ID: 1124650398 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:31469621-31469643 |
Sequence | GGCGGCCACAGCGACTTTCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1124650386_1124650398 | 25 | Left | 1124650386 | 15:31469573-31469595 | CCTGCCTTCTTCGAAGCACAGGA | No data | ||
Right | 1124650398 | 15:31469621-31469643 | GGCGGCCACAGCGACTTTCAGGG | No data | ||||
1124650393_1124650398 | 0 | Left | 1124650393 | 15:31469598-31469620 | CCTGGGTCTGCAGCTGTGGGTTG | No data | ||
Right | 1124650398 | 15:31469621-31469643 | GGCGGCCACAGCGACTTTCAGGG | No data | ||||
1124650388_1124650398 | 21 | Left | 1124650388 | 15:31469577-31469599 | CCTTCTTCGAAGCACAGGAGGCC | No data | ||
Right | 1124650398 | 15:31469621-31469643 | GGCGGCCACAGCGACTTTCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1124650398 | Original CRISPR | GGCGGCCACAGCGACTTTCA GGG | Intergenic | ||