ID: 1124654605

View in Genome Browser
Species Human (GRCh38)
Location 15:31498201-31498223
Sequence GGTGCCCAGTTACACAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124654605_1124654614 27 Left 1124654605 15:31498201-31498223 CCCTCTCTGTGTAACTGGGCACC 0: 1
1: 0
2: 0
3: 17
4: 211
Right 1124654614 15:31498251-31498273 CTTCATTGAGTTTTGCAGTATGG 0: 1
1: 0
2: 2
3: 21
4: 183
1124654605_1124654609 -5 Left 1124654605 15:31498201-31498223 CCCTCTCTGTGTAACTGGGCACC 0: 1
1: 0
2: 0
3: 17
4: 211
Right 1124654609 15:31498219-31498241 GCACCCCACATATGGGTGCCAGG 0: 1
1: 0
2: 1
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124654605 Original CRISPR GGTGCCCAGTTACACAGAGA GGG (reversed) Intronic
900605086 1:3520284-3520306 GCAGCCCAGGTACACAGAGGCGG + Intronic
901201736 1:7471076-7471098 GGTGCCAAGATTTACAGAGAAGG + Intronic
901787068 1:11631796-11631818 GGGGCCCAGTAACACTGAGTAGG + Intergenic
902480880 1:16710921-16710943 GGTGCCCAGCCAGCCAGAGAAGG + Intergenic
902744386 1:18463721-18463743 TGTGTCCAGCTACACAGAAAAGG - Intergenic
903619584 1:24688214-24688236 GGTGACTGGTGACACAGAGAGGG + Intergenic
904004793 1:27358090-27358112 GGTGCCCAGGTCCCCAGGGAGGG + Intronic
905212504 1:36384559-36384581 TGTGCCCAGGTACACACAGCTGG + Intronic
905303169 1:36999262-36999284 GGTGCCCAGGTGCACCGAGGTGG + Intronic
906773513 1:48507046-48507068 GGTGCCCACCCACACTGAGAAGG - Intergenic
907998279 1:59654972-59654994 AGTGCCCAGGGACACAGAGTGGG - Intronic
908767611 1:67568691-67568713 GGTGGCCATTTACAAAGAGGAGG + Intergenic
911487292 1:98517209-98517231 GGTGCCCAGTAATGCAGATATGG + Intergenic
911814294 1:102325081-102325103 GGTTCCAAGTTATAAAGAGAGGG + Intergenic
912220536 1:107669270-107669292 TGTCCCCACTTACACAGCGAAGG - Intronic
912578678 1:110700502-110700524 GGTGACCAGTCACAGAAAGATGG + Intergenic
913216437 1:116624684-116624706 CCTGCCCAGATACACAGAGAAGG - Intronic
916282487 1:163067626-163067648 GGTGCCCAGGTAAACAAAGAAGG + Intergenic
916312314 1:163410763-163410785 GGTGCCCCTTTATGCAGAGAAGG + Intergenic
917220334 1:172721833-172721855 TGTAACCAGATACACAGAGAAGG + Intergenic
917476393 1:175372886-175372908 GGTGCCTACCTTCACAGAGAGGG + Intronic
918011699 1:180592860-180592882 GGTGACTTGTTACACAGTGATGG + Intergenic
922305562 1:224341065-224341087 GGTGCCGCGCTCCACAGAGACGG - Intergenic
1062825189 10:562163-562185 GGTTCCCAGTTACAGGCAGAGGG + Intronic
1062984296 10:1753218-1753240 GCAGCCCAGTTGCACAGACAGGG - Intergenic
1064864348 10:19862286-19862308 TGTGCCCAGTTCCTCAGATACGG + Intronic
1068804825 10:61183641-61183663 GGGGCTCAGTTACATAGATATGG + Intergenic
1072977793 10:100074366-100074388 GGTGACCAGCTTCCCAGAGATGG + Intronic
1073144961 10:101274469-101274491 GGTGCCCACTTTCAGAGAGGAGG + Intergenic
1076139702 10:128069284-128069306 TTTGCCCAGTTTGACAGAGAGGG + Intronic
1076904860 10:133356699-133356721 GGTGCCCAGCGACAAGGAGAGGG - Exonic
1077270906 11:1679988-1680010 GGTCCTGAGTTACACTGAGAAGG - Intergenic
1077683562 11:4269651-4269673 GGGGCAGAGTCACACAGAGAGGG - Intergenic
1077686478 11:4297112-4297134 GGGGCAGAGTCACACAGAGAGGG + Intergenic
1077691632 11:4348300-4348322 GGGGCAGAGTCACACAGAGAGGG + Intergenic
1079244285 11:18741667-18741689 GGTACCCAGGTACATAAAGATGG + Intronic
1083488603 11:62998819-62998841 GGTGCCCGGGGACACAGAGTTGG + Intronic
1084117566 11:67050877-67050899 GGTGCACAGTAACACATAGGAGG - Intergenic
1085309869 11:75509977-75509999 GCTGCCCATTTTCACATAGATGG + Intronic
1087078227 11:94145258-94145280 GCTGCCAAGTTACACATATAAGG - Intronic
1088354863 11:108932323-108932345 GGTTCCCATTTTCAAAGAGAAGG - Intronic
1092051249 12:5472093-5472115 GGAGCCTAATTACACAGAGATGG - Intronic
1096905993 12:54936044-54936066 CCTGCCCAGTTGCAAAGAGACGG - Intergenic
1097620906 12:61938420-61938442 GTCACCCAGGTACACAGAGAGGG + Intronic
1099501156 12:83415521-83415543 GGTGCCCAGGGACTCAGAGTAGG + Intergenic
1099641270 12:85288605-85288627 AGTGCCCAGATATACAGTGAGGG - Intronic
1100022032 12:90080950-90080972 GGTACACAGGGACACAGAGATGG + Intergenic
1100360662 12:93877010-93877032 GGTGCCCAGTGAAGCAGATATGG - Intronic
1100798041 12:98202508-98202530 GGTGCTCTGTCCCACAGAGATGG - Intergenic
1100892144 12:99137535-99137557 CATTCTCAGTTACACAGAGAGGG + Intronic
1101508133 12:105366665-105366687 GGTGTCCAGTCAAACAAAGACGG + Exonic
1101739199 12:107487149-107487171 GATGCTCAGACACACAGAGAAGG + Intronic
1102645245 12:114399604-114399626 GTTTCCCAGTTACAAAGTGAAGG - Exonic
1103007239 12:117431174-117431196 GGACCCCAGTTACAGACAGATGG + Intronic
1104687836 12:130800504-130800526 TCTGCCCAGTAACACAGATAGGG - Intronic
1106926373 13:34617499-34617521 GGTCTACAGTGACACAGAGAAGG + Intergenic
1107056797 13:36114260-36114282 GTTCTCCAGTTACACTGAGAAGG + Intronic
1107432264 13:40350920-40350942 GAAACCCAGTTGCACAGAGAAGG + Intergenic
1109395607 13:61754568-61754590 GGTACCCAGGGACACAAAGACGG - Intergenic
1109932057 13:69228790-69228812 GGTGCACATGGACACAGAGATGG - Intergenic
1118246321 14:64114582-64114604 GGTGCCGAGATGCACAGAAAAGG - Intronic
1118261082 14:64247105-64247127 GTTGCCCATTTACAAAGAGATGG + Intronic
1119439890 14:74621141-74621163 GCTAGTCAGTTACACAGAGAAGG + Intergenic
1119651830 14:76389392-76389414 TGTCCCCAGTGACACAGAGTGGG + Intronic
1120863128 14:89272992-89273014 GGTGCAGAGTTTCACAAAGAAGG - Intronic
1123836775 15:24202863-24202885 GGTGACCAGTTACAGAAACAAGG - Intergenic
1123845993 15:24302639-24302661 GGTGACCAGTTACAGAAACAAGG - Intergenic
1123865029 15:24510342-24510364 GGTGACCAGTTACAGAAACAAGG - Intergenic
1124654605 15:31498201-31498223 GGTGCCCAGTTACACAGAGAGGG - Intronic
1124856571 15:33395133-33395155 TGTGCTCAGTTACACAAAGATGG + Intronic
1128559194 15:68653455-68653477 GGTGCCCATCTACTCTGAGATGG + Intronic
1132637250 16:957284-957306 CATGCACAGTTACACAGACATGG - Intronic
1132750649 16:1455913-1455935 GGGCCCCAGCCACACAGAGAGGG + Intronic
1133133973 16:3696429-3696451 GGTGCACACTTAAACAGAGGAGG + Intronic
1133428080 16:5710752-5710774 GGTCCCCAGGGACACAGAGCCGG - Intergenic
1134609815 16:15599004-15599026 AGGGCCCAGTCACACAGAGCAGG - Exonic
1136909727 16:34135524-34135546 CCTGCCCAGGTACTCAGAGATGG - Intergenic
1142519770 17:496807-496829 GCTCCCTAGTTACACAGAAAAGG + Intergenic
1144094942 17:11891868-11891890 GGTGTACTGGTACACAGAGAAGG - Exonic
1144196676 17:12901467-12901489 AGAGGCCAGTTACACAGAGATGG + Intronic
1144205971 17:12979828-12979850 AGTGCCAAGTGCCACAGAGATGG + Intronic
1145019488 17:19418294-19418316 GGGGCCCAGAGACTCAGAGAGGG + Intergenic
1146619878 17:34389050-34389072 GGTGGCCAGTGACAGGGAGAGGG + Intergenic
1146623255 17:34416610-34416632 GCTGCCCAGTCACTCAGAGCTGG - Intergenic
1147135227 17:38430199-38430221 GGTGTCCCATTTCACAGAGAGGG + Intronic
1148895923 17:50839077-50839099 GATGCCCAAGTTCACAGAGACGG - Intronic
1151575032 17:74948912-74948934 GGTGCCCAGCTTGACAGAGCAGG + Intronic
1153512508 18:5870759-5870781 GGTGGTCAGTTCCAAAGAGAAGG + Intergenic
1155665146 18:28299142-28299164 GGTGCTCAGTCCCAGAGAGATGG + Intergenic
1158868483 18:61661129-61661151 TATACCCAGTGACACAGAGAAGG + Intergenic
1159954048 18:74507145-74507167 GGCGCCCAAGTGCACAGAGAGGG - Intronic
1160530026 18:79557305-79557327 GGCGCCCAGGTCTACAGAGAGGG + Intergenic
1161577177 19:5060762-5060784 GGTGCCCAGTGACACAGCGGCGG - Intronic
1162270757 19:9613174-9613196 GGTGACAAGTTATACAGATATGG + Intronic
1162531473 19:11238582-11238604 GGGGCACAGTGACACACAGAAGG + Intronic
1163222882 19:15934595-15934617 GGCCTCCAGTTACACAGAAAGGG + Exonic
1163606813 19:18280302-18280324 TGTGCCCAGGAACTCAGAGAGGG - Exonic
1165717081 19:38053166-38053188 GGTGCCCAGATACACAAACAGGG + Intronic
1166334082 19:42095125-42095147 TGGGCACAGTTACACAGGGACGG - Intronic
1167190394 19:47984699-47984721 GGTGCACAGGGACACAAAGATGG + Intronic
1167293363 19:48636195-48636217 GGTGGACAGATTCACAGAGATGG + Intronic
1167369158 19:49070657-49070679 GGTGCCCAGTGCCACAAAGTAGG + Exonic
1168363427 19:55762939-55762961 AGTCCCCAGTTGCACAGAGTGGG + Exonic
1168364382 19:55772943-55772965 AGTCCCCAGTTGCACAGAGTGGG + Exonic
925930519 2:8703671-8703693 TGTACCCAGTTACAGGGAGAAGG + Intergenic
927889858 2:26741566-26741588 AGTGCCAAGTGAGACAGAGAGGG + Intergenic
929290791 2:40188791-40188813 TGTGGCCAGGGACACAGAGAGGG - Intronic
931005914 2:57850036-57850058 GGTGCCCAGGTCCACAGCCATGG + Intergenic
931772172 2:65506925-65506947 GTTGCCCAGTTGCACAGAATTGG + Intergenic
932396175 2:71450109-71450131 ACTGCCCAGTGACACAGAGTGGG + Intergenic
933783915 2:85823005-85823027 GGTGCCCAGCCACAGAGAGAGGG - Intergenic
935729285 2:106051762-106051784 GCTCCCCAGTTGCACACAGAAGG + Intergenic
936578724 2:113676905-113676927 GGTGCGCTGTTACTCAAAGAAGG + Intergenic
938065105 2:128277604-128277626 GCTGCCCTGTTACCCACAGAGGG - Intronic
939411674 2:141834689-141834711 AGTGTCCAGTTTCACAGAGTGGG + Intronic
939778636 2:146416917-146416939 GCTGCCCAGTTACCTAGACATGG + Intergenic
941417993 2:165245648-165245670 GGAGCCTAGTTATACAGACAGGG + Intronic
942610854 2:177741273-177741295 GGTGCACATGTACAGAGAGAAGG - Intronic
943245262 2:185440150-185440172 AGTAGCCAGTTACACTGAGATGG - Intergenic
945796175 2:214366956-214366978 GAAGCCCAATTACACAGAGGTGG + Intronic
945984212 2:216341061-216341083 GGGGCCCAGCCACTCAGAGAGGG - Intronic
946670129 2:222094204-222094226 GGTTAGCAGTTACACAGACAAGG - Intergenic
948587120 2:239026486-239026508 GGGTCCCAGCGACACAGAGAGGG + Intergenic
948587136 2:239026537-239026559 GGGTCCCAGCGACACAGAGAGGG + Intergenic
1171505484 20:25629678-25629700 AGTGCCCATTTGGACAGAGATGG + Intergenic
1173002200 20:39112342-39112364 GCTGCCCAGCTACAGAGATAAGG - Intergenic
1173505605 20:43584776-43584798 GGAGCCCAGATCCTCAGAGAGGG - Intronic
1174725695 20:52859549-52859571 TGTGCCCTGTTACAGAGAGACGG - Intergenic
1175970970 20:62686770-62686792 AGTGCCCAGCACCACAGAGAAGG + Intergenic
1176422309 21:6526026-6526048 TGTAACCAGTTACAGAGAGAAGG - Intergenic
1178418552 21:32424689-32424711 CGTGACCAGTTCCACAGAGCGGG - Intronic
1178904659 21:36626685-36626707 GCTGTGCAGTTACACAAAGATGG - Intergenic
1179126458 21:38595378-38595400 GGTGGCCAATTAAGCAGAGAAGG + Intronic
1179697800 21:43134342-43134364 TGTAACCAGTTACAGAGAGAAGG - Intergenic
1181638101 22:24183587-24183609 GTTGTCCAGTGACACAGTGAAGG - Exonic
950479357 3:13235181-13235203 GCTGCCCCGTCTCACAGAGAGGG + Intergenic
952435808 3:33271386-33271408 GGTGCCCAGAGAAAGAGAGAGGG - Intergenic
952780750 3:37095064-37095086 GGTATCCAGGTATACAGAGAAGG + Intronic
952821174 3:37487284-37487306 TATGGCCAGTTAAACAGAGAGGG + Intronic
953216139 3:40920756-40920778 TGTGCCCAGTTTCCCAGAAATGG + Intergenic
954365719 3:50145099-50145121 GGGGCCCAGTTCTCCAGAGAGGG - Intergenic
961708036 3:128804671-128804693 GGAACTCAGATACACAGAGAAGG - Intronic
962055436 3:131866408-131866430 TGTGCCCAGTTCCAGAGAGGAGG + Intronic
962400583 3:135055874-135055896 GGTGCACAGATACAGAGAGTAGG - Intronic
965812677 3:172607852-172607874 GGGGCCCACTTACACTGGGAGGG - Intergenic
968595328 4:1479320-1479342 GGTGCCCATTTAGAAAAAGAAGG + Intergenic
969130636 4:4988855-4988877 TGTGCCCAGTAACACAGACTCGG - Intergenic
969365776 4:6693592-6693614 CGTGCCCACTTACCCAGGGAGGG + Exonic
969496080 4:7527082-7527104 GGTCCCCAGGGCCACAGAGAGGG - Intronic
972030383 4:34449795-34449817 TGTAACCAGTTACAGAGAGAAGG - Intergenic
972030611 4:34452562-34452584 TGTAACCAGTTACAGAGAGAAGG - Intergenic
973759047 4:54100527-54100549 GGTGCGAAGTGACGCAGAGAGGG - Exonic
976708438 4:88042891-88042913 TGAGCACAGTTACCCAGAGAAGG + Intronic
981195454 4:141914895-141914917 GCTGCCCAGATTGACAGAGATGG + Intergenic
982515590 4:156344416-156344438 TGTGCCCAGGTACACATAGGAGG - Intergenic
984231516 4:177106075-177106097 GGTGCCAAGTTTCAGTGAGATGG + Intergenic
989299272 5:39869715-39869737 GGTGCTCAGTTACATAAAGATGG - Intergenic
989347039 5:40440616-40440638 GGAGCCCAGGTAAACAGAAAAGG - Intergenic
994639253 5:102386242-102386264 GGTGCCAAGGTCCACTGAGATGG + Intronic
996082304 5:119269225-119269247 GGAACCCAGTTACAAAGGGAGGG - Intronic
997388380 5:133493507-133493529 AGTCCCCATTTTCACAGAGAGGG + Intronic
998416743 5:141951731-141951753 GGTGCCCAGTGACAGAGACAGGG + Intronic
999377878 5:151099432-151099454 GGAGCCCTGTTTTACAGAGAAGG + Intergenic
999783015 5:154866116-154866138 GATGCCCAGTTAAACAAAGCAGG - Intronic
999916920 5:156272912-156272934 GTTGCATAGTTACAAAGAGATGG + Intronic
1000905950 5:166966026-166966048 GTTGTCCAGCTGCACAGAGAAGG + Intergenic
1001220285 5:169894784-169894806 GGCCCCAGGTTACACAGAGACGG + Intronic
1001755751 5:174167221-174167243 GGGGCACAGTTACTCAGAGCTGG + Intronic
1002074385 5:176699433-176699455 ACTGCCCAGGTACACAGTGAAGG - Intergenic
1002075341 5:176705200-176705222 GGTGTCCAGAGACACAGTGAGGG + Intergenic
1004029057 6:11848045-11848067 GGAGCCCAGTGACGCACAGAGGG - Intergenic
1005298150 6:24446523-24446545 GGGGCACAGACACACAGAGAGGG + Intronic
1005348031 6:24909611-24909633 GATGCCCAGTCCCATAGAGATGG + Intronic
1006374621 6:33665039-33665061 GGTGCCCAGCTGCAGAGACAGGG - Exonic
1006700317 6:35967507-35967529 GGTGCTCAGTTTCACACAAAGGG + Intronic
1006800831 6:36758736-36758758 GGTGACCAGGTAGACACAGAAGG + Intronic
1007785217 6:44275975-44275997 GGTGCCCAGCTACTCTGAGGCGG + Exonic
1009378191 6:62997723-62997745 TGTAACCAGTTACAGAGAGAAGG + Intergenic
1011436381 6:87342498-87342520 TGTGCACATTTACACATAGAAGG - Intronic
1013267222 6:108511955-108511977 GATGACCTGTTAGACAGAGAAGG + Intronic
1013620046 6:111879278-111879300 GGTGCCCAGTCAGACATAGTAGG - Intergenic
1014216492 6:118756962-118756984 AGGACACAGTTACACAGAGAGGG - Intergenic
1014383762 6:120776755-120776777 GGTGCCCATTGACATAAAGATGG - Intergenic
1015074210 6:129134991-129135013 GGTGCCCAGGTCCCCTGAGAAGG - Intronic
1015193050 6:130492992-130493014 GGTGCACAGAGACACAAAGATGG - Intergenic
1015471905 6:133615120-133615142 GGTGCTCTGTTACAGGGAGATGG - Intergenic
1018450320 6:163901466-163901488 GGTGCCCACTCACACTGAGAGGG + Intergenic
1018866660 6:167751742-167751764 GGTGCCCAGATCCAGGGAGATGG + Intergenic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1019428137 7:986940-986962 GATGCCCCGTTTCACAGACAAGG - Intronic
1019951492 7:4376703-4376725 GGTGTCCAGTCACAAAGGGATGG + Intergenic
1023835392 7:44064638-44064660 GTGTCCCAGTTACACAGAAATGG + Intronic
1024539486 7:50464383-50464405 TGTGCCCAGGTAGACAGTGATGG + Intronic
1025270654 7:57509983-57510005 TGTAACCAGTTACAGAGAGAAGG + Intergenic
1025605688 7:63038449-63038471 ACTGCCCATTAACACAGAGAGGG + Intergenic
1029543893 7:101200371-101200393 GGGGCCCAGGTAGCCAGAGATGG - Intronic
1029660955 7:101961207-101961229 GCTGCCCAGGGACACACAGATGG - Intronic
1029979284 7:104863014-104863036 AGAGCCCAGTTACACAGAGCTGG + Intronic
1030993827 7:116334289-116334311 AGTGGCCATTTACACAGAGAAGG + Intronic
1031353224 7:120760956-120760978 GTTGCCCAGTCCCATAGAGAAGG + Intergenic
1032561784 7:132900051-132900073 GGTGCCAAGTCAGGCAGAGAAGG - Intronic
1032893359 7:136223004-136223026 GGTGCTCTGTCCCACAGAGATGG - Intergenic
1035859935 8:3017208-3017230 GGAGCCCAGTTCCACTGGGAGGG - Intronic
1037306039 8:17504893-17504915 AGTTCCCTGATACACAGAGAAGG + Intronic
1041463726 8:58138579-58138601 GGTGCTCAGTTACACAATGGTGG - Intronic
1042029405 8:64459218-64459240 TGTGCCAGGTCACACAGAGATGG - Intergenic
1042414321 8:68501570-68501592 AGTCCCCAGTTGCACAGAGTGGG + Intronic
1043559109 8:81469772-81469794 TGTAACCAGTTACAGAGAGAAGG + Intergenic
1044803144 8:95977559-95977581 GATGCTGAGTTACAAAGAGATGG + Intergenic
1047865598 8:129020946-129020968 AGTGCCCACTCTCACAGAGAGGG - Intergenic
1048871580 8:138803604-138803626 GGGCCCCAGGTACACAGGGATGG - Intronic
1050367657 9:4887450-4887472 TGTAACCAGTTACAGAGAGAAGG - Intergenic
1053558055 9:39158855-39158877 GGTGCAGAGACACACAGAGAGGG - Intronic
1053822175 9:41979141-41979163 GGTGCAGAGACACACAGAGAGGG - Intronic
1054139059 9:61460097-61460119 GGTGCAGAGACACACAGAGAGGG + Intergenic
1054608399 9:67208272-67208294 GGTGCAGAGACACACAGAGAAGG + Intergenic
1056464541 9:86840715-86840737 GGTTCCCAGTTTTACAGAGGAGG - Intergenic
1058057886 9:100467643-100467665 GGTCCTCAGTTACATAGACAAGG - Intronic
1060400712 9:123348039-123348061 GGTGCTCAGCCGCACAGAGAAGG + Intergenic
1187704761 X:21998857-21998879 TGTGCAAAGTTGCACAGAGAAGG - Intergenic
1193698207 X:84735189-84735211 TGTCCACAGTTACACAGATAAGG + Intergenic
1194155831 X:90387578-90387600 AGTGCTCAGTTACATAGAGATGG + Intergenic
1197855739 X:130912034-130912056 GGTGCAGAGTGACACAGGGAAGG + Intergenic
1197982313 X:132229697-132229719 GGTGCAATGTTACACAGAGTAGG - Intergenic
1198672710 X:139098682-139098704 GGTACGCAGAAACACAGAGATGG + Intronic
1199448220 X:147951698-147951720 GATGCCCAGTTAGACAGAATGGG - Intergenic
1200502179 Y:3964532-3964554 AGTGCTCAGTTACATAGAGATGG + Intergenic
1201498642 Y:14617714-14617736 GGTGCTCTGTTTCAGAGAGATGG + Intronic
1201668117 Y:16482657-16482679 GGTGAGCAGTGAGACAGAGATGG - Intergenic