTGGGGAGGCAGCTAAGG + Intronic
1003923422 6:10855383-10855405 GAGGCCTGGGTCTGCAGCTGTGG - Intronic
1004520720 6:16358865-16358887 GAGGCCCAGGTCTGCAGCCGTGG - Intronic
1005021564 6:21423682-21423704 GAGGCCCAGGTCTGCAGCCATGG + Intergenic
1005987038 6:30882060-30882082 GCAGGCTGGGTCAGCAGCTGGGG - Intronic
1006347861 6:33497919-33497941 GAGGCCCAGGTCTGCAGCTGGGG - Intergenic
1006500769 6:34457657-34457679 GAGGCCTGGGTTTGCAGCCATGG - Intergenic
1006766413 6:36510454-36510476 GATGCCCAGGTCTGCAGCTGTGG + Intronic
1006833464 6:36982936-36982958 GAGGATTTGGCCTGCAGCTGTGG + Intronic
1006867732 6:37222574-37222596 GAGGCCCAGGTCTGCAGCCGTGG + Intronic
1006989083 6:38197956-38197978 GAGGACTGGGACTGCTGATGGGG + Intronic
1007430375 6:41773044-41773066 CAGGCCTGGGACTGGAGTTGAGG - Intronic
1007649843 6:43412654-43412676 GATGCCTGGGTCCACAGCTGGGG - Intergenic
1008507620 6:52246382-52246404 CAGCCCTGGCACTGCAGCTGGGG + Intergenic
1009243463 6:61205406-61205428 GATACCTGGGTCTGCAGCCATGG + Intergenic
1009610277 6:65931541-65931563 GAGGCCTGGGTCTGCAGCTGTGG + Intergenic
1011175153 6:84551945-84551967 GAGGCCAGTGTGAGCAGCTGGGG - Intergenic
1011484691 6:87829667-87829689 GAGGCCTGGGTCTGACCCTAGGG - Intergenic
1012088550 6:94860596-94860618 GAGGCCTGGGTCTGAAACAAAGG - Intergenic
1012104802 6:95143486-95143508 GATGCCTGAGACTGCAGATGGGG - Intergenic
1012123558 6:95397862-95397884 GAGGCCTGAGCCTGCATCTAAGG - Intergenic
1012142109 6:95636865-95636887 GATGCCTGGGTCCACAGCGGTGG + Intergenic
1012718099 6:102702084-102702106 GATGCCTGGGTCCAGAGCTGTGG + Intergenic
1013236200 6:108199305-108199327 GAGGCCTGGGTCTGCAGCTGTGG + Intergenic
1013692940 6:112667407-112667429 GAGGCCGGAGTCTGCAGCCATGG - Intergenic
1013709513 6:112880328-112880350 GGGGCCTGGATCTGCTGCCGAGG + Intergenic
1013793066 6:113857796-113857818 GAGGCCTGGGGAGGCGGCTGTGG + Exonic
1013949286 6:115760058-115760080 GTGGCCTGGGTCTGAAGTTCAGG - Intergenic
1014384613 6:120785704-120785726 GATGCCAGGGTCTGGAGCTGTGG - Intergenic
1014770381 6:125452978-125453000 GATGCCTGGGTCAGCAGCCTTGG - Intergenic
1015455766 6:133424694-133424716 GAGGCCCAGGTCTGCAGCTGTGG + Intronic
1015663621 6:135603239-135603261 GATGCCTGGGTCTACAGCCACGG - Intergenic
1015710371 6:136132638-136132660 GAGGCTAGGGTTTGCAGCTGGGG - Intronic
1016758956 6:147716431-147716453 GATGCCTGGGTCCACAGCTGTGG + Intronic
1017373113 6:153736100-153736122 GATTCCTGGGACTGGAGCTGTGG + Intergenic
1017849691 6:158294477-158294499 GAGGCCTGGGTGTGGAGAGGAGG + Intronic
1018447143 6:163868053-163868075 GGGGCCTGGGTGAGGAGCTGGGG + Intergenic
1018516425 6:164584674-164584696 GAAGCCTGGGTCAGCAGATTGGG + Intergenic
1018700609 6:166423224-166423246 GAGGCCTGGGTCTGCAGTCGGGG + Intronic
1018706666 6:166468499-166468521 GAGGTCTGGGGCTGCAGGTGGGG + Intronic
1018946125 6:168347777-168347799 GAGGCCTGGAAGAGCAGCTGTGG - Intergenic
1019058923 6:169242084-169242106 GAGGACTGGGCCAGCAGCAGAGG + Intronic
1019142542 6:169957377-169957399 GGGGCTGGGGTCTGCATCTGAGG + Intergenic
1019218236 6:170457250-170457272 GAGGGCCAGGCCTGCAGCTGAGG - Intergenic
1019258375 7:65910-65932 GAGGCCACGGTCCACAGCTGGGG + Intergenic
1019333436 7:471516-471538 GAGGCCTGGCTCTGCTGGCGGGG + Intergenic
1019371654 7:665134-665156 GTGGCCTGCGCCTGGAGCTGCGG - Intronic
1019397026 7:826489-826511 GAGGCCGGGGGCTGCAGCTCTGG + Intronic
1019409319 7:899719-899741 GAGGCCTGGGCCCCCATCTGGGG - Intronic
1019460036 7:1153092-1153114 GACTCCCGTGTCTGCAGCTGTGG + Exonic
1019727101 7:2609073-2609095 GAGCTCTGGGGCTGCTGCTGTGG + Intronic
1019897995 7:3997995-3998017 AATGCCTGAGTCTGCAGCCGCGG + Intronic
1019898029 7:3998145-3998167 GAGGCCCAGGTCTGCAGCCACGG + Intronic
1020568145 7:9822892-9822914 GAGGCCCAGGTCTGCAGCTGCGG + Intergenic
1021513809 7:21461461-21461483 AACACCTGGGTCAGCAGCTGCGG - Intronic
1023219076 7:37899829-37899851 GTGGCCTGGGGGAGCAGCTGGGG - Intronic
1023481164 7:40636271-40636293 GTTGACTGGGTCTTCAGCTGAGG + Intronic
1023700140 7:42883968-42883990 GAGGCCCAGGTCTGTAACTGTGG + Intergenic
1023700162 7:42884058-42884080 GAGGCCCGGGTCCGCAGCCACGG + Intergenic
1023788985 7:43737241-43737263 GAGACCTGGGTCTGCAGCTGAGG - Intergenic
1023789025 7:43737414-43737436 GAGGCCCACGTCTGCAGCCGTGG - Intergenic
1023790565 7:43750085-43750107 GAGGCCCAGGTCTGCAACTGTGG + Intergenic
1023856219 7:44185836-44185858 GAGGGCTGGGGCTGCATCTGTGG - Intronic
1024254687 7:47531915-47531937 GAGGCCCAGGTCTGCAGCCGTGG - Intronic
1024786307 7:52911472-52911494 GATGGCTGGGTCCGCAGCCGTGG + Intergenic
1025288119 7:57685375-57685397 GATGCCTGAGTCTGCAGCATTGG - Intergenic
1025825605 7:65008118-65008140 GAGGACTGGCTCTGTAGTTGGGG + Intergenic
1026399540 7:69995631-69995653 AAGGCCTAGGTCTGCCACTGAGG + Intronic
1026723863 7:72855605-72855627 GTGACATGGGCCTGCAGCTGGGG - Intergenic
1027128291 7:75572849-75572871 GATGCCTGAGTCTGCAGCTGGGG - Intronic
1027575089 7:79921889-79921911 GATTCCTGGGTCTGCAGCCATGG - Intergenic
1027735031 7:81920927-81920949 GATACCTGGGTCTGGAGCTGAGG + Intergenic
1027924742 7:84446951-84446973 GATGCCTGGGTCCCCAGCTGTGG - Intronic
1028423144 7:90655980-90656002 GAGGCCTGTCTCTGCAGCCTGGG + Intronic
1028596016 7:92546985-92547007 GATGCCTGGGTCCGCAGCTGTGG - Intergenic
1028831754 7:95335892-95335914 GAGGCCTGTGGCTGCAGGAGTGG + Intergenic
1029049543 7:97670203-97670225 CAGTCCTGGGTCTGGCGCTGTGG + Intergenic
1029327511 7:99823007-99823029 GAGGCCTGGGTCTGCAGCTGTGG - Intergenic
1029607681 7:101608983-101609005 GAGCCCTGTCTCTGCTGCTGAGG - Intergenic
1029703157 7:102260969-102260991 GAGGCCTGGGCCTGCATGTACGG + Intronic
1029899202 7:104022040-104022062 GATGCCTGGGTCCACAGTTGTGG - Intergenic
1029973889 7:104815025-104815047 GAGGCCCAGGTCTGCAGCCATGG + Intronic
1030243704 7:107359125-107359147 GATGCCTGGGTCCACAGCTGTGG - Intronic
1030514178 7:110519923-110519945 GAGGCCTGGGTCTGCAACCACGG + Intergenic
1031743835 7:125468595-125468617 GATGCCTGTGTCTGCAGCCCAGG + Intergenic
1031743901 7:125468894-125468916 TAGGCCTGGGCCGGCATCTGGGG + Intergenic
1032431135 7:131862653-131862675 GAGGCCTGGGACTGCTTCAGAGG - Intergenic
1033213066 7:139474878-139474900 TAGGTCTGGGCCTGCATCTGAGG - Intronic
1033243396 7:139699587-139699609 CAAGGCTGGGCCTGCAGCTGGGG + Intronic
1033265750 7:139885033-139885055 CAGGGCTGGGCCTGCAGATGAGG + Intronic
1033266824 7:139894214-139894236 AAGGACTGGGTCTGCAGCAATGG - Intronic
1033584833 7:142766532-142766554 GGGGCCTGGGCCAGAAGCTGTGG - Intergenic
1034078023 7:148251147-148251169 GACCCCTGGGCTTGCAGCTGGGG - Intronic
1034293602 7:149951209-149951231 GGGGCCTGGCTCTGCAGCTGGGG - Intergenic
1034405213 7:150898340-150898362 GAGACCAGAGTCTGCAGCAGAGG + Intergenic
1034421534 7:150993506-150993528 GAGCCCTGGGGCTGCAGCATGGG - Intronic
1034433134 7:151050847-151050869 GAGGGCTGGGGCTGGGGCTGGGG - Exonic
1034453316 7:151149529-151149551 GAGGCCTGGCTCTGGAGGGGTGG - Intronic
1034812464 7:154145644-154145666 GGGGCCTGGCTCTGCAGCTGGGG + Intronic
1035104744 7:156432773-156432795 GAGGACTGAGATTGCAGCTGTGG - Intergenic
1035183903 7:157111173-157111195 GTGCCCTGGGTCAGCACCTGTGG - Intergenic
1035241985 7:157538137-157538159 GACGCCAGTGTCTGCATCTGGGG - Intergenic
1035252497 7:157606296-157606318 GCTGCCTGGGTCTGCAGCTACGG + Intronic
1035450843 7:158976046-158976068 GAGGCCTGGGTCTGCAGCTGTGG - Intergenic
1035450869 7:158976182-158976204 GAGGCCCAGGTTTGCAGCCGTGG - Intergenic
1036381275 8:8237898-8237920 GAGGCCTGGGCCTGGGGTTGGGG - Intergenic
1036702120 8:11019710-11019732 GAGGGCTGTGTCTGCAGGTGTGG - Intronic
1038149242 8:24927860-24927882 GAGGCCTGGGTCTGCAGCCTTGG - Intergenic
1038780439 8:30565015-30565037 GTGGCCTGGCTCTGCAGCTCTGG + Intronic
1039690381 8:39858612-39858634 CCGTCTTGGGTCTGCAGCTGAGG + Intergenic
1040478172 8:47799282-47799304 GAGCTGTGGGCCTGCAGCTGGGG - Exonic
1040975869 8:53194227-53194249 CAGCCCTGGGGGTGCAGCTGTGG + Intergenic
1041357398 8:57014695-57014717 GAGGCCTGGGTCTGCAGCTGAGG + Intergenic
1041643527 8:60228412-60228434 GAGGCCTACGTCTGCACTTGGGG + Intronic
1041956288 8:63560290-63560312 GATGCCTGGGTTTGCAGCTGCGG + Intergenic
1042337134 8:67640545-67640567 GATGCCTGGGTCTGCACCTGTGG + Intronic
1043082668 8:75785114-75785136 GATGCCTGGGTCTGGACTTGTGG + Intergenic
1043890049 8:85644310-85644332 GAGGCCTGCTTGTGCATCTGGGG + Intergenic
1043891590 8:85656224-85656246 GAGGCCTGCTTGTGCATCTGGGG + Intergenic
1043892662 8:85663061-85663083 GAGGCCTGCTTGTGCATCTGGGG + Intergenic
1043892895 8:85714274-85714296 GAGGCCTGCTTGTGCATCTGGGG - Intergenic
1043895582 8:85735728-85735750 GAGGCCTGCTTGTGCATCTGGGG - Intergenic
1043897097 8:85746080-85746102 GAGGCCTGCTTGTGCATCTGGGG + Intergenic
1043899423 8:85764448-85764470 GAGGCCTGCTTGTGCATCTGGGG + Intergenic
1043901031 8:85776641-85776663 GAGGCCTGCTTGTGCATCTGGGG + Intergenic
1043902995 8:85791916-85791938 GAGGCCTGCTTGTGCATCTGGGG + Intergenic
1043904605 8:85804109-85804131 GAGGCCTGCTTGTGCATCTGGGG + Intergenic
1043906217 8:85816300-85816322 GAGGCCTGCTTGTGCATCTGGGG + Intergenic
1043907825 8:85828490-85828512 GAGGCCTGCTTGTGCATCTGGGG + Intergenic
1044008903 8:86967392-86967414 GAGACTTGGGTTTGCAGCTGTGG + Intronic
1044297355 8:90544438-90544460 GTGGCCTGGGTCCACAGCTGTGG + Intergenic
1044525074 8:93242130-93242152 GAGGCCTGGGTCTGCAGCCACGG + Intergenic
1044525092 8:93242221-93242243 GATGCCCAGGTCTGCAGCCGTGG + Intergenic
1044918555 8:97143222-97143244 GAATCCTGGGTCTGCAACTTTGG + Exonic
1044962234 8:97542634-97542656 GAGGCCAAGGTCTGCAGCCATGG - Intergenic
1045124237 8:99072015-99072037 GAAGCCAGGGTCTGGAACTGGGG + Intronic
1045294721 8:100863069-100863091 CAGGCCTGGGGCTGGAGCTGCGG + Intergenic
1045811907 8:106231667-106231689 CTGCCCTTGGTCTGCAGCTGGGG - Intergenic
1046195631 8:110860093-110860115 GATGCCTAGGTCTGCAGCTGTGG - Intergenic
1046395577 8:113633998-113634020 GGGGCCAGGGTCTGGAGCAGTGG + Intergenic
1046635807 8:116674303-116674325 GAGGCCTGGGGGTGGAGGTGGGG + Intronic
1047629508 8:126691820-126691842 GAGGTCTGGGGCTGCAGGGGTGG + Intergenic
1047761274 8:127956249-127956271 CAGGGCTGGGGCTGGAGCTGAGG + Intergenic
1047771108 8:128030874-128030896 CAGGCCTGGGACTGGGGCTGAGG - Intergenic
1048339221 8:133525906-133525928 GATGCCTGGGTCCAGAGCTGTGG + Intronic
1048421819 8:134284613-134284635 GAGGCCCAAGTCTGCAGCTGTGG + Intergenic
1048573546 8:135673739-135673761 CAGCCCTGGGTCTGAGGCTGAGG + Intergenic
1048688235 8:136928461-136928483 CATGCCTGGGTCCTCAGCTGAGG + Intergenic
1048807739 8:138255982-138256004 GAAGCCTGGATCTGGAGGTGAGG + Intronic
1049021670 8:139961425-139961447 GAGGCCTGGGTCTGCAGCTATGG - Intronic
1049167183 8:141133686-141133708 GAGGTGTAGGTCTGCAGGTGGGG + Intronic
1049186774 8:141259367-141259389 CAGGCATGGTTCTGGAGCTGGGG - Intronic
1049328151 8:142034768-142034790 CAGGCCTGGGTCTGCTGCTGGGG - Intergenic
1049604843 8:143524518-143524540 GGGGCCTGGCTCTGAGGCTGCGG - Intronic
1049850343 8:144827234-144827256 GGGGCCGGGGCCTGGAGCTGGGG - Intergenic
1050808794 9:9718526-9718548 GATGCCTGGGTCTGGAGCCGTGG - Intronic
1050947858 9:11549359-11549381 GATGCCTGGGTCTACAGCCATGG - Intergenic
1051355074 9:16233715-16233737 GATGCCTGGGTCTGTAGCCATGG - Intronic
1052707463 9:32010698-32010720 GATGCCTGGGTCTCCAGCTGCGG - Intergenic
1052827606 9:33188280-33188302 GAGGCCAGAGCTTGCAGCTGTGG + Intergenic
1053076463 9:35138717-35138739 GAGGCCTGGCTCTGCAGCTGTGG - Intergenic
1053076504 9:35138889-35138911 GAGGCCCAGGTCTGCAGCCCCGG - Intergenic
1053077926 9:35150813-35150835 GAGCCCTGGCTCTGCAGCTGTGG - Intergenic
1053128051 9:35598924-35598946 GATGCCTGGGTCCACAGCCGTGG - Intergenic
1053128070 9:35599014-35599036 GAGGCCTGAGTCTGCAGCTGTGG - Intergenic
1053349951 9:37407209-37407231 GTGCCCTGCGTCTGCAGCAGCGG + Intergenic
1053444972 9:38145907-38145929 GAGGCCTGGGTCTGCAGCCATGG - Intergenic
1053617285 9:39781419-39781441 GAAGCCCAGGTCTGCAGCAGTGG - Intergenic
1053875468 9:42540782-42540804 GAAGCCCAGGTCTGCAGCAGTGG - Intergenic
1053897177 9:42753851-42753873 GAAGCCCAGGTCTGCAGCAGTGG + Intergenic
1054236232 9:62560942-62560964 GAAGCCCAGGTCTGCAGCAGTGG + Intergenic
1054266881 9:62926018-62926040 GAAGCCCAGGTCTGCAGCAGTGG + Intergenic
1054550374 9:66595472-66595494 GAAGCCCAGGTCTGCAGCAGTGG + Intergenic
1055093717 9:72388924-72388946 GAGGCCTGGCTCTGCCTTTGTGG - Intergenic
1055572540 9:77632054-77632076 GGTGCCTGGGTCTGCAGCTGTGG - Intronic
1056192150 9:84194896-84194918 GAGGCCTGGGTCTGCAGCTATGG + Intergenic
1056577665 9:87868604-87868626 GAGGCCTTGGTGGGCAGGTGGGG - Intergenic
1056726653 9:89125110-89125132 GAGCTGTGGGTCTGCAGCAGTGG + Intronic
1056815016 9:89794960-89794982 CAGCCCTGGGTCTGCTTCTGTGG - Intergenic
1056986038 9:91364377-91364399 GATGCCTGGGGCTGCAGCCGTGG - Intergenic
1056992068 9:91421706-91421728 TAGGTCGGGGTCTGAAGCTGGGG + Intronic
1057180140 9:93025322-93025344 GAGGCCCTGGGCTGGAGCTGAGG - Intronic
1057316024 9:93969067-93969089 GAGCCCTGGGCCTCCAGCAGAGG + Intergenic
1057468424 9:95337221-95337243 GAAGGCCGGGTCTGCAGCTGGGG - Intergenic
1057565209 9:96160836-96160858 GAGCCCTGGCTCTGTGGCTGGGG - Intergenic
1057829566 9:98396261-98396283 CTGGCCAGGGTCTGCAGCTCTGG - Intronic
1058091779 9:100813848-100813870 GAGACCTGGGTCTGCAGCCGGGG + Intergenic
1058510644 9:105713293-105713315 TATGCCTGGGTCTGCAGCCCCGG - Intronic
1058953599 9:109925798-109925820 GAATCATGGGTTTGCAGCTGAGG - Intronic
1059566177 9:115385311-115385333 GAGGCCTGGGTCTGCAGCTGTGG - Intronic
1059788843 9:117617828-117617850 CAGTCCTGACTCTGCAGCTGAGG + Intergenic
1060219762 9:121758170-121758192 GAGACCCGGGTCTGCTGCTGGGG + Intronic
1060796346 9:126515038-126515060 CAGGCTTGGGACTGCAGGTGGGG - Intergenic
1061675320 9:132212300-132212322 GAGGCTTGGGTGTGCGGCTTAGG - Intronic
1061902433 9:133679865-133679887 GGGGCCCGGGTCTGCAGCTCTGG + Intronic
1061938861 9:133873446-133873468 GAGGCCAGTGTCTTCAGCAGGGG - Intronic
1062107855 9:134765561-134765583 GAGGCCTGAGTCACCAGCTGGGG + Intronic
1062184631 9:135211452-135211474 GAGGCCTGGGTCTGCAGCCTTGG - Intergenic
1062230953 9:135480855-135480877 GAGGCCAGGGTCTGCAGGCCAGG - Intronic
1062243314 9:135551141-135551163 AGGGCCTGGCACTGCAGCTGGGG + Intergenic
1062268106 9:135696587-135696609 GAGTCCTGGGTGTGCATGTGGGG - Intronic
1203776519 EBV:76043-76065 GAGGCCTAGGTCCACAGTTGTGG + Intergenic
1203612434 Un_KI270749v1:21636-21658 GATGCCTGAGTCTGCAGCATTGG + Intergenic
1203632396 Un_KI270750v1:81426-81448 CAGGCCTGGGTGTCCATCTGGGG + Intergenic
1185498517 X:578689-578711 AAGACCTGGGTCTGGAGGTGAGG + Intergenic
1186335513 X:8582693-8582715 GAGGCCTGGGTCTGAAACCCAGG + Intronic
1186805742 X:13139054-13139076 GAGCCCTGGGTCTGCAGCCAAGG - Intergenic
1187362501 X:18641503-18641525 GAGCCCTGGGGAGGCAGCTGAGG - Exonic
1187369395 X:18692146-18692168 GAAGCCTGGGTTTGGAGCTCAGG - Intronic
1187871346 X:23767331-23767353 GATGTCCAGGTCTGCAGCTGTGG + Intergenic
1188207655 X:27380354-27380376 GATGCCCGGGTCTGCAGCTGCGG - Intergenic
1189360042 X:40343411-40343433 GAGGCCTGGGTCTGCAGCTGCGG - Intergenic
1189381545 X:40506042-40506064 GATGCCTGGTCCTGCGGCTGTGG - Intergenic
1189856465 X:45229460-45229482 GATGCCTGGCTCTGCAGCTGTGG + Intergenic
1190189223 X:48262548-48262570 GAGGGCTTTGTCTGCACCTGGGG + Intronic
1190360659 X:49645366-49645388 TATGCCCAGGTCTGCAGCTGTGG + Intergenic
1190360684 X:49645457-49645479 GAAGCCTGGGTCTGGAGCCATGG + Intergenic
1190369404 X:49726887-49726909 GATGCCTGCATCCGCAGCTGTGG - Intergenic
1190597685 X:52064203-52064225 GAGGCCTGGGCATGCAGCAGAGG + Intronic
1190611139 X:52189870-52189892 GAGGCCTGGGCATGCAGCAGAGG - Intronic
1191221133 X:57989593-57989615 GAGACCTAGGTCTGCAGCTGTGG - Intergenic
1192265403 X:69534052-69534074 GATGCCTGAGTCTGCAGCCATGG + Intergenic
1192362289 X:70447466-70447488 CTGGGCTGGCTCTGCAGCTGTGG - Intronic
1192578289 X:72260180-72260202 TGGGGCTGGGTCTCCAGCTGTGG - Intronic
1193108642 X:77705211-77705233 GAGGCCTGGGACTGCAGCCACGG + Intronic
1195179186 X:102339957-102339979 GAGGCCCAGGTCTGCAGCTGTGG + Intergenic
1195454407 X:105051603-105051625 GAGGCCTGGGTCTGCAGCCACGG + Intronic
1195618346 X:106930264-106930286 GCTGCCTGGGATTGCAGCTGAGG + Exonic
1196883790 X:120223940-120223962 GAGGCCTGGGTCTGCAGCCACGG + Intergenic
1197035540 X:121870014-121870036 GATGCCTGGGTCCGCAGTCGTGG - Intergenic
1197617253 X:128707793-128707815 GCAGGCTGGGTCTGCAGCAGGGG + Intergenic
1197886393 X:131222453-131222475 GAGGCCTGAGTTAGCAGCTTAGG + Intergenic
1197951971 X:131907911-131907933 GAGGCCTGGGTCTGCAGCTGCGG - Intergenic
1198699603 X:139382676-139382698 GAGGCCTGGGTCTGCAGCTGTGG + Intergenic
1199360157 X:146907738-146907760 GAGGCCTGGGTCTGCAGCTGTGG + Intergenic
1199614653 X:149647311-149647333 GATGCCTGGGTCTGCAGCGATGG - Intergenic
1200038307 X:153347266-153347288 CAGGCCTGAGTCAGCATCTGAGG + Exonic
1200044984 X:153396607-153396629 GAGCCCTGAGTGGGCAGCTGTGG - Intergenic
1201149601 Y:11088424-11088446 GAAGCCTAGGTATCCAGCTGGGG + Intergenic
1201368559 Y:13235287-13235309 GATGTCTGGCTCTGCAGCTGTGG + Intergenic
1201428040 Y:13875605-13875627 GAGGCCTGGGTCTGAAACCCAGG - Intergenic
1202340621 Y:23861183-23861205 GGTGCTTGAGTCTGCAGCTGTGG - Intergenic
1202530145 Y:25808899-25808921 GGTGCTTGAGTCTGCAGCTGTGG + Intergenic