ID: 1124653436

View in Genome Browser
Species Human (GRCh38)
Location 15:31489023-31489045
Sequence GCTGCAGGGCAGACACACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 1, 2: 2, 3: 51, 4: 340}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124653429_1124653436 7 Left 1124653429 15:31488993-31489015 CCTTGACGTGGCCACCCTTTCCA 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1124653436 15:31489023-31489045 GCTGCAGGGCAGACACACCCAGG 0: 1
1: 1
2: 2
3: 51
4: 340
1124653431_1124653436 -7 Left 1124653431 15:31489007-31489029 CCCTTTCCAGATCTGAGCTGCAG 0: 1
1: 0
2: 2
3: 21
4: 251
Right 1124653436 15:31489023-31489045 GCTGCAGGGCAGACACACCCAGG 0: 1
1: 1
2: 2
3: 51
4: 340
1124653432_1124653436 -8 Left 1124653432 15:31489008-31489030 CCTTTCCAGATCTGAGCTGCAGG 0: 1
1: 0
2: 2
3: 17
4: 214
Right 1124653436 15:31489023-31489045 GCTGCAGGGCAGACACACCCAGG 0: 1
1: 1
2: 2
3: 51
4: 340
1124653427_1124653436 21 Left 1124653427 15:31488979-31489001 CCTGCTGGGTTCTGCCTTGACGT 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1124653436 15:31489023-31489045 GCTGCAGGGCAGACACACCCAGG 0: 1
1: 1
2: 2
3: 51
4: 340
1124653430_1124653436 -4 Left 1124653430 15:31489004-31489026 CCACCCTTTCCAGATCTGAGCTG 0: 1
1: 1
2: 1
3: 21
4: 245
Right 1124653436 15:31489023-31489045 GCTGCAGGGCAGACACACCCAGG 0: 1
1: 1
2: 2
3: 51
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124653436 Original CRISPR GCTGCAGGGCAGACACACCC AGG Intronic
900111010 1:1005663-1005685 CCAGCAGGGCAGATAAACCCAGG - Intergenic
900413053 1:2521800-2521822 CCTGCAGGGGAGACACAAACCGG + Exonic
900506961 1:3034408-3034430 GCTATAGGGTAGACACACACAGG + Intergenic
900731966 1:4268035-4268057 GCTGCCGAGAAGCCACACCCAGG + Intergenic
901238359 1:7679487-7679509 GCTTCATGACAGACACACCCCGG + Intronic
901533815 1:9869955-9869977 ACACCTGGGCAGACACACCCAGG + Intronic
903135369 1:21306004-21306026 GATGCTGGGAAGACAAACCCAGG - Intronic
903574547 1:24330801-24330823 GCTGCAGGGCACACAGAGGCAGG - Intronic
904419991 1:30385203-30385225 GGAGCAGGTCAGACTCACCCAGG - Intergenic
904585326 1:31576802-31576824 GCTGGAGGGCAGAGAGACCTAGG + Intronic
907118444 1:51989740-51989762 GCAGCAGGGTAGACCCAACCTGG + Intronic
909958387 1:81803676-81803698 GCTGCAGCTCAGACGCTCCCAGG - Intronic
916267398 1:162904466-162904488 AATGCACGGCAGACACAGCCTGG + Intergenic
918642257 1:186857043-186857065 GCTGCATGGCAGACACATGTGGG - Intronic
919905587 1:202076126-202076148 AGTGCAGGGAAGACACACTCTGG + Intergenic
919929198 1:202210174-202210196 GCGGCAGGGCAGGCACACAGAGG - Intronic
920032286 1:203044689-203044711 GCTGCAGGGCAGACACCTGTAGG - Intronic
920314261 1:205066307-205066329 GATGCAGTGAACACACACCCAGG - Intronic
921392487 1:214630587-214630609 GATGAAGGCCAGACTCACCCAGG + Exonic
922702324 1:227769142-227769164 GCCCCAGGGGAGACACAGCCTGG - Intronic
923794722 1:237142702-237142724 GCTCCAGGTCAGACACACAGAGG + Intronic
923860104 1:237884830-237884852 GCTGCAGTGCAGATGCACCTGGG + Exonic
924685724 1:246287930-246287952 GCTGCAGGGTAGAACCACCTAGG + Intronic
1063955475 10:11261509-11261531 GTTCCAGGGCAGACACCCTCAGG + Intronic
1066010749 10:31191688-31191710 GCTCCAGGGGAGACAGCCCCAGG - Intergenic
1066230342 10:33426004-33426026 GCCTCAGGGCTGAGACACCCAGG + Intergenic
1067546287 10:47194747-47194769 GCTGTGGGGCAGACACAGCTGGG + Intergenic
1069513168 10:69057133-69057155 GCAGCACGGCAGACACTTCCTGG - Intergenic
1069552744 10:69375877-69375899 GCTGCAGGGGAGAGGCAGCCAGG - Intronic
1069779169 10:70944035-70944057 GCTGCAGGGCAGGCTCAGCGGGG - Intergenic
1070950352 10:80426077-80426099 GCTCCAGGCCAGACATACCTGGG - Intronic
1073170911 10:101507766-101507788 GCTGCAGTGCAGAGGCACCCCGG + Intronic
1073555604 10:104447845-104447867 GTTCCAGGGCAGCCACACTCTGG + Intronic
1073568480 10:104556035-104556057 GCAGCAGGGGACAAACACCCAGG - Intergenic
1074405276 10:113176089-113176111 GCTTCAGGCAAGACACTCCCGGG - Intergenic
1075163166 10:120042079-120042101 GCTGCAGGGAAGACACAGGGAGG - Intergenic
1075727391 10:124617545-124617567 CCAGCAGGACAGACCCACCCAGG - Exonic
1076736360 10:132460936-132460958 GCTGCAGGTCAGGCAGAGCCTGG - Intergenic
1077630596 11:3808677-3808699 GCTGCCGGGCAGCCCCACTCGGG + Intronic
1078432794 11:11300776-11300798 GCTGCAGAGCAGAATCACCTGGG + Intronic
1078448943 11:11426080-11426102 GCTGCAGAGCAGGCAGAGCCTGG + Intronic
1078576621 11:12508229-12508251 GCTGGAGGGCAGACACACCCTGG + Intronic
1079127573 11:17729976-17729998 GCTTCAGGCCCTACACACCCTGG + Intergenic
1080208439 11:29756952-29756974 GCAGCAGGGCAGGTACAGCCTGG - Intergenic
1081537662 11:44007154-44007176 GCTGCAGGGCAGACTGCCTCAGG + Intergenic
1081930624 11:46868407-46868429 GCCAGAGGGCAGACAAACCCAGG + Intronic
1083284736 11:61651163-61651185 GCAGCAGGACAGACAAAGCCGGG + Intergenic
1083620792 11:64048397-64048419 GGTCCAGGGCAGACCCTCCCCGG - Intronic
1083686697 11:64380730-64380752 TCTCCAGGGCAGACGCAGCCTGG + Intergenic
1084257393 11:67952456-67952478 GCTGTTGGTCAGACACACCCTGG + Intergenic
1084434734 11:69132162-69132184 GTGGCAGCCCAGACACACCCAGG - Intergenic
1084525958 11:69698127-69698149 TGTCCAGGGCAGACACACCGAGG + Intergenic
1084815383 11:71642809-71642831 GCTGTGGGTCAGACACACCCTGG - Intergenic
1084936592 11:72590209-72590231 GCTGCAGGGAAGAGGCATCCAGG + Exonic
1085052924 11:73388980-73389002 GCTGCTGGGCAGGCAGAGCCCGG - Intronic
1085355484 11:75832740-75832762 GCTTCAGGGCAGAAACACTGAGG - Intronic
1085740535 11:79074751-79074773 GGGGCAGGGAAGACACACTCTGG - Intronic
1087628329 11:100621874-100621896 GGTGCAGGGCAGTGGCACCCTGG + Intergenic
1089037563 11:115410791-115410813 GCTGTATGCCAGCCACACCCTGG - Intronic
1089060335 11:115621141-115621163 GCTGCAACACAGACAAACCCTGG - Intergenic
1089605509 11:119639015-119639037 GGTCCGGGGCAGACACACCTGGG - Intronic
1090203607 11:124872950-124872972 TCTGCAGGGCAGCCACACGGAGG - Exonic
1091240836 11:134051166-134051188 TCTGGAGGGAAGACACACCCTGG + Intergenic
1091676160 12:2491680-2491702 GCTGCTGGGAAGACACAATCGGG + Intronic
1091918960 12:4289309-4289331 GCTGCCGGGCAGAGGCAGCCTGG - Intronic
1091999299 12:5019434-5019456 TCTGCAGGCCAAACACAGCCTGG - Intergenic
1092231022 12:6775318-6775340 GCGGCAGGGCAGCCCCACCCTGG - Exonic
1092427632 12:8387240-8387262 GCTGTGGGTCAGACACACCCTGG + Intergenic
1092428898 12:8394221-8394243 GCTGTGGGTCAGACACACCCTGG + Intergenic
1097087149 12:56477133-56477155 GCAGCTGGGCAGCAACACCCTGG - Exonic
1098967357 12:76804776-76804798 TCTGGTAGGCAGACACACCCAGG - Intronic
1100713893 12:97285754-97285776 GCAGCAGCACAGACACAGCCAGG + Intergenic
1104022946 12:125005876-125005898 GCTGCAGTGCACACAAACACAGG - Intronic
1104786686 12:131454901-131454923 CATGCAGGGCATACACAGCCCGG + Intergenic
1104800999 12:131555291-131555313 GCTGCAGGTTAGACTCACCTGGG + Intergenic
1104918549 12:132278784-132278806 GCTGCAGGGCCGACAGCTCCAGG - Intronic
1105209165 13:18247735-18247757 GCTGCAGGGAGGACACATACAGG - Intergenic
1105345105 13:19564598-19564620 GCTGCAGGTCAGACAGGGCCTGG - Intergenic
1106379662 13:29223960-29223982 GCAGCAGGGCAGACAGCTCCAGG - Intronic
1108696319 13:52905591-52905613 GCTGTGGGGCAGACACACTTTGG + Intergenic
1111241545 13:85481687-85481709 TCTGGTGGGCAGGCACACCCGGG + Intergenic
1111242379 13:85492285-85492307 ACTTCAGGGCGGACACACTCAGG + Intergenic
1112064302 13:95776050-95776072 GCAGCAGGCCAGGCACAGCCAGG - Intronic
1112391496 13:98988977-98988999 TCTTCAGGGCTGACACACCCTGG + Intronic
1112438583 13:99408820-99408842 ACAGCAGGTCAGACACAGCCAGG + Intergenic
1113369723 13:109712575-109712597 GCTGGAGGGGAGACACTGCCTGG + Intergenic
1113664672 13:112132963-112132985 GATGCAGAGCAGACACACAGGGG - Intergenic
1113767394 13:112889782-112889804 GCTTCAGGGCAGTCACACCTGGG + Intergenic
1114453149 14:22839262-22839284 CCTGCAGGATAAACACACCCCGG - Intronic
1117519015 14:56531613-56531635 TCTGATGGGCAGGCACACCCAGG - Intronic
1120179002 14:81324243-81324265 TCTGGCGGGCAGACACACCCAGG + Intronic
1120976533 14:90253945-90253967 AAAGCAGGGCAGCCACACCCTGG - Intergenic
1121261579 14:92570085-92570107 CGTGCAGGGGACACACACCCAGG - Intronic
1121338079 14:93089271-93089293 GCTGTGGGGTAGACACGCCCTGG + Intronic
1122201077 14:100123016-100123038 GCCTCAGCTCAGACACACCCAGG + Intronic
1122350449 14:101086960-101086982 GCTGCAGGGCAGACACGTACTGG + Intergenic
1122487555 14:102091278-102091300 CCTCCAGGGCAGTTACACCCAGG + Intronic
1122848012 14:104511249-104511271 GATGCAGGAGAGACACACACAGG - Intronic
1123030160 14:105447807-105447829 TCTGCAGGGCCCACACCCCCCGG + Intronic
1124252095 15:28113539-28113561 GCTGCAGGGCAGCCCCACCTGGG + Intronic
1124606054 15:31171154-31171176 TCTGCTGGGCAGACACAGGCAGG - Intergenic
1124653436 15:31489023-31489045 GCTGCAGGGCAGACACACCCAGG + Intronic
1124981175 15:34569812-34569834 CCTGCAGGGCGGACACTCCAAGG + Intronic
1125379047 15:39067798-39067820 TGTGCAGGGCAGAAACAGCCAGG - Intergenic
1126435347 15:48631855-48631877 GCAGCAGTGCAGAGATACCCTGG - Intronic
1126467213 15:48972132-48972154 CATGCAGGGCATGCACACCCAGG + Intergenic
1129511637 15:76128037-76128059 GCTGCATGTCAGAAACACCTGGG + Intronic
1130272275 15:82458275-82458297 GCTGGGGGGCAGACAAACACAGG - Intergenic
1130464627 15:84185628-84185650 GCTGGGGGGCAGACAAACACAGG - Intergenic
1130488059 15:84409176-84409198 GCTGGGGGGCAGACAAACACAGG + Intergenic
1130499640 15:84487909-84487931 GCTGGGGGGCAGACAAACACAGG + Intergenic
1130586918 15:85190242-85190264 GCTGGGGGGCAGACAAACACAGG - Intergenic
1130713889 15:86312611-86312633 GCTGCAGGGAAGATACACATAGG - Intronic
1132295334 15:100730286-100730308 CCAGCAGGGCAGAACCACCCAGG - Intergenic
1132861612 16:2074518-2074540 GCAGCCGGGCAGAGACGCCCAGG - Intronic
1132954036 16:2581503-2581525 GCAGCACGGCAAACGCACCCCGG - Intronic
1132960309 16:2618660-2618682 GCAGCACGGCAAACGCACCCCGG + Intergenic
1132977475 16:2717798-2717820 ACTGGTGGGCAGAGACACCCCGG + Intronic
1133129283 16:3666312-3666334 GGTGGAGGGCAGACACCCCCTGG + Intronic
1133170479 16:3979778-3979800 GGTGCAGGGCAGAACCTCCCTGG - Intronic
1133370616 16:5243138-5243160 GCTGTGGGTCAGACACACCCTGG - Intergenic
1134092348 16:11398330-11398352 TCTGCAGGGCAGACTCACCCTGG + Exonic
1134194381 16:12147822-12147844 CCTGCAGGGCATTCACATCCTGG - Intronic
1135329256 16:21547463-21547485 GCTGCGTGGCAGACACACAAGGG + Intergenic
1136294382 16:29293326-29293348 GCTCCCGGGCAGACAATCCCTGG - Intergenic
1136339596 16:29633405-29633427 GCTGCGTGGCAGACACACAAGGG + Intergenic
1137628402 16:49923956-49923978 GCTGGAAGGCAGCCGCACCCTGG - Intergenic
1138225817 16:55293325-55293347 AGTGCACGGCAGACACACCTGGG - Intergenic
1139433115 16:66921752-66921774 CCTCCAGGGCAGGCACACCCGGG + Exonic
1139697376 16:68684772-68684794 TCTGCAGTGTAGACACACACAGG - Exonic
1139870970 16:70108370-70108392 ACTGCAGGGCACACAGGCCCAGG + Intergenic
1140375905 16:74445503-74445525 ACTGCAGGGCACACAGGCCCAGG - Intergenic
1141483026 16:84319409-84319431 GCTGCAGGAGGGACACACGCTGG - Exonic
1141720476 16:85752644-85752666 GCTGCAGGGCAGGGACAGCTGGG - Intergenic
1141847138 16:86618528-86618550 GCTGAAGGGCAGTGCCACCCAGG - Intergenic
1141921836 16:87140659-87140681 TCTGCAGGGCACTCACACACAGG - Intronic
1142100288 16:88267373-88267395 GCTCCCGGGCAGACAATCCCTGG - Intergenic
1142112111 16:88338473-88338495 TGTGCGGGGCAAACACACCCTGG - Intergenic
1143023032 17:3926401-3926423 GCTGGAGGACAGACACAGGCTGG - Intronic
1143448307 17:7021561-7021583 GCTGCAAGGCAGAAGCTCCCCGG - Intergenic
1144033633 17:11343691-11343713 GCTGCAGGGCAGAAAGCACCAGG + Intronic
1144090175 17:11849311-11849333 GTTGCAGTGCAGACACACTGTGG - Intronic
1144704029 17:17355674-17355696 GCTGCAGGGAAGTCAGAGCCAGG - Intergenic
1146559813 17:33858351-33858373 CCTGCAGGGCAGCCACACTGGGG - Intronic
1147188251 17:38724562-38724584 GCAGCAGGGAAGAGACCCCCGGG + Intronic
1149659191 17:58325542-58325564 GCTGCAGGCCAGGCTCACTCTGG - Exonic
1150493587 17:65590999-65591021 GCTGCAGGGCAGCCACACCACGG + Intronic
1151834170 17:76572543-76572565 GCCACAGGGCTCACACACCCTGG - Intronic
1151968966 17:77447514-77447536 GAAGCAGGACAGGCACACCCAGG + Intronic
1152261543 17:79269923-79269945 GCTGCAGGGCAGGCACAGGGAGG - Intronic
1152303593 17:79508970-79508992 CCTGCAGGTCAGAAACACCTGGG + Intronic
1152362082 17:79837466-79837488 GCTGCAGGACAGCAACACCTAGG + Intronic
1152740748 17:82017287-82017309 GCTGTAGTGCAGACACATCAGGG - Exonic
1152821181 17:82438658-82438680 GCTGGAGGCCAGACCCACCAGGG + Intronic
1152928775 17:83099701-83099723 GCTGCAGGCCAGACACCAGCAGG - Intergenic
1153684923 18:7536140-7536162 ACAGCCTGGCAGACACACCCAGG + Intergenic
1153772250 18:8425522-8425544 GTTGCAGCGAAGACACCCCCTGG - Intergenic
1155524900 18:26706158-26706180 GCTGCAGGGCAGAGGCAACATGG - Intergenic
1157608297 18:48939909-48939931 ACAGCAAGGCAGACACACCCAGG + Intronic
1157727983 18:49979362-49979384 GCAGCAGGCCAGACAGGCCCAGG + Intronic
1158025248 18:52888224-52888246 GCTGCAGGCCATTAACACCCTGG + Intronic
1159541492 18:69782933-69782955 GCTACAGGGCACACACATGCTGG - Intronic
1160530673 18:79560565-79560587 CCGGCAGAGCAGACACAGCCTGG - Intergenic
1161534687 19:4811829-4811851 GCTGCAGGGAGGACAGACCTTGG - Intergenic
1163126202 19:15245554-15245576 TCTCAGGGGCAGACACACCCTGG - Intronic
1163671753 19:18633445-18633467 GCTGCAGGGCTCACACCCTCAGG - Intergenic
1164584177 19:29455678-29455700 CATGCAGGGCAGACTCATCCTGG - Intergenic
1164683849 19:30153734-30153756 GCTGCAAGGCAGACCTTCCCGGG - Intergenic
1165329577 19:35134208-35134230 CATGCAGGGGAGACACATCCAGG - Intronic
1165404315 19:35620323-35620345 GTGGCAGGGCAGACCTACCCTGG - Exonic
1165995300 19:39839776-39839798 GCCCCAAGGCAGGCACACCCTGG + Intronic
1166335093 19:42101056-42101078 GCTGCAGTGCAGAGACACAGTGG - Intronic
1167593505 19:50416368-50416390 GCCACATGGCAGTCACACCCGGG - Intronic
925001570 2:407012-407034 GCAGCAGGGAGGACTCACCCTGG - Intergenic
925134913 2:1520114-1520136 GCTCCAGGGCAGAAACATCCTGG + Intronic
925201176 2:1968778-1968800 GCTGCACGGCACACACAGCCAGG + Intronic
925408973 2:3627927-3627949 GGAGCAGGGCTGTCACACCCAGG - Intronic
925795197 2:7533607-7533629 CCTGCAGGGCTTACACACCAGGG + Intergenic
925866978 2:8236703-8236725 GCTGCAGGGCAGGCAGACTGAGG + Intergenic
925874571 2:8301009-8301031 TCTGCAGGGCAGGAACCCCCTGG + Intergenic
926130537 2:10301290-10301312 GGTGCATGGCAGACACAGGCAGG - Intergenic
926314930 2:11702474-11702496 TCTGCAGGCCAGCCACACCCTGG + Intronic
927863892 2:26576713-26576735 CCTGCAGGGCAGTCTCGCCCAGG - Intronic
928357072 2:30627180-30627202 TCTGGTGGGCAGGCACACCCAGG + Intronic
928435362 2:31251384-31251406 CCTCCAGGGAAGACACAGCCTGG + Intronic
929412084 2:41708218-41708240 GATGCAGAACAGACTCACCCAGG - Intergenic
929513478 2:42584831-42584853 GGTGGAGTGCAAACACACCCAGG - Intronic
929534271 2:42770628-42770650 GCTTCAGGGCAGCCCCACTCAGG + Intronic
929659110 2:43765678-43765700 GCAGCACGGCAGCCACACACCGG + Exonic
930836758 2:55802443-55802465 GCTGCAGAGCAGAGACAGGCAGG - Intergenic
936024469 2:109020949-109020971 CAGGCAGGGCAGGCACACCCAGG + Intergenic
937458725 2:122067107-122067129 GGTGCAGGGCAGAAAGACCATGG + Intergenic
938758419 2:134401452-134401474 CCCTCAGGTCAGACACACCCTGG + Intronic
939017770 2:136921137-136921159 GCAGCAGGGGAGGCACAGCCAGG - Intronic
939085082 2:137708673-137708695 GCAGCAGGGGAGGCACAGCCAGG - Intergenic
940396170 2:153195440-153195462 GCTGCAGGGCAGGCAGCTCCAGG + Intergenic
940813241 2:158269450-158269472 GTTGGAGGGCAGAGAAACCCTGG - Intronic
943667611 2:190626622-190626644 GCTGCAGGTCAGACAACCCAGGG + Intergenic
944139594 2:196440831-196440853 GCTGCAGCACAGACTCACCCTGG - Intronic
944800471 2:203233412-203233434 GCTGCAGGGCAGATACGGCTGGG - Intergenic
946666990 2:222060768-222060790 GCTGCAGGAGAGAGACACCCCGG + Intergenic
948201688 2:236133803-236133825 GCAGCAGGGCAGGCACGGCCTGG - Intergenic
948410416 2:237755436-237755458 CTTGCAGGGCAGCCTCACCCAGG + Intronic
948421849 2:237864730-237864752 GCAGCAGGGCTGCCCCACCCTGG - Intronic
948455988 2:238104875-238104897 GCTGGAGGGCCCACACTCCCTGG - Intronic
948542187 2:238698967-238698989 GCTGGAGAGCAGGCACAGCCAGG + Intergenic
948911955 2:241009345-241009367 CCTCCAGGCCAGGCACACCCTGG + Intronic
948943508 2:241207960-241207982 GCTCCAAGGCGGACAAACCCTGG + Intronic
1170066182 20:12312998-12313020 ACTTAAGGTCAGACACACCCTGG - Intergenic
1170629060 20:18052903-18052925 GCTGCGGGGTAGAGAAACCCAGG - Intronic
1171058630 20:21933618-21933640 TCTGCAGCTGAGACACACCCTGG - Intergenic
1171290338 20:23979448-23979470 GCTGCAGGGAGGACACATACAGG - Intergenic
1172441618 20:34970363-34970385 TCTGCTGTTCAGACACACCCTGG + Intergenic
1172446592 20:34996591-34996613 GCTGCAGAGCAGGCACAGCAGGG - Exonic
1172629590 20:36368985-36369007 GCAGCAGAGCAGACAGCCCCTGG + Intronic
1173135996 20:40439670-40439692 GCTTCAGAGCAGACACTTCCAGG + Intergenic
1173293883 20:41738732-41738754 AGTGAAGGGCAGACACAGCCCGG + Intergenic
1175368378 20:58470747-58470769 GCTGCAAAGCAGACAGACCTGGG + Exonic
1175554692 20:59841489-59841511 ACAGGAGGGCAGACAAACCCTGG + Exonic
1175801652 20:61804458-61804480 CCTGGAGGTCAGCCACACCCGGG + Intronic
1175947611 20:62566032-62566054 GCAGAAGGGCAGACACCCCCTGG + Intronic
1176024721 20:62979970-62979992 CCTGCCGTGCAGACCCACCCAGG + Intergenic
1176063523 20:63182515-63182537 CCTGCAGGGCTGAGACACGCAGG + Intergenic
1176078567 20:63260377-63260399 GTTGCAGGGCAGACAGGCTCGGG - Intronic
1178370339 21:32021820-32021842 GCTCCTGGGCAGACACAACCGGG + Intronic
1179139285 21:38710036-38710058 GCTGCAGGGCCTAGACCCCCTGG + Intergenic
1179289168 21:40003757-40003779 GCTGCAGAGCAGACTCAGGCTGG + Intergenic
1180183296 21:46127478-46127500 GCTGAAGGGCAGCCAGACCCAGG - Intronic
1180198917 21:46213302-46213324 GCGGCAGGGCTGGCACAGCCTGG - Intronic
1180767091 22:18351562-18351584 GCTGCAGGGAGGACACACACAGG + Intergenic
1180779220 22:18510817-18510839 ACTGCAGGGAGGACACACACAGG - Intergenic
1180799569 22:18625518-18625540 GCTGAAGGGCAGTCATGCCCAGG - Intergenic
1180811939 22:18768137-18768159 GCTGCAGGGAGGACACACACAGG - Intergenic
1181093291 22:20489025-20489047 GGTGGAGGGCAGACACATCGAGG - Exonic
1181198094 22:21202381-21202403 GCTGCAGGGAGGACACACACAGG - Intergenic
1181222147 22:21369748-21369770 GCTGAAGGGCAGTCATGCCCAGG + Intergenic
1181401650 22:22653423-22653445 GCTGCAGGGAGGACACATACAGG + Intergenic
1181518340 22:23430891-23430913 GCTTCCTGGCAGTCACACCCTGG - Intergenic
1181637907 22:24182742-24182764 GCTGAAGGGCAGTCATGCCCAGG + Intronic
1181639036 22:24187290-24187312 GCAGCAGGACGGACACACTCAGG - Exonic
1181703608 22:24634520-24634542 GCTGCAGGGAGGACACATACAGG + Intergenic
1181846106 22:25710068-25710090 GATGCTGGGGAGACACAGCCAGG - Intronic
1182445224 22:30386102-30386124 GAAGCAGGGCAGAGGCACCCAGG + Exonic
1183192916 22:36333108-36333130 GGAGCATGGCAGACACAGCCAGG + Intronic
1183565229 22:38609710-38609732 GTTGCAGGGAAAACACTCCCAGG + Intronic
1185014099 22:48333465-48333487 TCTGTGGGGCAGACACACCTGGG + Intergenic
1203228713 22_KI270731v1_random:92456-92478 GCTGCAGGGAGGACACACACAGG + Intergenic
950797352 3:15520927-15520949 GCTGAAGGGAAGTCGCACCCAGG + Intronic
955466802 3:59245677-59245699 GCTGCATGGTAGAATCACCCAGG - Intergenic
957040097 3:75329789-75329811 GCTGCAGGGCACAAACAACTAGG + Intergenic
957072329 3:75576934-75576956 GCTGTGGGTCAGACACACCCTGG + Intergenic
961281740 3:125769837-125769859 GCTGTGGGTCAGACACACCCTGG - Intergenic
961450934 3:127002024-127002046 GCTGCAGGGCAGGCAGGCACGGG + Intronic
961872605 3:129999747-129999769 GCTGTGGGTCAGACACACCCTGG + Intergenic
962108784 3:132420223-132420245 TCTGCACAGCAGACTCACCCAGG - Intronic
962498308 3:135965297-135965319 GCTGCTGGCCAGACATTCCCTGG - Intergenic
962708016 3:138063465-138063487 GCTGCAGTGCAGACCCTTCCAGG - Intronic
964420275 3:156495046-156495068 ACTGCAGGGCACACACACTGGGG - Intronic
964431069 3:156606269-156606291 GCTTCTGGGCACACGCACCCCGG - Intergenic
964717702 3:159740275-159740297 GCTGCAGGCCATACCCACACTGG + Intronic
965117990 3:164515703-164515725 GCAGCAGGGGAGGCACAGCCAGG - Intergenic
967312393 3:188118194-188118216 GCTGCAGTGCCGAGTCACCCTGG - Intergenic
968441907 4:628570-628592 TCTGCAGGGCAGGCAGGCCCCGG + Intronic
968581225 4:1396249-1396271 TCTGCAGGCCAGACCCCCCCAGG - Intergenic
968750251 4:2385200-2385222 GCTTCAGGACAGACAGACCTGGG + Intronic
969622472 4:8285628-8285650 GCTGAATGCCAGACACAGCCTGG - Intronic
969738030 4:9004103-9004125 GCTGTGGGTCAGACACACCCTGG - Intergenic
969797220 4:9535650-9535672 GCTGTGGGTCAGACACACCCTGG - Intergenic
971282107 4:25249665-25249687 GCGGCAGGGCAGACACTCCTGGG + Intronic
971448671 4:26779380-26779402 GGTGCTGGGCAGACCCACCTAGG + Intergenic
971790775 4:31167533-31167555 TCTGCAACACAGACACACCCAGG + Intergenic
971876732 4:32318206-32318228 GCAGCAGGGCAGACAGATCCAGG + Intergenic
971923887 4:32980877-32980899 ACTGCAGGGCATACACACAAAGG - Intergenic
972427774 4:38950576-38950598 ACTGCAGGACAGAAAGACCCCGG + Intergenic
985373925 4:189314362-189314384 TGTGCAGGGCGGACGCACCCCGG + Intergenic
985373939 4:189314410-189314432 TGTGCAGGGCGGACGCACCCCGG + Intergenic
985373953 4:189314458-189314480 TGTGCAGGGCGGACGCACCCCGG + Intergenic
985373967 4:189314506-189314528 TGTGCAGGGCGGACGCACCCCGG + Intergenic
985373981 4:189314554-189314576 TGTGCAGGGCGGACGCACCCCGG + Intergenic
985373995 4:189314602-189314624 TGTGCAGGGCGGACGCACCCCGG + Intergenic
985374009 4:189314650-189314672 TGTGCAGGGCGGACGCACCCCGG + Intergenic
985374023 4:189314698-189314720 TGTGCAGGGCGGACGCACCCCGG + Intergenic
985374037 4:189314746-189314768 TGTGCAGGGCGGACGCACCCCGG + Intergenic
985374051 4:189314794-189314816 TGTGCAGGGCGGACGCACCCCGG + Intergenic
985374065 4:189314842-189314864 TGTGCAGGGCGGACGCACCCCGG + Intergenic
985374079 4:189314890-189314912 TGTGCAGGGCGGACGCACCCTGG + Intergenic
985519815 5:368661-368683 CCTGCAGAGGAAACACACCCTGG - Intronic
985680718 5:1254258-1254280 GCTGAAGTGCAGACGCCCCCGGG - Intronic
985694952 5:1335011-1335033 GCTCCAGGGCGGCCTCACCCAGG + Intronic
985958409 5:3281646-3281668 CCTGCAGGCCAGACACCCCCAGG - Intergenic
988051326 5:26035245-26035267 GCTGCTGGGAAGTTACACCCTGG + Intergenic
989609451 5:43277298-43277320 GCTTCACGGCAGACACAATCTGG - Exonic
992266958 5:75028948-75028970 TCTGCAGATCAGACACATCCTGG + Exonic
992515898 5:77492141-77492163 GACGCAGAGCAGACCCACCCGGG + Intronic
1001466896 5:171975382-171975404 GCTGCTGGCCAGCCACAGCCTGG + Intronic
1002166042 5:177346905-177346927 GCTGCACAGCAGACCCACCTGGG + Intronic
1002950248 6:1802636-1802658 CCTGTAGGGCAGACTCGCCCAGG - Intronic
1004599213 6:17131540-17131562 TCTGCAGGGAAGACAGACACTGG - Intergenic
1004868620 6:19879751-19879773 GCTGTAGGGTATACACCCCCAGG + Intergenic
1006022730 6:31126835-31126857 GCTGTAGGGCAGTCGCTCCCTGG + Intronic
1007032416 6:38640115-38640137 CCGGCAGGGCAGCCACACCCTGG - Intronic
1010752470 6:79631116-79631138 GCTGGAGGGGAGCCACAGCCCGG - Intergenic
1011149146 6:84249899-84249921 CCTGCAGTGCAGCCACAGCCTGG + Intergenic
1015110849 6:129589897-129589919 GCTGAAGGTCAGACAGCCCCTGG + Intronic
1016163188 6:140907439-140907461 GCCGCAGGGCAGACAGTTCCAGG + Intergenic
1017950430 6:159130961-159130983 GCTGCAGGGCAGATGCCCCCAGG - Intergenic
1018687859 6:166317712-166317734 GCAGCAGGGCAGGCATACCTTGG - Intergenic
1018802415 6:167234759-167234781 GCTGCACTGCAGACAGACGCTGG - Intergenic
1018808372 6:167278737-167278759 GCTGCACTGCAGACAGACGCTGG + Intronic
1018997563 6:168721694-168721716 GCTCCAGGGCAGAATCCCCCTGG - Intergenic
1019139956 6:169936845-169936867 GCTGCAGGGCCGAGTCTCCCCGG - Intergenic
1019174443 6:170153053-170153075 CCTGCAGGGCAGCCGCAGCCTGG - Intergenic
1019214991 6:170437815-170437837 GCCCCAGTGCAGACACAGCCAGG + Intergenic
1019291835 7:254283-254305 GCTGCAGGGCAGGCTCCCCGTGG - Intronic
1019319875 7:410773-410795 CCTGCAGGGCAGACCCCACCCGG + Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019542536 7:1558035-1558057 GCTGCAGGACAGAGTCACCCGGG - Intronic
1019570838 7:1711314-1711336 CCTGCACAGCAGACCCACCCTGG - Intronic
1020256712 7:6506488-6506510 GCTGCAGGGCAGGGACACTGAGG + Intronic
1021658022 7:22891040-22891062 GCCACAGGGCAGACACAGCCAGG + Intergenic
1022839034 7:34145137-34145159 GCTGCAGGTCAGAATCACCTAGG - Intronic
1022958124 7:35400136-35400158 GCTGCAGGGCGAGCACATCCAGG - Intergenic
1023871814 7:44267238-44267260 GTTCCAGGGCAGACAGTCCCTGG + Intronic
1024299657 7:47877218-47877240 GCTGCAGGGCAGACGACTCCTGG + Intronic
1024511386 7:50207446-50207468 GCCCCTGGGCAGAAACACCCTGG + Intergenic
1024588117 7:50858537-50858559 GCTGCATTGCAGCCCCACCCAGG + Intergenic
1024668124 7:51565855-51565877 GATGCAGGACAGTCACCCCCTGG - Intergenic
1024995287 7:55269510-55269532 GCTGCTTGGCACACACGCCCTGG - Intergenic
1025605983 7:63040186-63040208 GCTGCAGGGCACACAGGCACAGG - Intergenic
1026370303 7:69691764-69691786 GCAGCAGGGGAGGCACAGCCAGG - Intronic
1029074595 7:97925892-97925914 GCTGTTGGTCAGACACACCCTGG + Intergenic
1029160757 7:98549676-98549698 GCTGGGGGGCAGGCACACACAGG - Intergenic
1029471880 7:100759824-100759846 GCTTAAGGGCAGACGCACTCTGG + Exonic
1029595888 7:101537524-101537546 TCTCCAGGTCAGACACAGCCAGG + Intronic
1029922770 7:104283273-104283295 GCTCCAGGGGAAACACAGCCTGG - Intergenic
1030774675 7:113519600-113519622 TCTGGTAGGCAGACACACCCGGG + Intergenic
1032658350 7:133955633-133955655 GCTCCAGGGCAGACAGGGCCAGG - Intronic
1033422709 7:141217542-141217564 GTTGCAGGGCAGACACCCATTGG + Intronic
1033422722 7:141217632-141217654 GTTGCAGGGCAGACACCCATTGG + Intronic
1034201758 7:149287136-149287158 GGTCCAGTGCACACACACCCAGG - Intronic
1034276599 7:149826551-149826573 CCTCCAGGGCAGCCACAGCCAGG - Intergenic
1035240641 7:157527006-157527028 GCTGCAGGACAGACGCCCCCAGG + Intergenic
1035681853 8:1494102-1494124 GCTGCAGGGCCCACACACAGTGG + Intergenic
1036243114 8:7095377-7095399 GCTGTGGGTCAGACACACCCTGG - Intergenic
1036257685 8:7218667-7218689 GCTGTGGGTCAGACACACACTGG + Intergenic
1036258936 8:7225666-7225688 GCTGTGGGTCAGACACACACTGG + Intergenic
1036307685 8:7613844-7613866 GCTGTGGGTCAGACACACACTGG - Intergenic
1036310989 8:7684262-7684284 GCTGTGGGTCAGACACACACTGG + Intergenic
1036358540 8:8061845-8061867 GCTGTGGGTCAGACACACCCTGG - Intergenic
1036676746 8:10840091-10840113 GCTCCGCGGCAGACACGCCCAGG - Intergenic
1036778970 8:11632787-11632809 GCTGCAGGGCACACAGGCACGGG + Intergenic
1036829619 8:12011794-12011816 GCTGTTGGTCAGATACACCCTGG + Intergenic
1036891157 8:12598114-12598136 GCTGTGGGTCAGACACACCCTGG + Intergenic
1036892420 8:12605107-12605129 GCTGTGGGTCAGACACACACTGG + Intergenic
1036898713 8:12656054-12656076 GCTGTGGGTCAGACACACCCTGG + Intergenic
1036899964 8:12663083-12663105 GCTGTGGGTCAGACACACCCTGG + Intergenic
1037508104 8:19552953-19552975 GATACATGGAAGACACACCCTGG + Intronic
1037571497 8:20161849-20161871 GCTGCTGGGTAGACTCAGCCCGG - Intronic
1037659619 8:20915610-20915632 TCTGGAAGGCAGGCACACCCAGG + Intergenic
1038001908 8:23399195-23399217 TCTGCATGGCAGTCACACCCTGG - Intronic
1039468131 8:37797813-37797835 CCTGCAGGGCACCCACGCCCCGG + Intronic
1039894164 8:41704609-41704631 GCTGCTGGGCAGAGACCACCAGG + Intronic
1040816287 8:51511631-51511653 GCTGCAGGCCAGACTCAGGCAGG + Intronic
1043955849 8:86359082-86359104 GCTGCATGGCAGAATCACCTGGG - Intronic
1046749935 8:117916362-117916384 GCACCAGCGCAGACACACACAGG + Intronic
1047929670 8:129714053-129714075 GCTGCAGGGGAGAAAAACCCGGG + Intergenic
1048441950 8:134466443-134466465 GCTGCAGGGCAGGTACTCCAGGG - Intergenic
1049051568 8:140201066-140201088 GATGCAGGGCTCACAGACCCAGG + Intronic
1049103945 8:140599521-140599543 GCTCCAGGTCCGACACTCCCAGG + Intronic
1049155814 8:141066093-141066115 GCAGCTGCACAGACACACCCAGG - Intergenic
1049415140 8:142491634-142491656 GCGGCAGGGTGCACACACCCAGG - Intronic
1049544287 8:143222146-143222168 GCTGCAGGGCCTTCTCACCCGGG - Intergenic
1049624748 8:143614986-143615008 GCAGAAGTGGAGACACACCCTGG + Intronic
1051879980 9:21830001-21830023 TTTCCAGGGCAGTCACACCCAGG - Intronic
1052976050 9:34411048-34411070 GCTACAGGCCAGCCACTCCCAGG - Intronic
1055761871 9:79617611-79617633 GCTGGAGGTCAGCCAGACCCAGG + Intronic
1056196569 9:84234915-84234937 GCTGCTGGCCAGACACTGCCAGG - Intergenic
1056886076 9:90445299-90445321 CCTTCTGGGCAGACACACTCTGG - Intergenic
1057546260 9:96021897-96021919 GCTGCGGGGCCGACCCGCCCAGG + Intergenic
1058241955 9:102574398-102574420 GCTGAAAGGCAGGCACAACCAGG - Intergenic
1059411384 9:114134579-114134601 GCTGCACAGCAGGCACAGCCAGG + Intergenic
1060230318 9:121820950-121820972 GCTGCGCGGCAGCCACACCGTGG + Intergenic
1061119531 9:128634635-128634657 CCCGCAGGGCAGGGACACCCTGG + Intronic
1061217724 9:129231469-129231491 GCTCCAAGTCAGACAGACCCAGG - Intergenic
1061848591 9:133401874-133401896 GGTGGCTGGCAGACACACCCTGG - Exonic
1062452783 9:136622539-136622561 GCTGGGGGGCAGACAGGCCCAGG + Intergenic
1062589582 9:137267367-137267389 GCCGCAGGGAAGACACAGCCAGG - Intronic
1062614212 9:137388706-137388728 GCTGCCGGGGAGACCCACTCGGG - Intronic
1185628280 X:1497842-1497864 GCTGCAGGTCTGACACCCACAGG - Intronic
1185778783 X:2828777-2828799 GCTGCCGGGAAGAGAGACCCGGG - Intronic
1186817260 X:13250072-13250094 TCTGCATGGCAGACACAAGCAGG + Intergenic
1189007964 X:37014753-37014775 TCTGCAGGGCAGTCTTACCCAGG + Intergenic
1192898469 X:75470071-75470093 GCAGCCTTGCAGACACACCCAGG - Intronic
1202370593 Y:24193045-24193067 GCTGGGGGGCAGACAAACACAGG + Intergenic
1202500191 Y:25477072-25477094 GCTGGGGGGCAGACAAACACAGG - Intergenic