ID: 1124650394

View in Genome Browser
Species Human (GRCh38)
Location 15:31469599-31469621
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124650384_1124650394 19 Left 1124650384 15:31469557-31469579 CCAGGAGGGCGGGGCTCCTGCCT 0: 10
1: 51
2: 99
3: 182
4: 611
Right 1124650394 15:31469599-31469621 CTGGGTCTGCAGCTGTGGGTTGG No data
1124650383_1124650394 25 Left 1124650383 15:31469551-31469573 CCTTGTCCAGGAGGGCGGGGCTC No data
Right 1124650394 15:31469599-31469621 CTGGGTCTGCAGCTGTGGGTTGG No data
1124650386_1124650394 3 Left 1124650386 15:31469573-31469595 CCTGCCTTCTTCGAAGCACAGGA No data
Right 1124650394 15:31469599-31469621 CTGGGTCTGCAGCTGTGGGTTGG No data
1124650388_1124650394 -1 Left 1124650388 15:31469577-31469599 CCTTCTTCGAAGCACAGGAGGCC No data
Right 1124650394 15:31469599-31469621 CTGGGTCTGCAGCTGTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124650394 Original CRISPR CTGGGTCTGCAGCTGTGGGT TGG Intergenic
No off target data available for this crispr