ID: 1124653981

View in Genome Browser
Species Human (GRCh38)
Location 15:31493970-31493992
Sequence CTCAAAGCAGAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1041
Summary {0: 1, 1: 0, 2: 6, 3: 102, 4: 932}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124653976_1124653981 11 Left 1124653976 15:31493936-31493958 CCTTAAGAAACTAGAAAAGGGGT 0: 1
1: 0
2: 11
3: 81
4: 523
Right 1124653981 15:31493970-31493992 CTCAAAGCAGAGAGGGAGGAGGG 0: 1
1: 0
2: 6
3: 102
4: 932

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124653981 Original CRISPR CTCAAAGCAGAGAGGGAGGA GGG Intronic
900310917 1:2032734-2032756 CTCACAGCAGAGAGCGGGGTGGG - Intergenic
900331181 1:2135396-2135418 TTAAAAGCAAAGAGAGAGGAGGG + Intronic
900482646 1:2906681-2906703 CTCAGGGGAGGGAGGGAGGAAGG + Intergenic
900501197 1:3005502-3005524 CTCAAACCTGGGATGGAGGATGG + Intergenic
900763010 1:4485607-4485629 CTGACGGCTGAGAGGGAGGAAGG + Intergenic
900863096 1:5246544-5246566 AACAAAGCAAAGAGGGAGGGAGG - Intergenic
900907618 1:5571864-5571886 CTCTCAGCAGAAAGGGAGGCTGG - Intergenic
900932791 1:5747507-5747529 CTGACAGCAGGAAGGGAGGAAGG + Intergenic
901037664 1:6346056-6346078 CTGGAAGCAGAGAGGGAGCCAGG + Intronic
901212258 1:7533304-7533326 CTGACAGAAGAGAGGGAGGTGGG + Intronic
901539968 1:9909679-9909701 ATCAAACTACAGAGGGAGGAAGG + Intronic
901811882 1:11772061-11772083 CACTAAGGAGAGAGGGAGGAGGG - Exonic
902077659 1:13800737-13800759 CTCAAAGCAGGGAGTCAGTATGG - Intronic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902479067 1:16702225-16702247 CTGGAAGGAGGGAGGGAGGAAGG - Intergenic
902707958 1:18219425-18219447 CTGAAATCAGAGAGGTAGGGAGG + Intronic
902949720 1:19872819-19872841 CTCAAAAAAGAAAGGAAGGAAGG - Intergenic
903143149 1:21352157-21352179 CTCAGAGAGGACAGGGAGGAAGG - Intergenic
904402036 1:30263265-30263287 AAGAAAGCAGAGAGAGAGGAAGG + Intergenic
904438693 1:30515867-30515889 CACAAAGCACTGAGGGAGGTGGG - Intergenic
904459538 1:30667970-30667992 CTAAAAGCAGAGAGGGCAGAAGG - Intergenic
904774158 1:32896480-32896502 TCCAGAGCAGTGAGGGAGGAAGG - Intronic
905208275 1:36355521-36355543 CTCAAACCAGTGAGGGAGCCTGG + Intronic
905596721 1:39214087-39214109 CTGAAGGCAGGGAGGGAGGAGGG - Intronic
906601930 1:47137802-47137824 CTGAAACCAGAGAGGTAGGCTGG - Intronic
907777432 1:57531658-57531680 AATAAAGCAGAGAGGGAGGGAGG + Intronic
907824206 1:57999789-57999811 TTAAAAGCAGGGAGGGATGAGGG + Intronic
907842316 1:58169885-58169907 TTCAAATCAGAGAGGGAGAAGGG - Intronic
907966649 1:59337340-59337362 CAAAAGGGAGAGAGGGAGGAAGG + Intronic
908150227 1:61293164-61293186 CTCAGAGAAGAGAGGGAGGGAGG - Intronic
908300388 1:62756509-62756531 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908732445 1:67240063-67240085 CTCAAAGGAGAAAGGGTGGGGGG - Intronic
908839826 1:68267774-68267796 CCCAAAGCAATGAGGAAGGAAGG - Intergenic
909016832 1:70389042-70389064 ATTAAAGCAGAGAGGGAGGAAGG - Intergenic
909097133 1:71301433-71301455 ATCAAAGGAGGGAGAGAGGAAGG - Intergenic
909953929 1:81754161-81754183 TCCAAAGGAGGGAGGGAGGAAGG - Intronic
910053859 1:83008473-83008495 GTGGAAGGAGAGAGGGAGGAAGG - Intergenic
910397471 1:86806912-86806934 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
910406462 1:86896241-86896263 CTCAAAACAAAGAGGGGGGGAGG + Intronic
910616964 1:89209057-89209079 GTCTAAGAAGACAGGGAGGATGG + Intergenic
910746532 1:90580792-90580814 GTGAAAGCAAAGAGGGAGCAAGG - Intergenic
911070405 1:93827688-93827710 CTAAAAGGAAAGAGGGAGGGAGG + Intronic
911129800 1:94376571-94376593 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
911260588 1:95680645-95680667 CCGAAAGGGGAGAGGGAGGAAGG - Intergenic
911671199 1:100610195-100610217 CTCAAAGCAGTGATGGAGGAAGG - Intergenic
911751386 1:101501120-101501142 TTTAAATCAGAGAGGGAGGAGGG - Intergenic
911845648 1:102747854-102747876 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
912021271 1:105111269-105111291 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
913056236 1:115162788-115162810 CTCTGAGGAGGGAGGGAGGAGGG - Intergenic
913960108 1:143332872-143332894 CTGAGAGCAGAGGGTGAGGAGGG - Intergenic
914054464 1:144158445-144158467 CTGAGAGCAGAGGGTGAGGAGGG - Intergenic
914124682 1:144807916-144807938 CTGAGAGCAGAGGGTGAGGAGGG + Intergenic
915260536 1:154673736-154673758 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
915510705 1:156385532-156385554 CTCTGAGCAGAGAAGGAAGAGGG + Intergenic
915905509 1:159873897-159873919 TTCCAAGCATAGAGGGAGGGAGG - Intronic
916083601 1:161252376-161252398 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
916114410 1:161474813-161474835 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
916444617 1:164860845-164860867 CTCAGACAAGAGAGGGAGGAAGG + Intronic
916816317 1:168356622-168356644 CTCAAGGAAGGGAGGGAAGAAGG - Intergenic
916875004 1:168959703-168959725 CTCAAAGCAGAGCACAAGGAAGG + Intergenic
916939500 1:169664257-169664279 TTTAAATCAGAGAGGGAGAAGGG - Intronic
917058692 1:171013007-171013029 CTGAAAGATGAGAGAGAGGAGGG - Intronic
917086100 1:171307099-171307121 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
917227548 1:172800643-172800665 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
917279855 1:173370097-173370119 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
917281132 1:173378958-173378980 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
917281183 1:173379356-173379378 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
917445826 1:175105269-175105291 TTTAAATCAGAGAGGGAGAAGGG + Intronic
917505275 1:175621720-175621742 ATAAAGGCAGAGAGGAAGGAGGG - Intronic
917676251 1:177321862-177321884 TTTAAATCAGAGAGGGAGCAGGG - Intergenic
917761242 1:178160800-178160822 CTCCAACCAGAGAAGGGGGATGG + Intronic
918445032 1:184609022-184609044 CTGAAAGCAAAGAGAAAGGAAGG + Intronic
918750204 1:188261481-188261503 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
918922107 1:190726318-190726340 CTGAAAGAAGCCAGGGAGGATGG - Intergenic
918989043 1:191674236-191674258 ATTAGAGCAGGGAGGGAGGAAGG - Intergenic
919051085 1:192512399-192512421 CACAAATTAGAGATGGAGGAAGG - Intergenic
919116826 1:193290451-193290473 ATGAAATCAGAGAGGGAGTAGGG + Intergenic
919287706 1:195585483-195585505 CTCAGAACAGAGAGAGAGAAAGG + Intergenic
920355160 1:205366587-205366609 CTGAAAGGAAAAAGGGAGGATGG - Intergenic
920597625 1:207288613-207288635 CTCAAAGGAGGAAGGGCGGAGGG - Intergenic
920667326 1:207972570-207972592 CTCCAAACAGAGAGGGAGTGGGG - Intergenic
920812801 1:209302996-209303018 CTCACAGAGGAGAGGAAGGAGGG + Intergenic
921317316 1:213905005-213905027 TGAAAAGCAGGGAGGGAGGAAGG + Intergenic
921325866 1:213985839-213985861 CGGAGAGCAGAGAAGGAGGAGGG - Intronic
922801899 1:228368279-228368301 CTTAAAGTGGAGAGGGAGGCTGG + Intronic
923210518 1:231799924-231799946 GACAAAGAAGAGAGGGAGAAAGG - Intronic
923360986 1:233210937-233210959 CTCAGTGCAGAGAAGGAGCAAGG + Intronic
923427031 1:233881269-233881291 CTAAATGCAGAGATGGAGGTGGG - Intergenic
924583766 1:245344233-245344255 AAGAAAGGAGAGAGGGAGGAAGG - Intronic
1063252604 10:4289784-4289806 CACAAAGAAGACAGGGAGAAAGG - Intergenic
1063321726 10:5057989-5058011 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1063811948 10:9721782-9721804 GTCAAAGCAGAGAGAGACTAGGG + Intergenic
1063859110 10:10289472-10289494 TTTAAATCAGAGAGGGAGAAAGG + Intergenic
1063910515 10:10825130-10825152 CTCAAATCAGACAGGGAGGCTGG - Intergenic
1064050674 10:12056834-12056856 CTCAGAGAAGAGAGAAAGGAGGG - Intergenic
1064165304 10:12980522-12980544 CACAGGGCAGACAGGGAGGAGGG + Intronic
1064603591 10:17016598-17016620 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1065082387 10:22141043-22141065 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1065280743 10:24135182-24135204 CTCCAAGAGGAGAAGGAGGATGG + Intronic
1065708291 10:28491370-28491392 CTCAATAGAGAGAGGGAGGGAGG + Intergenic
1065806536 10:29398369-29398391 CTCAGAGCACAGAAGGAGGACGG - Intergenic
1065853506 10:29811306-29811328 TTCTCAGCAGAGAGAGAGGAGGG + Intergenic
1065884325 10:30063472-30063494 CCTAAAGCAGGGAGGGAGGAGGG - Intronic
1065960187 10:30727760-30727782 AGCAAAGGAGAGAGGAAGGAAGG + Intergenic
1066012730 10:31209442-31209464 CTGGCAGCAGAGAGGGAGAAAGG - Intergenic
1066293432 10:34034257-34034279 GTCCAGGGAGAGAGGGAGGATGG - Intergenic
1066358663 10:34709726-34709748 CCCAAAACAGAGAGGGAGAAGGG + Intronic
1066390653 10:34975250-34975272 CTCAAAGGGGAGAATGAGGAGGG + Intergenic
1066614597 10:37282384-37282406 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1066763079 10:38775770-38775792 CTCATAGCTGAGAGTGAGGATGG - Intergenic
1067356434 10:45532550-45532572 CACATGGCATAGAGGGAGGAAGG - Intronic
1067432073 10:46251472-46251494 CCAAAAGCAGAGATGGAGGCTGG - Intergenic
1067776792 10:49170109-49170131 ATCCGAGCAGAGAGGAAGGAAGG + Intronic
1067893970 10:50160135-50160157 GTGAAAGGAGAGATGGAGGAAGG - Intergenic
1067954877 10:50780129-50780151 GTGAAAGGAGAGATGGAGGAAGG + Intronic
1068404975 10:56575976-56575998 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1068526773 10:58139132-58139154 GAGAAAGGAGAGAGGGAGGAAGG + Intergenic
1069365110 10:67688188-67688210 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1069635174 10:69920600-69920622 CACAAGGCAGAGAGGGAGAACGG - Intronic
1069636298 10:69926968-69926990 CTCAAAGGAGCGTGGGTGGAGGG - Intronic
1070456833 10:76625381-76625403 CTAAAAGGACAGAGTGAGGAGGG + Intergenic
1070543650 10:77435831-77435853 AGAAAAGCAGAGAGAGAGGAGGG + Intronic
1070626551 10:78054981-78055003 CCCAGACCAGAGAGGCAGGAAGG - Exonic
1071144115 10:82546940-82546962 AACAAAGAAGAAAGGGAGGAAGG + Intronic
1071426834 10:85565628-85565650 CCATAAGCAGAGAGGCAGGAAGG + Intergenic
1071834835 10:89408611-89408633 TTTAAATCAGAGAGGGAGCAGGG - Intronic
1072719160 10:97770423-97770445 CTGACAGCAGACGGGGAGGAAGG + Intronic
1072945166 10:99803461-99803483 ATGGAAGGAGAGAGGGAGGAAGG - Intronic
1073141237 10:101249312-101249334 GTGAAAGCTGAGAGGCAGGAGGG + Intergenic
1073207743 10:101777459-101777481 CACAGAGCAGGGAGGGAGGCAGG - Intronic
1073299600 10:102462759-102462781 CTCAGAGCAGCGCGGGAGAAAGG - Intronic
1073398607 10:103238872-103238894 CAGAAAGGAGAGAGTGAGGATGG + Intergenic
1073880094 10:107971153-107971175 ATCAAAGCAGAGAGAGACCATGG + Intergenic
1073970730 10:109043516-109043538 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1074104226 10:110376579-110376601 AACAGAGGAGAGAGGGAGGAAGG - Intergenic
1074415600 10:113264469-113264491 CCCCAAGCAGGGAGGAAGGAAGG + Intergenic
1074541792 10:114371252-114371274 CTCAAAGGAGAGAGCCAGGTGGG + Intronic
1074613018 10:115039293-115039315 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1074681580 10:115912859-115912881 CACAAGGCAGGGAGGGAGCATGG + Intronic
1074742671 10:116500198-116500220 TTTAAAACAGAGAGGGAGAAGGG + Intergenic
1074845288 10:117392269-117392291 CTCAAAAAAGAAAGGAAGGAAGG - Intergenic
1075122720 10:119675924-119675946 CTCAAAGAAGGAAGGGAGGGAGG - Intronic
1075310651 10:121411004-121411026 CATAGAGCAGTGAGGGAGGAAGG - Intergenic
1075353959 10:121753833-121753855 CTCAAAGATGAGAGGGAAGTTGG + Intronic
1075552497 10:123402415-123402437 AGGAAAGAAGAGAGGGAGGAGGG + Intergenic
1075572916 10:123558493-123558515 TTCAAAGGAAAGAGGGAGGAGGG - Intergenic
1075649349 10:124117445-124117467 ACCAAGGCAGAGAGGGAGGGTGG - Intergenic
1075808782 10:125209229-125209251 CTCAGGCCAGAGAGGGAGAAAGG + Intergenic
1075836100 10:125454305-125454327 CTCAAAGAACAGGGGCAGGACGG - Intergenic
1076214245 10:128679969-128679991 CTGGAGGCAGAGAGGAAGGAAGG + Intergenic
1076518164 10:131061761-131061783 TTCAGAGTAGAGAGGAAGGAAGG + Intergenic
1076572448 10:131441447-131441469 GGAAAAGGAGAGAGGGAGGAAGG + Intergenic
1076680600 10:132169468-132169490 CTCCCAGCAGGGAGGGAGGGAGG + Intronic
1077334466 11:1997285-1997307 CTCCCAGCAGAGGGGCAGGATGG - Intergenic
1077591954 11:3499272-3499294 TTCAAACTAGAGAGGGAGAAAGG - Intergenic
1077915897 11:6611474-6611496 CTGTCAGCAGAGCGGGAGGAGGG + Intronic
1078335828 11:10462511-10462533 CCCAAGGCAGAGATGGAGGCAGG + Intronic
1078918010 11:15798868-15798890 AGCAAAAGAGAGAGGGAGGAGGG + Intergenic
1079203264 11:18393318-18393340 ATTAAAGAAGAGATGGAGGAGGG + Intergenic
1079205817 11:18413412-18413434 CCAAAAGCAGAGAGGGAGGAGGG - Intronic
1079731239 11:23939342-23939364 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1080239528 11:30110601-30110623 CTCAAAGCAGAGATGGTATATGG + Intergenic
1080582723 11:33657141-33657163 AAGCAAGCAGAGAGGGAGGAAGG + Intronic
1080668730 11:34357684-34357706 CGCGACGCAGAGAGGAAGGAGGG - Exonic
1081145977 11:39562915-39562937 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1081587625 11:44398257-44398279 TTCAAAGCAGAGACGCAGGAGGG - Intergenic
1081667160 11:44923327-44923349 CACCCAGCAGAGAGGGAGGATGG + Intronic
1081732840 11:45383809-45383831 TGCAAAGGAGGGAGGGAGGAAGG - Intergenic
1081782682 11:45724126-45724148 ATCAAACCAGAGAGAGAGAAGGG - Intergenic
1082738632 11:56885339-56885361 CTCAAAGCAGACATTCAGGAAGG - Intergenic
1082906151 11:58310447-58310469 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1083017798 11:59474561-59474583 ATCAAAGCTTAGAGGGTGGAGGG - Intergenic
1083404831 11:62449390-62449412 CTGAAACCAGAGAGGGAGGCAGG + Intronic
1084210989 11:67622268-67622290 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1084212343 11:67630005-67630027 CCGAAAGCTGAGAGGGAGAAGGG + Intergenic
1084247795 11:67872008-67872030 TTCAAACTAGAGAGGGAGAAAGG - Intergenic
1084426954 11:69089357-69089379 CCCAAAGCACAGAGGGTGCAGGG - Intronic
1085721116 11:78913218-78913240 ATGAAAGCAGAGAAGCAGGAAGG - Intronic
1085745317 11:79110118-79110140 CTGGCAACAGAGAGGGAGGAGGG - Intronic
1085854564 11:80161634-80161656 CTCACCACAGGGAGGGAGGAGGG - Intergenic
1086013765 11:82138836-82138858 CAAAAAGAAGAGAGGGAGGGGGG - Intergenic
1086277956 11:85154111-85154133 CCAAAAGAAGAGAGGGAGGGTGG - Intronic
1086317374 11:85608731-85608753 TTTAAATCAGAGAGGGAGAAAGG - Intronic
1086720250 11:90111824-90111846 CTCACAGCTGAGAGTGAGGATGG - Intergenic
1087074985 11:94120418-94120440 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1087459012 11:98422759-98422781 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1087683346 11:101238426-101238448 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1088068641 11:105753959-105753981 CCCAAAGGACAGAGGTAGGAGGG - Intronic
1088116037 11:106315923-106315945 TACAAAACAGAGAGGAAGGAGGG - Intergenic
1088492527 11:110401620-110401642 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1088544726 11:110947806-110947828 CTCTAAGAAGAGAGTGGGGAAGG + Intergenic
1088715245 11:112543337-112543359 CTTAAATCAGAGAGTCAGGAAGG - Intergenic
1088962759 11:114686263-114686285 CCAAAAGCAGGGAGGGAGGATGG - Intronic
1088997001 11:115009719-115009741 ATGAAAGGAGAAAGGGAGGAAGG + Intergenic
1089213610 11:116822389-116822411 CTCATGGAAGAGAGGGAGGGAGG - Intronic
1089285991 11:117408552-117408574 CTCACAGCAGGGTGGGAGGGAGG - Intronic
1089353370 11:117833988-117834010 CAAAAAACAGAGAGGTAGGAGGG + Intronic
1089489287 11:118871798-118871820 CTTTAAGCAGAGGGGGTGGAGGG + Intergenic
1089498588 11:118919991-118920013 CCCAGAGCACAGTGGGAGGAAGG - Intronic
1089523460 11:119081175-119081197 CTCAAAGCAGTGTTGGTGGAAGG - Exonic
1089689673 11:120179462-120179484 CGCAAAGAAGAGTGGGAGTAGGG - Intronic
1089775396 11:120832072-120832094 CTCAAGGCAAGGAGGGGGGAGGG - Intronic
1090001098 11:122959507-122959529 CTCAACGCAGAGAAGGTGGTTGG - Exonic
1090165786 11:124545464-124545486 CTCAAAGAAAAGTGGGTGGAAGG - Intergenic
1090494385 11:127195714-127195736 CACAGAGCAGAAAGGGAGGCTGG - Intergenic
1090620124 11:128553200-128553222 CTCCAGGCTGATAGGGAGGAGGG + Intronic
1090758072 11:129812541-129812563 CTCAAGGGAAAGTGGGAGGAGGG + Intergenic
1090797380 11:130146614-130146636 CTGAAAGCAGACAGGCAGGTAGG - Intergenic
1090878484 11:130812756-130812778 GCCAAGGCAGAGAGGAAGGAGGG + Intergenic
1091097491 11:132837860-132837882 CCCTGAGCAGTGAGGGAGGAGGG - Intronic
1202817449 11_KI270721v1_random:52467-52489 CTCCCAGCAGAGGGGCAGGATGG - Intergenic
1091994702 12:4984078-4984100 CTCAGAGCAGTGTGGGATGATGG + Intergenic
1092418077 12:8307403-8307425 TTCAAACTAGAGAGGGAGAAAGG - Intergenic
1092472285 12:8790506-8790528 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1092484391 12:8889896-8889918 CTTAAAACTGATAGGGAGGAAGG + Intergenic
1093345231 12:18033519-18033541 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1093580588 12:20781053-20781075 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1093990754 12:25587402-25587424 CTCACAGCAGAAAGGGAAGCAGG + Intronic
1094338119 12:29383520-29383542 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1095154012 12:38830894-38830916 CTAGAAGCAGAGAGGCAGCATGG - Intronic
1095328595 12:40929085-40929107 ATCAAAACAGAGAGGAAAGAAGG + Intronic
1095887880 12:47207600-47207622 ATAAAAGCAAAGAGGAAGGAAGG - Intronic
1096638048 12:52973814-52973836 CTCAAAAAAGAAAGGAAGGAAGG + Intergenic
1096968471 12:55647217-55647239 CGCAGAGCAGAGAGTGGGGAGGG + Intergenic
1096995356 12:55834819-55834841 CACAGGGCAGAGAGGGAGTAAGG - Intergenic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097428290 12:59473102-59473124 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1097531352 12:60804188-60804210 TATAAAGCAGAGAGGGAAGAAGG + Intergenic
1098698353 12:73589443-73589465 CTCAAAGGAGAGAGGAATGTAGG - Intergenic
1098808393 12:75051018-75051040 CTCTAAGTAGAAAGGTAGGATGG + Exonic
1099104180 12:78479471-78479493 CCCAGAACAGAGACGGAGGAAGG + Intergenic
1099137501 12:78925621-78925643 CTCTATGAAGAAAGGGAGGATGG - Intronic
1099220746 12:79911186-79911208 CTGAAAAAAGAGTGGGAGGATGG - Intronic
1099376237 12:81898669-81898691 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1099414753 12:82372223-82372245 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1099464046 12:82960619-82960641 ACTAAAGCAGAGAGGGAGGGAGG + Intronic
1099962799 12:89412899-89412921 GACAAAGAAGGGAGGGAGGAAGG - Intergenic
1100209784 12:92388836-92388858 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1100400160 12:94222412-94222434 TTCAAAGCAGAAAGGGAGACAGG - Intronic
1100432599 12:94543931-94543953 CTAAAAGCAGACAGGGAGATAGG - Intergenic
1100436068 12:94572673-94572695 GACAAAGCAGAGAAGGAGGGAGG + Intronic
1100641486 12:96485721-96485743 CTCAAAAAAAAGAGAGAGGAGGG - Intergenic
1101320048 12:103665592-103665614 ACCAAAGCAGAGAGGGAGCAGGG + Intronic
1101348116 12:103904992-103905014 CCCAAAGCAGAGAAAGAGGTAGG - Intergenic
1101408905 12:104453271-104453293 AGGAAAGGAGAGAGGGAGGAAGG - Intergenic
1101704865 12:107212085-107212107 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1101779650 12:107823954-107823976 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1102011068 12:109618618-109618640 TGGAAAGCAGAGAGGGAGCAGGG + Intergenic
1102029310 12:109730853-109730875 CACACAGCAGCGGGGGAGGAGGG - Intronic
1102030560 12:109737881-109737903 CTCAGAACAGAGATGGGGGAGGG + Intronic
1102052162 12:109870622-109870644 ATCAAAGCAGAAGGAGAGGAAGG + Intronic
1102206796 12:111096406-111096428 CACAGAGCAGAGTGGGAGGCGGG + Intronic
1102454179 12:113061268-113061290 CCCCAACCAGAGAGGGAGGAAGG + Intronic
1102498476 12:113335279-113335301 TTCAAAGCGGAGGGAGAGGACGG - Intronic
1102754116 12:115323054-115323076 AAGAAAGGAGAGAGGGAGGAGGG + Intergenic
1102775246 12:115512995-115513017 ATCAAAGCTGAGAGAGAGCATGG - Intergenic
1103199301 12:119073619-119073641 CTCAAAAAAGAGAGAGAGGCCGG - Intronic
1103739389 12:123081208-123081230 CTAAAAGGAGAGAAGGTGGATGG + Intronic
1103743687 12:123107935-123107957 GTGACAGCACAGAGGGAGGAAGG + Intronic
1103915100 12:124372136-124372158 CTCAAGGCAGAGAAGAAGGAGGG - Exonic
1104306174 12:127612500-127612522 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1104610635 12:130225001-130225023 CTCCACGCAGAAAGGGAGAAGGG + Intergenic
1104661474 12:130613935-130613957 ATGACAGCAGAGAGGGAGGGAGG + Intronic
1105757385 13:23480624-23480646 TTAAAAGCAGAGAGAGAGAAGGG - Intergenic
1106321359 13:28642473-28642495 GTAAGTGCAGAGAGGGAGGAAGG - Intergenic
1106811665 13:33364343-33364365 CTCAAACCAGAGTGGGAGTTTGG + Intergenic
1106847734 13:33754472-33754494 TACAAAGGAGAGAGGGATGAAGG + Intergenic
1107536006 13:41333354-41333376 CTGAAAGCAGACAGAGATGATGG - Intronic
1107708223 13:43127744-43127766 GTCACAGGAGAGATGGAGGAAGG - Intergenic
1107710102 13:43142939-43142961 CTGAAGGCAGAGATGTAGGAAGG + Intergenic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1108264580 13:48693648-48693670 CTCTGAAAAGAGAGGGAGGAAGG + Intronic
1108350208 13:49585158-49585180 CTCAAAAAAGAGAGGGAGGCAGG + Intronic
1108848590 13:54702476-54702498 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1109136414 13:58656783-58656805 CTCTCAGCAGAGAGGGAAGCTGG + Intergenic
1109461408 13:62663645-62663667 CTCAAAAAAGAGACTGAGGATGG + Intergenic
1109501018 13:63236114-63236136 TTTAAATCAGAGAGGGAGAAAGG - Intergenic
1109967289 13:69717029-69717051 CTCAAATCAGAGAAGGTAGAAGG - Intronic
1110583810 13:77163719-77163741 TTCAGAGTAGAGAGGGAGAATGG - Intronic
1110889810 13:80684776-80684798 CAAAAAGTAGAGGGGGAGGAAGG - Intergenic
1110921818 13:81097515-81097537 CTAAGAGCAGAAAGGAAGGATGG - Intergenic
1111372520 13:87335751-87335773 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1111634378 13:90884449-90884471 CTCAAGGGAGAAAGGGAGAAGGG + Intergenic
1111718097 13:91906182-91906204 AACAAAGCAGACAGGGAGAACGG - Intronic
1112506364 13:99978666-99978688 GTCAAAGAGGAGAGGGAGGGAGG + Intergenic
1112519108 13:100080511-100080533 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1112538359 13:100283028-100283050 TTTAAATCAGAGAGGGAGAAGGG - Intronic
1112696737 13:101958119-101958141 CTGAAAGCTGAGTAGGAGGAAGG - Intronic
1113551516 13:111196536-111196558 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1113726149 13:112603829-112603851 AGGAAAGCAGAGAAGGAGGAAGG + Intergenic
1113743256 13:112725353-112725375 CTGAGAGCAGAGAGAGTGGAGGG - Intronic
1113870043 13:113553765-113553787 CAAAAGGCAGACAGGGAGGAAGG - Intronic
1114435335 14:22702033-22702055 CTGAAAGGAGAGAGGGCTGAAGG - Intergenic
1115285470 14:31709703-31709725 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1115765214 14:36616336-36616358 CACAGAGCAGAGTGGCAGGAGGG + Intergenic
1116402086 14:44520306-44520328 CTCAAACCATATAGGCAGGAGGG - Intergenic
1116870922 14:50068655-50068677 CATAGAGCAGTGAGGGAGGAAGG - Intergenic
1117760772 14:59025914-59025936 CAAAAAGCAGGGAGGGAGGAAGG + Intergenic
1118008413 14:61586066-61586088 CAGAAGGCAGAGAGGGAGGAAGG - Intronic
1118387211 14:65265724-65265746 CTCAAATCAGTCAGGGAAGATGG - Intergenic
1118991929 14:70804903-70804925 CAGAAAGAAGGGAGGGAGGAAGG + Intronic
1119060844 14:71472118-71472140 CCCAAAGCAGTGAGGGTGGTGGG - Intronic
1119094198 14:71813436-71813458 CCCAAAGCAGAGAGCCAGGCTGG - Intergenic
1119378505 14:74214053-74214075 GCCAAGGCAGTGAGGGAGGAAGG - Intergenic
1120174017 14:81274499-81274521 CTACCAGAAGAGAGGGAGGATGG - Intronic
1120198779 14:81515229-81515251 TTTAAATCAGAGAGGGAGGAGGG - Intronic
1120823630 14:88935507-88935529 CTCAAACCAGAGTGGCTGGAGGG - Intergenic
1120900665 14:89572941-89572963 CTCCTGGCAGAGAGGGAGGCAGG + Intronic
1121223176 14:92301604-92301626 CAAACAGCAGAGAGGGAGGTCGG - Intergenic
1121553716 14:94820738-94820760 CGCCTAGCAGTGAGGGAGGATGG + Intergenic
1121574393 14:94971559-94971581 CTCCAAGCAGAGAGTGAGTCAGG + Intergenic
1121996735 14:98608535-98608557 CTCAGAGCACAGTGGGAGGAGGG + Intergenic
1122031226 14:98914134-98914156 AACAAAGAAGGGAGGGAGGAAGG + Intergenic
1122114920 14:99522832-99522854 CACACAGGAGGGAGGGAGGAAGG + Intronic
1122123708 14:99568086-99568108 CTTTAGGCAGAGAGGCAGGAGGG + Intronic
1122407779 14:101510423-101510445 CTGAAACAAGAGAGGGAAGAGGG + Intergenic
1122659728 14:103287332-103287354 CACACAGCACAGAGTGAGGATGG - Intergenic
1122781046 14:104143717-104143739 CTCCAAGCAGCGAGGGAAGGTGG - Intronic
1202934407 14_KI270725v1_random:72018-72040 CTCATAGCTGAGAGTGAGGATGG - Intergenic
1124108983 15:26769766-26769788 CACAGAACAGAGAGGGAGGGAGG - Intronic
1124465309 15:29933795-29933817 CTGAAAGCAGAGGGAGAGGATGG + Intronic
1124653981 15:31493970-31493992 CTCAAAGCAGAGAGGGAGGAGGG + Intronic
1124787016 15:32690946-32690968 CTGAAGGCAGAAAGGGAGAAGGG - Intronic
1125097352 15:35870256-35870278 GTCAAAGCACAGATGGGGGAGGG - Intergenic
1125200072 15:37095431-37095453 CTCTAGGGAGAGAGGGAGGAAGG - Intronic
1125447898 15:39777260-39777282 ATCAGAGCTGAGAGGGAAGAAGG - Intronic
1125884557 15:43218978-43219000 TGAAAGGCAGAGAGGGAGGAGGG - Intronic
1126072085 15:44874182-44874204 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1126086105 15:45012484-45012506 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1126473249 15:49039133-49039155 CTCAAATCAGGTAGGGAGGAAGG - Intronic
1126639167 15:50807303-50807325 CTCGAAAGAGAGAGAGAGGAAGG - Intergenic
1127208802 15:56749481-56749503 CTAAAAGGAGAGAGTGAGGCTGG + Intronic
1127305818 15:57705016-57705038 CTCAAAGCAGAGCGGGTGTGGGG - Intronic
1127374442 15:58370158-58370180 CCCAGAGCAAAGTGGGAGGAAGG + Intronic
1127829955 15:62741998-62742020 CTACAAGCCAAGAGGGAGGAAGG - Intronic
1128203130 15:65827298-65827320 CTCAAAGCAGGAAGAGAGTAAGG - Intronic
1128479182 15:68022740-68022762 CTGTAAGGAGAGAGGGATGAGGG + Intergenic
1128566043 15:68700849-68700871 ATCCCAGGAGAGAGGGAGGAGGG + Intronic
1128818727 15:70633345-70633367 AACAAAACAGAGAGGGAGAAAGG + Intergenic
1128947925 15:71842985-71843007 CTCAGAGCAGAGAGGGGAAAAGG - Intronic
1128987212 15:72230461-72230483 ACCAGAGCAGAGAGGGAGGGAGG + Intronic
1129521481 15:76189222-76189244 GAGAAAGGAGAGAGGGAGGAAGG + Intronic
1130274110 15:82467674-82467696 CTCAAAGCAGACATGGGGGGTGG - Intergenic
1130296311 15:82648714-82648736 GCAAAGGCAGAGAGGGAGGACGG + Intronic
1130538369 15:84802917-84802939 ATCAGAGAAGACAGGGAGGAGGG - Exonic
1130588752 15:85199641-85199663 CTCAAAGCAGACATGGGGGGTGG - Intergenic
1130754120 15:86744685-86744707 CTCAGTGCAAAGAGGGAGGGTGG - Intronic
1130882188 15:88064871-88064893 CTGACAGTTGAGAGGGAGGAAGG + Intronic
1131223987 15:90608537-90608559 CTCTGAGCTGAGAGGAAGGAAGG - Intronic
1131411190 15:92209532-92209554 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1131601174 15:93850567-93850589 CTCAAAGAAAAGAGGGGGAATGG - Intergenic
1132933030 16:2468331-2468353 GGGAAAGCAGAGAGGGAGGGAGG - Intergenic
1133061842 16:3179966-3179988 CTCTAATCAGAGAGGAAGGCAGG + Intergenic
1133357433 16:5147004-5147026 TTCAAACTAGAGAGGGAGAAAGG - Intergenic
1133724005 16:8520825-8520847 CTCAAAAAAGACAGAGAGGAAGG + Intergenic
1133728794 16:8560551-8560573 CTCAAGGAAGAAAGGGAGGGAGG + Intergenic
1133758648 16:8781031-8781053 CTCAAAGGAGAGAGGGAGGGAGG + Intronic
1135181842 16:20281592-20281614 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1135339690 16:21635218-21635240 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1135740258 16:24969309-24969331 AGGAAAGGAGAGAGGGAGGAGGG - Intronic
1135745344 16:25012179-25012201 CCCAAAGAAGAGAAGTAGGATGG - Intronic
1135892124 16:26366661-26366683 CCCAAAGCAGAGGGAGAGGGAGG + Intergenic
1135959479 16:26983793-26983815 CCCAAAGCACAGAGGCAGGAAGG - Intergenic
1135964313 16:27023193-27023215 ATCAATGCAGTGAGAGAGGAAGG - Intergenic
1136056074 16:27690645-27690667 CTAAAAGCCAAGAGGGAGGTGGG - Intronic
1136425525 16:30167568-30167590 AGCAAAGAAGAGAGGCAGGAGGG - Intergenic
1136619248 16:31417042-31417064 CTCAAAAAAAAGAGGGAGGGAGG - Intronic
1137547936 16:49416848-49416870 CGCACAACAGAGAGGGAGGCGGG + Intergenic
1137674610 16:50298111-50298133 ATCAATGCAGAGAGGAAAGAGGG - Intronic
1137793590 16:51196152-51196174 ATCAAAGCAGATGGAGAGGAAGG + Intergenic
1138169877 16:54838779-54838801 ATCAAAGCAGGGAGCGGGGAGGG - Intergenic
1138293389 16:55867121-55867143 TTCCCAGCAGAGAGGGAGCACGG - Intronic
1138770993 16:59663654-59663676 GTGAAAGCAGAGAGGCAGTAAGG - Intergenic
1138981068 16:62269097-62269119 GAAAAAGGAGAGAGGGAGGAAGG + Intergenic
1139875056 16:70139306-70139328 CTCAAGGCAGACCGGGAAGAAGG - Intronic
1140275424 16:73504524-73504546 ATCAAAGGGAAGAGGGAGGAAGG + Intergenic
1140360727 16:74341825-74341847 CTCAAGGCAGACCGGGAAGAAGG + Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140681133 16:77385840-77385862 CTCAAGGCAGGGGGTGAGGAGGG - Intronic
1141017597 16:80465213-80465235 CTCAAGGAAGGGATGGAGGAAGG - Intergenic
1141084919 16:81086659-81086681 CTCAAATCAGAGAAGGAAAAAGG + Intronic
1142024922 16:87807259-87807281 CTGGAAGCAGGGAGGGAGGAGGG + Intergenic
1142201984 16:88765452-88765474 CTCAAGGCACAGAGAGGGGAGGG - Intronic
1142670851 17:1486814-1486836 TTCAAAGCAGGGAGGGAGATGGG - Intronic
1142675453 17:1510577-1510599 TTCCAAGGAGAGAGGGAGGAAGG - Intronic
1142826763 17:2517678-2517700 CAAAAAGGAGAGAGAGAGGATGG + Intergenic
1143115990 17:4582182-4582204 CTCAGAGCAGAGCAGGACGACGG + Intergenic
1143527770 17:7482412-7482434 CTCAAGGCAGAGGGTGAGGACGG - Exonic
1143601710 17:7950952-7950974 CCCAGAGCAGGGAGGGAGGGAGG + Intergenic
1144105615 17:11982082-11982104 CACATAGCAGAGAGGGGGGTTGG - Intronic
1144499719 17:15775511-15775533 AGGAAAGAAGAGAGGGAGGAAGG - Intergenic
1145167246 17:20623937-20623959 CTCAAAAAAGAAAGGAAGGAAGG - Intergenic
1145377362 17:22363102-22363124 CTAAAAGCAGAGCTGGAGTAAGG - Intergenic
1145912522 17:28550980-28551002 ATCAATGGAGAGAGGGAGGCTGG - Intronic
1146310492 17:31764706-31764728 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1146434260 17:32828639-32828661 CTACATGCAGAGAGGGAGGGAGG + Intronic
1146476256 17:33164963-33164985 CGCTAAGCAGAGAGGAAGGGAGG - Intronic
1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG + Exonic
1147511895 17:41076960-41076982 AGGAAAGAAGAGAGGGAGGAAGG + Intergenic
1147639740 17:41988862-41988884 CTCAAAGCAAAGAAAGAAGATGG - Exonic
1147896226 17:43753172-43753194 CTCAGAGGAGAGAGGGATCATGG + Intergenic
1147899272 17:43773354-43773376 CTAAAAGCAGAAAGGGAGAAAGG + Intronic
1148102187 17:45099040-45099062 GTGAAAGCAGAAGGGGAGGAGGG + Intronic
1148293212 17:46475253-46475275 CTGCAAGCAGAGAGGGAGCATGG + Intergenic
1148315397 17:46692956-46692978 CTGCAAGCAGAGAGGGAGCATGG + Exonic
1148384725 17:47226022-47226044 AAGAAAGAAGAGAGGGAGGAGGG - Intergenic
1148695521 17:49555971-49555993 TCCCAAGAAGAGAGGGAGGAGGG + Intergenic
1150860035 17:68791760-68791782 CTAAAAGTGGGGAGGGAGGAAGG + Intergenic
1150960419 17:69905991-69906013 CACAAAGCAAAGAGGGAAGGGGG - Intergenic
1151042613 17:70881099-70881121 ATAAGAGAAGAGAGGGAGGAAGG + Intergenic
1151356639 17:73562539-73562561 CTCAAAGAAGAGAGAGAGACAGG + Intronic
1151420654 17:73994991-73995013 TTCAGAGCAGAGATGCAGGATGG + Intergenic
1151782414 17:76256151-76256173 CTCACAGCTGGGAGAGAGGAGGG - Intergenic
1151871634 17:76840752-76840774 AGAAAAGAAGAGAGGGAGGAAGG - Intergenic
1152189008 17:78876857-78876879 CTCCAGGCAGAGAGGGGAGATGG - Intronic
1152235180 17:79134928-79134950 GTCACAGCAGAGATTGAGGAGGG + Intronic
1152343559 17:79738242-79738264 CCCAGAGCAGAGAGGCTGGAAGG - Intronic
1152359620 17:79825571-79825593 CTCAGAACAGAGAGGGACCAGGG - Intergenic
1152420896 17:80192634-80192656 GTCAAGGCAGTGAGGGAGGCGGG - Intronic
1153299607 18:3581282-3581304 ATCAGAGAAGACAGGGAGGAGGG - Intronic
1153438034 18:5087681-5087703 TTTAAATCAGAGAGGGAGAAAGG - Intergenic
1153738720 18:8100094-8100116 AGCAAGGCAGAGAGTGAGGAGGG + Intronic
1153872009 18:9330419-9330441 AACAAGGCAGGGAGGGAGGAGGG + Intergenic
1153981652 18:10315503-10315525 CTCAGAGCAGAGATGGATGAAGG - Intergenic
1154115511 18:11610023-11610045 CTCAAGGCAGAGGGTGAGGATGG - Intergenic
1155052332 18:22159511-22159533 CTCAAAGAAGTGAGGTAGGAGGG - Intergenic
1155085698 18:22455618-22455640 CTCAGAGCAGTTAGGGAGGCAGG + Intergenic
1155239451 18:23851620-23851642 GACAAACCATAGAGGGAGGAAGG - Intronic
1155817151 18:30327073-30327095 CTCAAAGCAGTTAGGCAGGAGGG - Intergenic
1155920947 18:31602237-31602259 ATCATAGCAGAGAGGGAGATGGG - Intergenic
1156053137 18:32963260-32963282 CTCAAAGCAGAGAAGTATGAGGG - Intronic
1156120870 18:33841396-33841418 CTGAAATCAGAGAGGGGGGTAGG - Intergenic
1156553602 18:38043445-38043467 CTCAAAGGGGAGAGGGAGGGAGG + Intergenic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157349436 18:46871433-46871455 CTCAGAACAGGGAGGGAGGGAGG + Intronic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1157857915 18:51118265-51118287 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1157941726 18:51936001-51936023 CCCAAAGCAGAGATGAAGCAGGG - Intergenic
1158282499 18:55842802-55842824 CACTAAGCAGAGAAGGAAGAAGG - Intergenic
1158700084 18:59737648-59737670 GTGAAAGCAGGGAAGGAGGAAGG + Intergenic
1159103216 18:63978016-63978038 CTTAAAAGAGAGAGGCAGGAGGG - Intronic
1159309345 18:66687428-66687450 CTCAAAGAAGGGAGGGAAAAAGG - Intergenic
1160211261 18:76882060-76882082 CTAGAAGCACAGAGGGAGGGCGG - Intronic
1160246250 18:77162546-77162568 CTCTCAGCAGCCAGGGAGGAAGG - Intergenic
1160532053 18:79571430-79571452 CTCCCCGTAGAGAGGGAGGATGG - Intergenic
1161883316 19:6973016-6973038 CTCAAAGCAGAAAGGGCACAGGG - Intergenic
1162237492 19:9320747-9320769 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1163242708 19:16074186-16074208 AGCAAGTCAGAGAGGGAGGAAGG + Intronic
1163409255 19:17143400-17143422 CTCAAAGCCGAGAAGGAGGGAGG + Intronic
1163500088 19:17671129-17671151 GTCATAGCCCAGAGGGAGGAAGG + Intronic
1164767510 19:30783085-30783107 ATCAAATCAGAGAGGATGGATGG - Intergenic
1164816051 19:31204303-31204325 AGAAAAGGAGAGAGGGAGGAAGG - Intergenic
1164925578 19:32127614-32127636 AGGAAAGGAGAGAGGGAGGAAGG + Intergenic
1164992968 19:32697865-32697887 TTAAAATCAGAGAGGGAGAAGGG + Intronic
1165151268 19:33761830-33761852 CTCAAAAAAGAAAGGAAGGAAGG + Intronic
1165501728 19:36194823-36194845 GTCAAAGGAGGGAGAGAGGAGGG - Intronic
1165929172 19:39344924-39344946 CTCAAAGGGGAGAAGGAAGAAGG - Intronic
1166146473 19:40840255-40840277 CAGAAAGCAAAGAGGGAGTAAGG - Intronic
1166150519 19:40870868-40870890 CAGAAAGCAAAGAGGGAGTAAGG - Intronic
1166395032 19:42433407-42433429 CTGAAAGCAGAGAGGCAAAATGG - Intronic
1166657559 19:44623341-44623363 CACATAGCAGAGAGGGAGCTGGG + Intronic
1166803640 19:45472509-45472531 GTCACAGAAGAGAGAGAGGAAGG - Intronic
1167539110 19:50074186-50074208 CTCCAGGCAGAAAGAGAGGAAGG + Intergenic
1167714081 19:51129844-51129866 GTCAGAGCAGACAGTGAGGATGG - Intronic
1167740276 19:51320439-51320461 CACCAGGCGGAGAGGGAGGAAGG - Intronic
1168677161 19:58286887-58286909 GATGAAGCAGAGAGGGAGGAAGG - Intronic
1202693943 1_KI270712v1_random:111123-111145 CTGAGAGCAGAGGGTGAGGAGGG - Intergenic
1202713108 1_KI270714v1_random:28132-28154 CTGGAAGGAGGGAGGGAGGAAGG - Intergenic
925384426 2:3452268-3452290 CTCCCTGCAGAGAGGGAGGGAGG + Intronic
925625505 2:5839011-5839033 ATCAAAGCAGAGAGCAGGGAAGG - Intergenic
925847833 2:8049718-8049740 CTGAAAGAAGAGATGGATGAAGG - Intergenic
925949922 2:8900479-8900501 TTTAAATCAGAGAGGGAGAAGGG + Intronic
926244636 2:11113688-11113710 AGGAAAGAAGAGAGGGAGGAAGG - Intergenic
926267860 2:11343530-11343552 CTAAAAGGAGAGAGTGAGGGCGG + Intronic
926609411 2:14930947-14930969 CTCCAACAAGAGTGGGAGGAAGG + Intergenic
926927718 2:18004610-18004632 AGCACAGCAGAAAGGGAGGAGGG - Intronic
927802969 2:26118312-26118334 CTCAAAAAAAAGGGGGAGGAGGG - Intronic
928285988 2:29990465-29990487 AAGAAAGCAGAAAGGGAGGAAGG + Intergenic
929178820 2:39010586-39010608 CTCAAACCACAGAGTGAGGTTGG + Exonic
929317883 2:40502302-40502324 CGCAAACCTGAGAGGGAAGATGG - Intronic
930038500 2:47102805-47102827 TTTAAATCAGAGAGGGAGAAGGG - Intronic
930409306 2:51003745-51003767 AGCAAAGGAGAGGGGGAGGAAGG + Intronic
930675035 2:54191274-54191296 ATCAGATCAGAGAGAGAGGATGG - Intronic
930713044 2:54567212-54567234 CTTAAAGTACAGAGTGAGGATGG + Intronic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
931540464 2:63324469-63324491 TTTAAATCAGAGAGGGAGAAGGG - Intronic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
931930219 2:67124376-67124398 CTAAAAGCAGACTGGAAGGATGG - Intergenic
932398011 2:71461417-71461439 CTCAGAGCTGAGAGGGAGCTTGG + Intronic
933342128 2:81037482-81037504 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
933952618 2:87343452-87343474 CTGAGAGCAGAGGGTGAGGAGGG + Intergenic
934236863 2:90239798-90239820 CTGAGAGCAGAGGGTGAGGAGGG + Intergenic
934306846 2:91832308-91832330 CTCATAGCTGAGAGTGAGGATGG + Intergenic
934326410 2:92020434-92020456 CTCATAGCTGAGAGTGAGGATGG - Intergenic
934464770 2:94251050-94251072 CTCATTGCTGAGAGTGAGGATGG - Intergenic
934867097 2:97823324-97823346 TTTAAATCAGAGAGGGAGAAGGG - Intronic
935061065 2:99608224-99608246 CTCAAAGGAAAAAGGGAGAAAGG - Intronic
935167281 2:100580562-100580584 TCAAAAGCAGAGAGGGAGGGAGG - Intergenic
935484742 2:103639740-103639762 TGGAAAGAAGAGAGGGAGGAGGG + Intergenic
935703928 2:105839771-105839793 CTCAAAGCCAAGAGGGCGGATGG + Intronic
936102089 2:109590956-109590978 CCCAGAGCAGAGAAGGAAGATGG + Intronic
937248082 2:120506439-120506461 ATCATAACAGAGAGGCAGGAGGG + Intergenic
937423243 2:121775904-121775926 GTGATAGCAGAGAGAGAGGATGG - Intergenic
938212462 2:129480273-129480295 ATGAAAGCAGAAAGGGATGATGG + Intergenic
938806217 2:134809179-134809201 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
938981397 2:136530657-136530679 CTAGAAGCAGAGAGTAAGGAGGG - Intergenic
939192104 2:138929193-138929215 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
939314109 2:140524790-140524812 CCAAAAGGGGAGAGGGAGGAAGG + Intronic
939437320 2:142195181-142195203 CCCAAAGGAGGAAGGGAGGAAGG + Intergenic
939851828 2:147313609-147313631 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
939878857 2:147607282-147607304 CCAAAACCAGAGTGGGAGGAAGG + Intergenic
939905239 2:147905836-147905858 CCAAAAGCAAAAAGGGAGGAAGG + Intronic
940072818 2:149708656-149708678 CACATAGCAGAGAAGGAGGTGGG + Intergenic
940338892 2:152558610-152558632 CTGAAAGGACATAGGGAGGAAGG - Intronic
940717968 2:157249346-157249368 CTCAAAACATTGAGGGAGGAAGG - Intergenic
940939335 2:159540013-159540035 CTCCAAACAGGGATGGAGGAAGG - Intronic
941243387 2:163068982-163069004 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
942207307 2:173632230-173632252 CTCAAAGCAGTAAGCTAGGAAGG - Intergenic
942492254 2:176501159-176501181 AAAAAAGCAGAGAGGGAGGGCGG - Intergenic
942616663 2:177798052-177798074 CTCAATGCAGACAGGGAAAAGGG - Intronic
943103098 2:183510718-183510740 TTTAAAACAGAGAGGGAGAAAGG + Intergenic
943133723 2:183887664-183887686 TTTAAATCAGAGAGGGAGAAAGG - Intergenic
943340173 2:186671300-186671322 ATGCAAGCAGAGAGGCAGGAAGG - Intronic
943371938 2:187026976-187026998 GCCAAAGCAGAGAGAGAGAAGGG - Intergenic
943510468 2:188819939-188819961 CTCAAAGCAGGCAGGAAGGAGGG + Intergenic
944036117 2:195296632-195296654 GCCAAAACAGAGAGGGAGAAAGG + Intergenic
944130427 2:196341657-196341679 CAAAAAGCAGAGAGAAAGGAAGG - Intronic
944454033 2:199875135-199875157 TTTAAAGGAGAGAGGGAAGATGG + Intergenic
944719054 2:202404776-202404798 CCAAAAGCAGGGAGGGAAGAGGG - Intronic
944728972 2:202499139-202499161 TTTAAATCAGAGAGGGAGAAGGG - Intronic
945450107 2:209984651-209984673 CTCAAGGCAATGGGGGAGGAAGG - Intronic
945804524 2:214474264-214474286 CTGAAAGCAAAGAGGCAGCATGG + Intronic
946207386 2:218119710-218119732 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
946381606 2:219352700-219352722 CTCACAGCAGCCAGGGAGGATGG + Intergenic
947441904 2:230130885-230130907 CTCAAAGCAGGCAGGAAGGAAGG - Intergenic
947441994 2:230131534-230131556 CACCATGCAGAGAGGGAGCAAGG - Intergenic
948047332 2:234953897-234953919 CAGAAAGCAGAGGTGGAGGAGGG - Intronic
948049293 2:234967480-234967502 CTCCAAGCAGGCAGGGAAGATGG - Intronic
948088234 2:235268102-235268124 CTCAAAGCAGAGATGGACGTGGG - Intergenic
948511337 2:238467193-238467215 CACATGGCAGAGGGGGAGGAAGG + Intergenic
948585415 2:239015934-239015956 CTCCTAGGAGAGAGAGAGGATGG - Intergenic
949004992 2:241640729-241640751 CTTAAAGCAGTGTAGGAGGAAGG + Intronic
1169373284 20:5044964-5044986 CTCCAAGAAGGGAGTGAGGAAGG - Intergenic
1169447188 20:5682311-5682333 CTTATAGCAGAGGGGCAGGAAGG + Intergenic
1170501800 20:16982390-16982412 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
1170705272 20:18738739-18738761 CTGCCAGCAGGGAGGGAGGAAGG + Intronic
1171031642 20:21682056-21682078 CACGAAACTGAGAGGGAGGAGGG - Intergenic
1171261480 20:23738152-23738174 TTTAAATCAGAGAGGGAGAAAGG - Intergenic
1171270622 20:23814043-23814065 CTTAAATCAGAGAGGGACAAAGG - Intergenic
1172340623 20:34154656-34154678 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1172631466 20:36381260-36381282 CTCACAACAGATAGGGAAGATGG + Intronic
1172952264 20:38729678-38729700 CTCAAAACAGAGAGGGACAGGGG + Intergenic
1173264242 20:41464019-41464041 CACAAAGGAGAGAGTGAGAAAGG + Intronic
1173749563 20:45466793-45466815 CTAGTTGCAGAGAGGGAGGATGG + Intergenic
1173833100 20:46105318-46105340 CTCAGAGTAGAGAGGGAGTATGG + Intergenic
1173917914 20:46723310-46723332 CTCCAAGAAGAGGGTGAGGAGGG - Intronic
1174044756 20:47725725-47725747 CCCAAAGCAGAGAGGCAGGCTGG - Intronic
1175411881 20:58775901-58775923 GTCAATGGAGAGAGGCAGGATGG - Intergenic
1175545088 20:59772970-59772992 TTCATAGCAGAGAAGCAGGAAGG + Intronic
1175566902 20:59987377-59987399 AGGAAAGCAGAGAGGAAGGAGGG - Intronic
1175584945 20:60131766-60131788 CTGGAAACAGAGAGAGAGGACGG + Intergenic
1175717076 20:61262313-61262335 CTCTAAGCTGAGAGAGAGCAAGG + Intronic
1176008624 20:62880216-62880238 CTCCAAACTGAGAGGGAGGGGGG + Exonic
1177135037 21:17299014-17299036 TTTAAATCAGAGAGGGAGGAGGG - Intergenic
1177650135 21:23949652-23949674 CTCAGTGCAGAGGGAGAGGAAGG + Intergenic
1177800725 21:25826093-25826115 GTCAAAGAAGGAAGGGAGGAAGG - Intergenic
1178237219 21:30856899-30856921 ATTAAAGCAGGGTGGGAGGAGGG + Intergenic
1179081882 21:38178977-38178999 CTGAAAGGAAAGATGGAGGATGG - Intronic
1180278669 22:10671335-10671357 CTCATAGCTGAGGGTGAGGATGG - Intergenic
1180585922 22:16890197-16890219 CTCATAGCTGAGAGTGAGGATGG - Intergenic
1180587666 22:16907206-16907228 CTTACAACAGGGAGGGAGGAAGG + Intergenic
1180867059 22:19125754-19125776 CACAAACCAGAGAAGGAAGACGG + Intergenic
1180874951 22:19170935-19170957 CTGAAGGAAGAAAGGGAGGAAGG - Intergenic
1181137805 22:20781283-20781305 CTCTAAGCTGAGAGTGTGGAAGG + Intronic
1181388994 22:22565507-22565529 TTCACTGCACAGAGGGAGGAGGG - Exonic
1181451382 22:23024399-23024421 CTCAAAGCAGGAAAGGTGGAGGG - Intergenic
1181452367 22:23032285-23032307 CTCAAAGCAGGGAAGGTGGAGGG - Intergenic
1181507961 22:23374401-23374423 TTCCCAGCAGAGAGGGAGCACGG - Intergenic
1181929413 22:26387994-26388016 CTCAAAGCAGTCAGGCAGGAGGG + Intergenic
1181990329 22:26832228-26832250 ATCAAAGGAGAGGGAGAGGAAGG + Intergenic
1182120925 22:27786187-27786209 CTGAAGGCAGAGAGACAGGAAGG + Intronic
1182294237 22:29303736-29303758 CTCATGGGAGAGAAGGAGGAAGG + Intergenic
1182396699 22:30041448-30041470 GTCAAGGCAGAGTGGGGGGATGG - Intergenic
1182600939 22:31463270-31463292 CTTAAACCAGTCAGGGAGGAAGG - Intronic
1182621319 22:31620254-31620276 GTCAAAGGTGAGAGTGAGGAGGG - Intronic
1183080727 22:35454396-35454418 CCCAAAGAAGAGAGAGGGGAGGG - Intergenic
1183136023 22:35888625-35888647 CTCATGGCAGAAAGGGAAGAGGG + Intronic
1183143884 22:35971511-35971533 AGCAGAGAAGAGAGGGAGGAAGG - Intronic
1183385315 22:37510751-37510773 CTCATGGCAGAAAAGGAGGAGGG + Intronic
1183629524 22:39024923-39024945 CTCAAACCAAACAGGGGGGATGG + Intronic
1183730905 22:39617837-39617859 CAGAGAGCAGGGAGGGAGGAGGG - Intronic
1183924164 22:41193847-41193869 CTCAAAAAAGGGAGGGAGGAAGG + Intergenic
1184263373 22:43332579-43332601 CTCCCAGCTGAGAGGGAGCAGGG - Intronic
1184508642 22:44918975-44918997 GTCAAAGCACTGAGGGAGGGAGG - Intronic
1184735918 22:46397836-46397858 CTTAATGCAGGGAGTGAGGATGG - Exonic
1184769245 22:46588183-46588205 CTCAAAGCAGATGGGGTGGCTGG - Intronic
1184882119 22:47314356-47314378 CACAAAGGACAGAAGGAGGAAGG - Intergenic
949301317 3:2586933-2586955 ATCAAAGGAGGGAAGGAGGAAGG - Intronic
949885465 3:8689732-8689754 CTCAAAGCCAAGATTGAGGACGG - Intronic
949914190 3:8944645-8944667 AGGAAAGCAGAGAGGGAGGGAGG + Intronic
950151981 3:10694842-10694864 CTGTCAGCAGAGAGGGAGGGGGG - Intronic
950426557 3:12927630-12927652 CTCAGAGCACAGAGGGAAGAGGG + Intronic
950899765 3:16486989-16487011 CACATGGCAGAGAGGGAGGGAGG - Intronic
951020460 3:17776694-17776716 TTTAAATCAGAGAGGGAGAAGGG - Intronic
951033003 3:17903760-17903782 AACAAAGGAGAGAGGGAGGGAGG - Intronic
951111814 3:18812800-18812822 TTCCAAACAGAGAGGAAGGAAGG - Intergenic
951239446 3:20271908-20271930 TTTAAATCAGAGAGGGAGAAAGG - Intergenic
951661313 3:25069697-25069719 CTGAAAGCGGAGGGGGAGGCAGG + Intergenic
951689877 3:25384309-25384331 CTCTTAGGAGAGAGGGAGGGAGG - Intronic
952452998 3:33448870-33448892 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
952555078 3:34522078-34522100 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
952719269 3:36515282-36515304 CTCACAGCTGAGAGGAAGGGTGG + Intronic
952775345 3:37040732-37040754 CTCAAAGCTGGGAGGAAAGAAGG - Intronic
952940981 3:38444223-38444245 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
953622973 3:44548684-44548706 CTTAAATCAGAGAGGGAGAAGGG + Intergenic
953663719 3:44910123-44910145 CTCAGAACTGAGAAGGAGGAAGG - Exonic
953909221 3:46883336-46883358 CGCAAAGGAGGGAGGGAGGGAGG - Exonic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
954586951 3:51744556-51744578 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
954598898 3:51852392-51852414 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
954627808 3:52032141-52032163 ATAAAAGAAGAGAGGAAGGAAGG - Intergenic
954993738 3:54863402-54863424 CTGAAAGCAGGGAGGGAGAGTGG - Intronic
955429572 3:58828643-58828665 GCTAAAGGAGAGAGGGAGGAAGG + Intronic
955614048 3:60786924-60786946 TTAAAAGAAGAAAGGGAGGAAGG + Intronic
956096479 3:65721584-65721606 CTTAAAGCAGGAAGGCAGGAAGG - Intronic
956289673 3:67648289-67648311 CTGAAGCCAGAGAGAGAGGAAGG + Intronic
956842991 3:73157275-73157297 TTTAAATCAGAGAGGGAGAAAGG + Intergenic
956930603 3:74038868-74038890 CTCAAACTGGAGAGGGAGGGAGG + Intergenic
957043521 3:75355892-75355914 CTCAAAGCCAAGATTGAGGATGG + Intergenic
957062003 3:75489833-75489855 TTCAAACTAGAGAGGGAGAAAGG - Intergenic
957790868 3:84939672-84939694 CACAGGGCAGAGAGGGAAGAAGG + Intergenic
958601360 3:96300012-96300034 CTTAAGTCAGAGAGGGAGAAAGG - Intergenic
958756773 3:98259500-98259522 CTCAGAACAGAGAGAGAGAATGG - Intergenic
959180910 3:102979462-102979484 CTCAAAGCAGGGAGGGTAGCAGG + Intergenic
959575922 3:107933630-107933652 ATCAAAGCAGAGGTGGAGGAAGG - Intergenic
959916657 3:111824097-111824119 TTCAAAGCAAGGAGAGAGGATGG - Intronic
960832769 3:121867195-121867217 CTCAAAGAAGAGGGAGAGCAGGG + Intronic
961061539 3:123832942-123832964 CACAAAGGAGAGAGAGAGGGTGG + Intronic
961088377 3:124089731-124089753 GTCAGGGCAGTGAGGGAGGATGG + Intronic
961261632 3:125606592-125606614 TTTAAAGCAGAGAGGGAGAAAGG - Intergenic
961566058 3:127763978-127764000 CTGAGAGCCGGGAGGGAGGAGGG - Intronic
961895776 3:130166780-130166802 TTCAAACTAGAGAGGGAGAAAGG - Intergenic
962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG + Intergenic
962684334 3:137832436-137832458 GTCAAAGCAGAGAGGTGGAATGG - Intergenic
963378828 3:144503834-144503856 CTCTCAGCAGAGAGGGGAGATGG + Intergenic
963386979 3:144610002-144610024 TTAAAGGAAGAGAGGGAGGAAGG - Intergenic
963696721 3:148573064-148573086 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
964064465 3:152562047-152562069 CTTAAATCAGAGAGGGAGAAGGG - Intergenic
964406195 3:156351889-156351911 CTCAAAGCCAAGCGGGAGCAAGG - Intronic
964972207 3:162576752-162576774 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
965062719 3:163803815-163803837 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
965634489 3:170767464-170767486 TACAAAGAAGAGAGTGAGGAAGG - Intronic
966703079 3:182877682-182877704 CCCAGAGCTGAGAGAGAGGAGGG + Intronic
967044012 3:185719831-185719853 CTCAAAAAAGAAAGGAAGGAAGG + Intronic
967059914 3:185862889-185862911 CCAAAAGCAGGGAGGGAAGAAGG + Intergenic
967672426 3:192253411-192253433 CAACAAGGAGAGAGGGAGGAAGG + Intronic
967891897 3:194369619-194369641 CTCTAAGCAGAGAGGAGGGATGG + Intronic
967966171 3:194961620-194961642 CCCATAGCAGAAATGGAGGAAGG + Intergenic
968218896 3:196918579-196918601 CGCAAAGAAGGAAGGGAGGAAGG + Intronic
968594074 4:1473401-1473423 CCCAGAGGAGACAGGGAGGAAGG - Intergenic
969027073 4:4182248-4182270 CTCAAAGCCAAGATTGAGGACGG + Intergenic
969028317 4:4191893-4191915 CTAAAAGAAGGGAGAGAGGAAGG + Intronic
969149931 4:5160810-5160832 AGCACAGCAGAGAGGGAGGCTGG + Intronic
969211047 4:5687515-5687537 CTCCAAGCAGGGAAGCAGGAAGG + Intronic
969498619 4:7540113-7540135 CTCATAGCAGGGAGGGAGTGGGG - Intronic
969575228 4:8032718-8032740 CGCCAGGCAGAGAGGGAGGAGGG + Intronic
969616062 4:8253187-8253209 GTCAAAGCAGGAAGGGAGGGAGG - Intergenic
969643453 4:8412798-8412820 CGCAGGGCAGCGAGGGAGGATGG - Intronic
969715389 4:8865857-8865879 CCCAAAGCAGCGAGGGAGCCCGG + Intronic
969746998 4:9080336-9080358 TTCAAACTAGAGAGGGAGAAAGG + Intergenic
970463090 4:16295573-16295595 CTCAAAATATAGAGGGAGGTGGG + Intergenic
970690343 4:18612660-18612682 AGAAAGGCAGAGAGGGAGGAAGG + Intergenic
970884683 4:20974424-20974446 CTTAAAGCTGAAATGGAGGAAGG + Intronic
971281240 4:25244144-25244166 TTTAAATCAGAGAGGGAGAAGGG + Intronic
971356007 4:25895838-25895860 CACCAAGTAGAGTGGGAGGATGG + Intronic
971469595 4:27007486-27007508 AAGAAAGGAGAGAGGGAGGAAGG - Intronic
971552423 4:27974600-27974622 GTTAAATCACAGAGGGAGGAAGG - Intergenic
971578436 4:28305247-28305269 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
972000119 4:34020779-34020801 CTTATAGGATAGAGGGAGGAGGG + Intergenic
972133342 4:35862962-35862984 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
972621506 4:40751494-40751516 ATAAAACCAGTGAGGGAGGATGG + Intronic
972894076 4:43597500-43597522 GTAGAAGGAGAGAGGGAGGAAGG - Intergenic
972948797 4:44292469-44292491 CTAGAAGTAGAGAGGGAGGAAGG + Intronic
972996872 4:44891313-44891335 CTAAAGGAAGACAGGGAGGAAGG - Intergenic
973339861 4:48993125-48993147 CACAGAGCAGAAATGGAGGAAGG - Intronic
974227122 4:59060540-59060562 GTGGTAGCAGAGAGGGAGGAGGG + Intergenic
974526522 4:63055082-63055104 TTTAAATCAGAGAGGGAGAAAGG - Intergenic
974537099 4:63186864-63186886 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
974838888 4:67280069-67280091 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
974891184 4:67885988-67886010 CTCAACGCAGAAAGGGAGGTGGG + Intergenic
975248705 4:72151370-72151392 CTCACAGCAGACCAGGAGGAAGG - Intergenic
975249410 4:72160785-72160807 CTCAAAGAAGGGAGGGAGGGAGG - Intergenic
975342509 4:73258240-73258262 TTCAAAGGAAGGAGGGAGGAAGG - Intronic
975595879 4:76047947-76047969 TTTAAATCAGAGAGGGAGAAGGG + Intronic
976162663 4:82220138-82220160 CACAGAGCAGATAGGGAGGAAGG + Intergenic
976174354 4:82336805-82336827 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
977068918 4:92358119-92358141 GTCAAAACAGAGAGGCATGATGG + Intronic
977201492 4:94121786-94121808 CTGAAAGCTGAGAAGGAGCAGGG - Intergenic
977252959 4:94709172-94709194 CTCAAAGCAGGAAGAAAGGATGG + Intergenic
977789828 4:101086944-101086966 GCCAAAGCACTGAGGGAGGAGGG - Intronic
977834957 4:101636038-101636060 TTTAAATCAGAGAGGGAGAAGGG + Intronic
978165011 4:105596482-105596504 CTGAAAGGAGACAGGGAGGAGGG + Intronic
978315405 4:107430343-107430365 CTCAGAGCAAAGATGGAGCAAGG + Intergenic
978601612 4:110434005-110434027 CTAAAAGGAGAGAGGGAGAGGGG - Intronic
978607805 4:110501427-110501449 TTGAAAGTAGAGAGGGAGGAGGG - Intronic
978608968 4:110515877-110515899 CTCATAGCAGAGAGAGAGAGAGG + Intronic
978630657 4:110739980-110740002 CTACAAGTAGAGAGGGAGGCAGG - Intergenic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
978919186 4:114161992-114162014 CCCCAGGCAGAGAGGGAAGAAGG + Intergenic
979287313 4:118940844-118940866 CTCAAAGCAGAGCGAGATGGGGG - Intronic
979914586 4:126414343-126414365 CCAAAAGCAGGGAGGGTGGAGGG + Intergenic
981732154 4:147910946-147910968 AACAAAGGAGAGAGGGAGAAGGG - Intronic
982701087 4:158660217-158660239 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
982775438 4:159437004-159437026 CTCAAATCAGGGTGGGAGGTGGG - Intergenic
983760968 4:171406189-171406211 CTCAAAGGAAAGAAGGAGGTAGG - Intergenic
983834963 4:172374936-172374958 TTTAAATCAGAGAGGGAGAAGGG + Intronic
984087207 4:175327535-175327557 TGCAAAGGAGAGAAGGAGGAAGG - Intergenic
984898670 4:184564699-184564721 CTAAAAGCAGAGCTGGAGTACGG - Intergenic
985171769 4:187157734-187157756 CTCAAAACAGAATCGGAGGATGG + Intergenic
985203436 4:187506857-187506879 CTCAAAGGAGCGAGCGGGGAAGG - Intergenic
985730459 5:1544548-1544570 AGAAAAGCAGGGAGGGAGGAGGG + Intergenic
986060172 5:4181285-4181307 CTCAAAGAAGACAGTGAAGAAGG - Intergenic
986062958 5:4209166-4209188 CTCCCAGCTGAGAGGGAGGAGGG + Intergenic
986380715 5:7182831-7182853 CACAAAACAGAGAGGTAGCAGGG - Intergenic
986759794 5:10869479-10869501 TTCAAGGTAGAGAGGAAGGAAGG - Intergenic
986889784 5:12288400-12288422 CTCAATGGAGAGAGGGGCGAGGG - Intergenic
986933270 5:12853704-12853726 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
987335850 5:16896969-16896991 AAGAAAGGAGAGAGGGAGGACGG + Intronic
987347861 5:16994567-16994589 CTGACAGCTGAGAGGGAGAAAGG + Intergenic
987545286 5:19305085-19305107 CTTAAATCAGAGAGGGAGAAGGG + Intergenic
988275871 5:29080511-29080533 CTCAAAGCAAAGAGGTATGATGG + Intergenic
988592057 5:32557626-32557648 TTTAAATCAGAGAGGGAGAAGGG + Intronic
988605538 5:32675747-32675769 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
988781003 5:34521836-34521858 CTCAAAGCTGGGAGGGAGCATGG + Intergenic
989807666 5:45630243-45630265 ATTTAAGCAGAGAGGGAGCAAGG + Intronic
989955261 5:50351620-50351642 AAGAAAGGAGAGAGGGAGGAAGG + Intergenic
989957309 5:50372576-50372598 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
990116692 5:52399539-52399561 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
990496713 5:56355318-56355340 CTTGAAGCAGAGAGGAAGAAGGG - Intergenic
990537659 5:56738789-56738811 CCAAAAGGGGAGAGGGAGGAAGG - Intergenic
990683863 5:58278009-58278031 CTCTCAGCAGAGAGGGAAGCTGG - Intergenic
990735473 5:58856255-58856277 CTCCAAACAGAGAGAGTGGAGGG + Exonic
990861469 5:60332327-60332349 CCGAAAACAGAGAGGGAGGGGGG - Intronic
991390781 5:66141459-66141481 CTCAAAAAAGAAAGGAAGGAAGG - Intronic
992545733 5:77812249-77812271 TTTAAATCAGAGAGGGAGAAGGG - Intronic
992901393 5:81300696-81300718 CTCAAAGGAGAGACTGAGCAAGG + Intergenic
993364398 5:87018969-87018991 CTCCATGTAGAGAGGGAGAAGGG + Intergenic
993509888 5:88758041-88758063 CTCAAGGAAGGGAAGGAGGATGG - Intronic
994231775 5:97316029-97316051 TTTAAATCAGAGAGGGAGAAAGG + Intergenic
994682816 5:102910380-102910402 CTGAAAGCACAGAGGTTGGAGGG - Intronic
994785265 5:104151871-104151893 CTCAAAGCATACTGTGAGGAAGG + Intergenic
995583464 5:113623567-113623589 TTTAAATCAGAGAGGGAGAAAGG + Intergenic
995706398 5:114992623-114992645 ATTAAATCAGAGAGGGAGAAGGG - Intergenic
995984999 5:118160489-118160511 CCCAAAGCAGAGTAGGAAGAGGG + Intergenic
996306790 5:122056118-122056140 GTCAAATGAGAGAGGGAGAATGG - Intronic
996680341 5:126223538-126223560 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
997526474 5:134556124-134556146 CTCAGCGCTGACAGGGAGGAAGG - Intronic
997721843 5:136084330-136084352 GTGAAAGGAGAGAGGGAGCAAGG + Intergenic
999119353 5:149197289-149197311 GCCAAAGCACAGAGGCAGGAAGG - Intronic
999204977 5:149841328-149841350 CTGCAAGGAGAGTGGGAGGAGGG + Intronic
999444291 5:151626904-151626926 CCCAAAGCAGAGAATGGGGAAGG + Intergenic
999475009 5:151890449-151890471 CTAAAAGCAGAGAGGGACAGAGG + Intronic
999670641 5:153956396-153956418 CACAAAGCAGAGAGTGGGGGTGG + Intergenic
999916511 5:156268590-156268612 CTCAAAATAGAAAGGAAGGAAGG - Intronic
1000085183 5:157882258-157882280 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1000179916 5:158798895-158798917 CTCGAAGCAGGGATGGTGGATGG - Intronic
1000254173 5:159521893-159521915 CTGAAACAAGAGTGGGAGGAAGG - Intergenic
1000382183 5:160639070-160639092 CACAAAGCACAGAGGCAGGAAGG - Intronic
1001557610 5:172647233-172647255 CTTAGAGCAGAGAGGGAAGAGGG + Intronic
1001561814 5:172674694-172674716 TCCCAAGCAGGGAGGGAGGAAGG - Intronic
1001676257 5:173519102-173519124 CTCACAGCCCAGAGGGACGAAGG - Intergenic
1001854120 5:174995870-174995892 GTCACAGGAGGGAGGGAGGATGG + Intergenic
1001958430 5:175864369-175864391 CTCAAAGCAGGGAAGGGGCAGGG - Intronic
1002260774 5:177992730-177992752 CTCAAGGCTGAGGGGGAGCATGG + Exonic
1002353291 5:178601077-178601099 CTCAAAGAAGAGGGGAAGGAAGG + Intergenic
1002659052 5:180777895-180777917 TGGAAAGGAGAGAGGGAGGAAGG - Intergenic
1002699191 5:181110611-181110633 CTCCTAGCGGGGAGGGAGGAAGG + Intergenic
1002812395 6:643644-643666 CTCAAAGTAAAGGGGAAGGAGGG + Intronic
1003601942 6:7525880-7525902 ACCAAAGCACAGAGGCAGGAAGG + Intergenic
1003805747 6:9724536-9724558 TTTAAATCAGAGAGGGAGAAGGG - Intronic
1004000742 6:11594642-11594664 CTCAAAGCAGAGACGAGGGGAGG + Intergenic
1004519217 6:16346498-16346520 CTAAATGCAAAGAGGGAGCAAGG - Intronic
1004812195 6:19273455-19273477 TTTAAATCAGAGAGGGAGAATGG - Intergenic
1006023178 6:31129910-31129932 CTTAAAGAAGAGAGAAAGGAGGG - Intronic
1006221740 6:32497263-32497285 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1006425390 6:33960009-33960031 CTCCATGCTGGGAGGGAGGAGGG - Intergenic
1006875031 6:37288077-37288099 CTCATAGTAGAGAGGGATGGTGG + Intronic
1007074982 6:39060594-39060616 ATCAAGGCAGGGAGGGAGCAGGG + Intronic
1007137906 6:39540639-39540661 AGCAGAGCAGAGCGGGAGGATGG + Intronic
1007178242 6:39910899-39910921 ATCAAAGCAGGGAGGAAGTAGGG - Intronic
1007253383 6:40511668-40511690 GCCAAACTAGAGAGGGAGGAAGG + Intronic
1007519594 6:42441323-42441345 CTCAAAGGGGGGAAGGAGGAGGG + Intronic
1008396644 6:51016450-51016472 CTCAAAGCAAAGGGGGAGTCAGG + Intergenic
1009385984 6:63084558-63084580 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1009407751 6:63330987-63331009 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1009470757 6:64026863-64026885 TTTAAATCAGAGAGGGAGAAGGG - Intronic
1010106388 6:72174117-72174139 CTCAAATCACAGATGGAGGAGGG - Intronic
1010391885 6:75347089-75347111 TTCAATGCACAGAGGGAGAAAGG - Intronic
1010732365 6:79404593-79404615 CTCTCAGCAGAGAGGGAAGCTGG - Intergenic
1011375094 6:86679147-86679169 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1011400525 6:86956507-86956529 CTCAAAGCAGTGATGGTGGCAGG - Intronic
1011467009 6:87668659-87668681 CTTAAAGCAGGGAGTGAGGTGGG - Intergenic
1012248955 6:96958951-96958973 GTCCAAGCAGAGAGGGATGAGGG - Intronic
1012438042 6:99235637-99235659 CTCAAAGGGGAAAGGTAGGATGG + Intergenic
1012528183 6:100202592-100202614 CTTAAAGCAGAGAGGGGTCAGGG - Intergenic
1013190697 6:107802565-107802587 CTCGAGGGAGGGAGGGAGGAAGG + Intronic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1013609212 6:111778509-111778531 TACAAAGGAGAGAGGGAGGAGGG - Intronic
1013778169 6:113701896-113701918 CACAAAGCAGAGAAAGGGGAAGG + Intergenic
1013807204 6:114009338-114009360 CTCAAAGCAGGGAGGGGGTTTGG + Intronic
1013977375 6:116093333-116093355 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1014251146 6:119116740-119116762 CTCAAAGCAGAGAAGGATTAAGG + Intronic
1015208654 6:130671030-130671052 ATGAAAGAAGGGAGGGAGGAAGG + Intergenic
1015211191 6:130701140-130701162 CTGAAAGAGGGGAGGGAGGAAGG + Intergenic
1015864825 6:137717485-137717507 AACAAGGAAGAGAGGGAGGAGGG + Intergenic
1016183980 6:141178402-141178424 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1016385261 6:143524625-143524647 TCCAAAGTAGAGAGGGAGGCAGG - Intergenic
1017212528 6:151872695-151872717 ACCAAAGCAAAGAGGGAGTATGG - Intronic
1017332609 6:153217302-153217324 CTCAAAGCAGAGGAGTAGGTAGG - Intergenic
1017391737 6:153947208-153947230 TTCCAAGGAGAGATGGAGGAGGG + Intergenic
1018154307 6:160971389-160971411 CTCAAAACACACAGGGAGGTAGG + Intergenic
1018162754 6:161063451-161063473 CTTAAAGGAGAGAGGGAGTTAGG + Intronic
1018265505 6:162020113-162020135 CTCAAAGTTGAGAGGATGGAGGG + Intronic
1018961679 6:168453950-168453972 GACAAAACAGAGAGGGAGAATGG - Intronic
1019214358 6:170433757-170433779 CTCATAACAGGGAGGCAGGAGGG + Intergenic
1019301551 7:306754-306776 CTCCAGGCAGAGAGGGAACAAGG - Intergenic
1019302272 7:311846-311868 CTCCAGGCAGAGAGGGAACAAGG + Intergenic
1019332415 7:466889-466911 CTCAATGGAAAGAGGGATGATGG - Intergenic
1019355427 7:576352-576374 TTAAAAGGAGAGAAGGAGGAGGG - Intronic
1019402816 7:866319-866341 CCCAAAAGAGGGAGGGAGGAAGG - Intronic
1019773268 7:2896968-2896990 CGCAATTCAGAGAGAGAGGAGGG - Intergenic
1020326453 7:6978229-6978251 TTCAAACTAGAGAGGGAGAAAGG - Intergenic
1020594227 7:10183904-10183926 CCAAAAGCACAGTGGGAGGAAGG + Intergenic
1020906624 7:14071313-14071335 CTCAAAGCCAAGAGGGCTGATGG - Intergenic
1021262374 7:18474032-18474054 ATCAAAGAAGAAATGGAGGAAGG + Intronic
1021542100 7:21771198-21771220 TTCAAGGGAGGGAGGGAGGAAGG - Intronic
1023078006 7:36502522-36502544 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1023125056 7:36947116-36947138 CCCAAAGCAGAGAGGGAGCAGGG - Intronic
1023353647 7:39345287-39345309 AGCAAAGCTGAGAGGGATGAGGG - Intronic
1023619502 7:42055467-42055489 CAGCTAGCAGAGAGGGAGGAGGG - Intronic
1024653704 7:51431299-51431321 CTCAAATCAGAGAGACAGGATGG - Intergenic
1024735234 7:52297054-52297076 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1024870837 7:53960450-53960472 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1026122518 7:67550307-67550329 AGCAAGGAAGAGAGGGAGGAAGG - Intergenic
1026133153 7:67636824-67636846 GAAAAAGAAGAGAGGGAGGAAGG - Intergenic
1026177713 7:68012602-68012624 CTCAAAGAAGAAGGGGAGAATGG + Intergenic
1026338583 7:69416045-69416067 AGCAAAGAAGAGAGGGAGGCTGG + Intergenic
1026981346 7:74528667-74528689 CTGAAAGGAGGGAGGGAGGGAGG + Intronic
1027193322 7:76010759-76010781 CTCAAAGTAGGGAGGGATGGGGG - Intronic
1027865506 7:83640852-83640874 GTAAAAACAGAAAGGGAGGAGGG + Intronic
1028495272 7:91454085-91454107 TTTAAATCAGAGAGGGAGAAAGG + Intergenic
1028943416 7:96551136-96551158 ATGAAAGGAGAGAGGGAAGAGGG + Intronic
1029694628 7:102204629-102204651 GGCTATGCAGAGAGGGAGGAGGG + Intronic
1031731729 7:125310062-125310084 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1032016027 7:128380948-128380970 CTCAGAGGAGACAGGGAGGAGGG - Intergenic
1032802491 7:135328158-135328180 CACAAGGAAGAGAGGGTGGATGG - Intergenic
1033170693 7:139081078-139081100 CTGGAAGCAGGGAGGAAGGAAGG + Intronic
1033492969 7:141862524-141862546 TTCAGAGCAGAGAGGGAGGCAGG + Intergenic
1033495123 7:141886479-141886501 TTCAGAGCAGAGTGGGAGGCAGG + Intergenic
1033585353 7:142770758-142770780 CTGAGAGCAGAGAGGGAGACCGG - Intergenic
1033643815 7:143286245-143286267 CTACAGGGAGAGAGGGAGGATGG - Intronic
1033759300 7:144422682-144422704 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1034419862 7:150984310-150984332 GTCAGAGGAGTGAGGGAGGAAGG - Intergenic
1034423300 7:151000306-151000328 CTCAGAGCAGAGAGGGACTTTGG - Intronic
1034580030 7:152034042-152034064 TTTAAATCAGAGAGGGAGAAAGG + Intronic
1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG + Intergenic
1034686048 7:152972398-152972420 CTGAGAGCATAGAGGCAGGAAGG + Intergenic
1034998089 7:155591053-155591075 CTCTCAGCAGAAAGGGAGGCTGG + Intergenic
1035178964 7:157075655-157075677 CTCCAAGCAGAGAGAGGGAAAGG - Intergenic
1035402857 7:158578690-158578712 CCTAAAGAAGGGAGGGAGGAAGG - Intronic
1036010544 8:4717075-4717097 CTCGGGGCAGAGAGGGAAGAAGG - Intronic
1036370166 8:8155708-8155730 TTCAAACTAGAGAGGGAGAAAGG + Intergenic
1036377434 8:8213075-8213097 CTAAAAGCAGAGACTGAGGCAGG + Intergenic
1036852120 8:12210073-12210095 CTAAAAGCAGAGACTGAGGCAGG - Intergenic
1036873487 8:12452595-12452617 CTAAAAGCAGAGACTGAGGCAGG - Intergenic
1036880726 8:12509923-12509945 TTCAAACTAGAGAGGGAGAAAGG - Intergenic
1036991977 8:13608324-13608346 GCCGAAGCAGAGAGGGAAGACGG - Intergenic
1036992999 8:13620429-13620451 CTAAAAGCAGAAAGTGAGCAAGG + Intergenic
1037586552 8:20280672-20280694 AGCAGAGCAGGGAGGGAGGAAGG + Intronic
1037776502 8:21839037-21839059 CCCAGAGCAAGGAGGGAGGATGG + Intergenic
1038229998 8:25690945-25690967 CTCACAGAGGAGAGGGATGATGG - Intergenic
1038270262 8:26069208-26069230 GTCAATGTAGAGAGTGAGGAGGG + Intergenic
1038302234 8:26363151-26363173 CTCAAAGTAGGAAGGGAGGATGG - Intronic
1038367630 8:26952824-26952846 CTCCAAGCAGAGAAGGATCAGGG - Intergenic
1038430838 8:27498162-27498184 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1038450169 8:27634386-27634408 AGCAAAGAGGAGAGGGAGGATGG + Intronic
1038462333 8:27727780-27727802 CTCAAAGCAGAGAGCAAGAAGGG + Intergenic
1038638734 8:29307219-29307241 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1039104953 8:33980219-33980241 TTCAAGGGAGAGGGGGAGGAAGG + Intergenic
1039693229 8:39883255-39883277 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1039737832 8:40351304-40351326 CCAAAAGCAGTGAGGGAGGGAGG - Intergenic
1040020861 8:42739658-42739680 CTCAAAGCAGGGGGGTTGGAGGG + Intergenic
1040667926 8:49654764-49654786 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1040971515 8:53141315-53141337 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1041223951 8:55679864-55679886 TTCACAGCAGAGAGAAAGGAGGG + Intergenic
1041549450 8:59083146-59083168 CTAAAATTAGAAAGGGAGGAAGG + Intronic
1041906401 8:63038418-63038440 CTTAAAGGTGGGAGGGAGGAGGG - Intronic
1042175187 8:66031694-66031716 CTCAAAGCAGTAAGGCAGGAGGG + Intronic
1042514470 8:69644976-69644998 CTCAAACAAGAGATGGAGCAGGG + Intronic
1042526940 8:69773441-69773463 GCAAAAGCAGAGAGGGAAGAGGG - Intronic
1042842780 8:73140949-73140971 CTCAAACGAGAGAGGGAAGAGGG - Intergenic
1042919558 8:73908254-73908276 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1043192055 8:77237774-77237796 TGCAAAGTAGTGAGGGAGGATGG - Intergenic
1043257001 8:78149853-78149875 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1043378494 8:79677037-79677059 CTCTAACCAAAGAGGGAGGGAGG + Intergenic
1044230823 8:89775805-89775827 CTCAAAGGAAACATGGAGGATGG + Intronic
1044822370 8:96162925-96162947 TTTAAAGCACAGAGAGAGGAAGG - Intergenic
1045351731 8:101347250-101347272 CTGAGAGGAGAAAGGGAGGAAGG + Intergenic
1045557006 8:103224409-103224431 CTCAAAGCAGAGTGGGCGGGTGG + Intronic
1045858494 8:106790798-106790820 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1047207935 8:122818484-122818506 AACTAGGCAGAGAGGGAGGAGGG - Intronic
1048579702 8:135720715-135720737 CTCACAGCAGAGCAGGAGCAGGG - Intergenic
1048920022 8:139219672-139219694 CTGAATGAAGAGAGGGAGGGAGG - Intergenic
1049046288 8:140154563-140154585 CTCAAAGCAGAGGTGGCAGAGGG - Intronic
1049398538 8:142413098-142413120 CTCAATGGAGAGATGGAGGCTGG - Intergenic
1049399145 8:142417095-142417117 CTCAAAGCAAAAATAGAGGACGG - Intergenic
1049554112 8:143273807-143273829 CCCACAGCAGAGAGGGTGGCTGG - Intronic
1049561873 8:143316169-143316191 CTCAGGGCAGACAGGGAGGGTGG - Intronic
1049595540 8:143481638-143481660 CTGAAGGCAGACAGGGACGATGG + Intronic
1050301550 9:4263921-4263943 CCCAAAGGAGGGAGTGAGGATGG - Intronic
1050487452 9:6149128-6149150 CTAGAAGCAAAGAGGGATGATGG + Intergenic
1050599627 9:7237294-7237316 CTCAAAAAAGCAAGGGAGGAAGG + Intergenic
1052067517 9:24040566-24040588 CACAGAGCAAAGAGGGAAGATGG - Intergenic
1052231047 9:26153365-26153387 AGGAAAGAAGAGAGGGAGGAAGG + Intergenic
1052345696 9:27407567-27407589 CTCCAAGAAGAGAGGAAGGAAGG - Intronic
1052901055 9:33795342-33795364 CTGAGAGCAGAGAGGGAGACTGG - Intronic
1053280487 9:36817316-36817338 AGAAAAGAAGAGAGGGAGGAAGG + Intergenic
1053449665 9:38182431-38182453 CTCATGGCAGAAGGGGAGGAAGG + Intergenic
1053694853 9:40627809-40627831 CTCATAGCTGAGAGTGAGGGTGG - Intergenic
1054269988 9:63012310-63012332 CTCATAGCTGAGAGTGAGGGTGG + Intergenic
1054306097 9:63427033-63427055 CTCATAGCTGAGAGTGAGGGTGG - Intergenic
1054404839 9:64751012-64751034 CTCATAGCTGAGAGTGAGGGTGG - Intergenic
1054438463 9:65236504-65236526 CTCATAGCTGAGAGTGAGGGTGG - Intergenic
1054491941 9:65785444-65785466 CTCATAGCTGAGAGTGAGGGTGG + Intergenic
1054964670 9:71009250-71009272 CTCAAAACAGAAAGGAAGAAGGG + Intronic
1055323088 9:75100993-75101015 CTCAAATTAGGGATGGAGGAAGG - Intronic
1055432767 9:76260698-76260720 CTAAAAGCAGAGTGGCAGCAGGG - Intronic
1055700265 9:78937257-78937279 CACAAAGCAGAGAGTAAGCATGG - Intergenic
1056062184 9:82895018-82895040 CTAAAAGCAGAGAGGCTGCAAGG - Intergenic
1056232185 9:84558011-84558033 CTCAAACCAGAAGGAGAGGATGG + Intergenic
1056234791 9:84584051-84584073 CACAAAGCAAAGAATGAGGAAGG - Intergenic
1056392840 9:86155035-86155057 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1056490904 9:87105984-87106006 ATGAAAGAAAAGAGGGAGGAAGG + Intergenic
1056684527 9:88748639-88748661 CTGAAGGCAAAGAGGGAGGCTGG + Intergenic
1056720453 9:89066829-89066851 CTCCAAGGAGAGAGAGATGAGGG + Intronic
1057255937 9:93547077-93547099 CTGATAGCAGAGACGGGGGATGG + Intronic
1057302298 9:93893962-93893984 CTCCCAGCAGAGCGGGAGGGAGG - Intergenic
1057540902 9:95969032-95969054 TTCAAAGAGGTGAGGGAGGAAGG + Intronic
1057542793 9:95990927-95990949 CTCTCAGCAGAAAGGGAGGCTGG + Intronic
1057867483 9:98692964-98692986 CTCAAAGAAGAGATGGGGGTAGG + Intronic
1057930021 9:99185141-99185163 CTCAAGGGCGAGAGGGAGGCAGG + Intergenic
1057971342 9:99561238-99561260 ATCAAAGTAAAGAGGTAGGAGGG + Intergenic
1058187248 9:101869487-101869509 CTAGAAGCAGAGACTGAGGAGGG - Intergenic
1058939151 9:109797277-109797299 TTCAGAGGAGAGAGGGAGGTTGG + Intronic
1059103067 9:111488065-111488087 CTCAAAAAAGAAAGGAAGGAAGG + Intergenic
1059254955 9:112921446-112921468 TTCAAAGCATAAATGGAGGATGG + Intergenic
1059466476 9:114471862-114471884 CCCAAAGCAGAGTGGGTGAAGGG - Intronic
1059592494 9:115677256-115677278 CTAAAAGCAAAGAGGGATCATGG - Intergenic
1059770935 9:117424886-117424908 GTTAAAGCAGAGAGAAAGGAAGG - Intergenic
1059876245 9:118638316-118638338 ATTAGAGGAGAGAGGGAGGAAGG - Intergenic
1059989099 9:119847833-119847855 CTCAGAGCAAATAGGGAAGATGG - Intergenic
1060150275 9:121284039-121284061 CTGAAAGAAGTGAGGGAGGCTGG + Intronic
1060936180 9:127517476-127517498 GGCAAAGCAGGGAGGGAGTATGG - Intronic
1061024939 9:128042422-128042444 CTGGAACCAGAGAGGTAGGAAGG + Intergenic
1061077008 9:128347917-128347939 CTGAAAGGGGAGAGGGAAGAAGG + Intronic
1061736682 9:132665550-132665572 CTCTGAGCAGAGAGGGAGCAAGG + Intronic
1061798194 9:133100654-133100676 CTCAAGGAAGTGTGGGAGGAGGG - Intronic
1061969828 9:134038938-134038960 CAAAAAGGAGAGAGGGAGGGAGG + Intronic
1062597322 9:137305129-137305151 CGCTAAGCAGGGAGGGAGGGTGG + Intergenic
1202777298 9_KI270717v1_random:1415-1437 CTCATAGCTGAGAGTGAGGGTGG - Intergenic
1186239001 X:7546463-7546485 CTCTCAGCAGAGAGGGAAGCTGG - Intergenic
1186404681 X:9291516-9291538 TTCAAAGAAGGGAGGGAGGAGGG + Intergenic
1186536198 X:10351223-10351245 CCCCAAGCAGAGAGGGAGTATGG - Intergenic
1187127672 X:16469301-16469323 ACCCAAGCAGAGGGGGAGGAGGG + Intergenic
1187200839 X:17132349-17132371 CTGAAGGCAGAGAGGGAGAGGGG + Intronic
1187384304 X:18833349-18833371 CTCTCAGCAGAAAGGGAGGCTGG - Intergenic
1187447639 X:19373047-19373069 CTCCCAGGAGACAGGGAGGAGGG + Intronic
1187478480 X:19633159-19633181 GACAGAGAAGAGAGGGAGGAAGG + Intronic
1188005842 X:25015346-25015368 CTGGAAGCAGGGAGGGAGGGAGG + Intronic
1188097460 X:26042353-26042375 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1188136463 X:26499710-26499732 TTTAAATCAGAGAGGGAGAATGG - Intergenic
1188911304 X:35851269-35851291 CTCACAGAAGAGAGGGAAGTGGG + Intergenic
1189271138 X:39752765-39752787 ATGAAAGGAGGGAGGGAGGAAGG + Intergenic
1189657269 X:43258135-43258157 CCAAAAGCAGGGAGGGATGAGGG - Intergenic
1190115181 X:47621717-47621739 CTCTAAGGAGAGGGGTAGGAAGG + Intergenic
1190491886 X:50990624-50990646 CTGAGGGCAGAGAGGGAGGCAGG - Intergenic
1190501276 X:51081056-51081078 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1190579696 X:51880403-51880425 CCCAAAGCAGAGAGTGAGAGGGG + Intronic
1191205999 X:57834773-57834795 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1191611144 X:63114805-63114827 CTCCAAGCATAGAGAGATGAAGG + Intergenic
1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG + Intronic
1191865998 X:65704365-65704387 CACAGAGCAGAGAAAGAGGAAGG - Intronic
1191979089 X:66905930-66905952 GTCAAAGCAGAGAGGGACTTTGG - Intergenic
1192181737 X:68920505-68920527 GTTGAAGGAGAGAGGGAGGAAGG - Intergenic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1192482823 X:71499954-71499976 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1192870074 X:75176513-75176535 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1193451309 X:81671497-81671519 CTCAAGGAAGAGTGGGAGGGTGG - Intergenic
1193709663 X:84863520-84863542 CTCAAAGCAGTAGGGGCGGAGGG + Intergenic
1194440360 X:93925385-93925407 CTCACAGAAGAAAGGAAGGAAGG + Intergenic
1195144749 X:102001799-102001821 CTAAAAGCAGTCAGGGAGAAGGG + Intergenic
1195439509 X:104884992-104885014 TTTAAATCAGAGAGGGAGAAGGG - Intronic
1195552445 X:106184777-106184799 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1196419446 X:115507386-115507408 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1196488929 X:116245740-116245762 TTTAAATCAGAGAGGGAGAAAGG - Intergenic
1196662003 X:118279681-118279703 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1196722155 X:118864517-118864539 CTCAAAGCAAAGAAGCAGCAAGG + Intergenic
1196799652 X:119531207-119531229 CTCAAAACAGAGAGAAAGGGAGG - Intergenic
1196974183 X:121140665-121140687 CTTGAAGCAGGGAGGGAGGCTGG + Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198151040 X:133910090-133910112 CTCAGAGAAGAGATGAAGGATGG - Intronic
1198832761 X:140768302-140768324 ATCAAAGGAGAAAGGGAGTAAGG - Intergenic
1199353525 X:146833039-146833061 GTCAAAGGAGAAATGGAGGAAGG - Intergenic
1199738202 X:150705266-150705288 CCCAAAGGAGAGAGAGGGGATGG + Intronic
1199832468 X:151559975-151559997 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1199886627 X:152027326-152027348 CTCAGAACAGAGATAGAGGAGGG + Intergenic
1199987319 X:152962116-152962138 GACAAAGAAGATAGGGAGGAGGG + Intronic
1200801078 Y:7387632-7387654 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1200966714 Y:9045524-9045546 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1201192652 Y:11459762-11459784 CTCATAGCTGAGAGTGAGGATGG - Intergenic
1201194323 Y:11476740-11476762 CTTAAAATAGGGAGGGAGGAAGG + Intergenic
1201271981 Y:12264455-12264477 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1201429634 Y:13891189-13891211 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1201461495 Y:14230517-14230539 AAGAAAGGAGAGAGGGAGGAAGG + Intergenic
1201472064 Y:14344477-14344499 CTCTAAGCACAGAGGGATGGGGG + Intergenic
1201496458 Y:14595160-14595182 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1201547055 Y:15177196-15177218 GTGAAAGGAGAGAGGGAGGCAGG - Intergenic
1201989566 Y:20009245-20009267 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1202074752 Y:21026860-21026882 TTTAAATCAGAGAGGGAGAAAGG + Intergenic
1202089923 Y:21178780-21178802 CTTAAATCAGAGAGGGAGAAGGG + Intergenic
1202146745 Y:21806652-21806674 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1202192667 Y:22260621-22260643 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1202257769 Y:22939248-22939270 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1202272116 Y:23082688-23082710 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1202293910 Y:23337994-23338016 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1202410759 Y:24572995-24573017 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1202425113 Y:24716432-24716454 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1202445676 Y:24953653-24953675 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1202460022 Y:25097077-25097099 TTTAAATCAGAGAGGGAGAAGGG + Intergenic