ID: 1124655928

View in Genome Browser
Species Human (GRCh38)
Location 15:31507288-31507310
Sequence CAGGGTTATATTGAGAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124655928 Original CRISPR CAGGGTTATATTGAGAAGGT TGG Intronic
903777623 1:25802970-25802992 CAGGGGTGTATTGTGTAGGTTGG + Intronic
904123183 1:28216778-28216800 CAGGCTTTTTTTGTGAAGGTGGG + Intronic
906131917 1:43465302-43465324 CAGGGTAAGACTGGGAAGGTGGG - Intergenic
907784115 1:57595358-57595380 CAGGGTTAGATTGAGAGATTTGG - Intronic
909220448 1:72953234-72953256 CATGGTTATATTGAGTATATAGG + Intergenic
910587276 1:88893403-88893425 CACTGTTTTCTTGAGAAGGTGGG + Intergenic
915257205 1:154643025-154643047 CAGGGTTATATTGCCCAGGCTGG + Intergenic
916651961 1:166840970-166840992 CAGGCTCAAATTGAGAGGGTAGG - Exonic
917863766 1:179173943-179173965 CAGGGTTTTCTTGAGAAGGTAGG - Intronic
920422145 1:205842189-205842211 CAGGATTATATTGACAGGGAAGG + Exonic
1063811454 10:9713549-9713571 GAGGGCTATTTTGAGAAGGCAGG - Intergenic
1065493891 10:26309511-26309533 CAGGGGTCTATTCAGATGGTTGG + Intergenic
1065561522 10:26968727-26968749 CAGCCTTAAATTGAGAAGCTTGG + Intergenic
1065569510 10:27055967-27055989 CAGGGTTATATTTAGAGTTTTGG - Intronic
1065884506 10:30064975-30064997 CAAGGTTTTATCGAGAATGTGGG - Intronic
1073358111 10:102873172-102873194 CATGGCTACATTGAGAAGTTGGG + Exonic
1073810063 10:107143075-107143097 TAGTGTTATCTTGAGAAAGTAGG + Intronic
1075981480 10:126744141-126744163 CATGGCTGTATTGGGAAGGTTGG - Intergenic
1076570873 10:131432133-131432155 CTGGGCTATGTTGAGAAGGGCGG + Intergenic
1080772275 11:35352733-35352755 GAGGGTTAGGTTGAGATGGTTGG + Intronic
1080835344 11:35935461-35935483 CAGGCTTATAATGATAAGGCAGG + Intergenic
1081829820 11:46099445-46099467 CAGTGCTATATTGAGAAGTGAGG - Intronic
1082309726 11:50631979-50632001 CAGGTTTATATTGAAAGTGTGGG + Intergenic
1082612372 11:55316668-55316690 CAGAATTATAGTGAAAAGGTTGG - Intergenic
1083792759 11:64996547-64996569 CTGGGTTATTTGGAGAAGGAAGG + Intronic
1085006913 11:73100242-73100264 AAGGGTTTTCTTGAGAAGGGAGG - Intronic
1086328597 11:85730332-85730354 CAGTATTTTATTGAGAATGTTGG - Intronic
1087570649 11:99923366-99923388 GAGGGTTATATTGTAAAGGAAGG + Intronic
1091469739 12:716249-716271 CAGGTTTAAATTTAGAAGTTTGG - Intergenic
1093187624 12:16039455-16039477 TTGGGCTAGATTGAGAAGGTTGG - Intergenic
1093210153 12:16298254-16298276 CAGAGTTATATTGAGAACTACGG - Intergenic
1094039443 12:26107494-26107516 CAGGGTTGATTTGAGAATGTTGG + Intergenic
1094066350 12:26364657-26364679 CCAGATTATAATGAGAAGGTTGG - Intronic
1094347268 12:29484760-29484782 CAGTGTTATTTGGAGAAAGTGGG - Intronic
1094814923 12:34173520-34173542 CTGGGGTATATTGAGAAGAATGG - Intergenic
1095102018 12:38195061-38195083 CTGGGGTATATTGAGAAGAATGG + Intergenic
1095156985 12:38869748-38869770 CAGAGTTATATAGAGTAGGTGGG - Intronic
1096425380 12:51497216-51497238 GAGGGTTATATTTAGGAGCTGGG + Intronic
1097570837 12:61329026-61329048 CAGGGTGATAAGCAGAAGGTAGG - Intergenic
1098443286 12:70540274-70540296 CAAAGTTTTATTGAGAATGTGGG - Intronic
1099856287 12:88171361-88171383 CAGGGTTGGAGGGAGAAGGTTGG - Intronic
1104214215 12:126720213-126720235 CAGGGATATATTTAGAATGAGGG - Intergenic
1104552549 12:129770441-129770463 CAGGATTCTTTTGAGAAAGTGGG + Intronic
1104592331 12:130094567-130094589 CAGGGTTTTATTGAGAAGTGGGG - Intergenic
1104995849 12:132655840-132655862 AAGAGTTATATTGAAAAGATAGG - Intronic
1112488152 13:99838372-99838394 GAGGGTTATACAGAGAATGTTGG + Intronic
1116738926 14:48730496-48730518 CAGGGTACTAGTGATAAGGTTGG + Intergenic
1117274096 14:54174789-54174811 CAGGGTTCTTTTGTGAGGGTTGG - Intergenic
1120228383 14:81816719-81816741 CAGGGTTATATTGGGAAACGTGG + Intergenic
1121663162 14:95650949-95650971 CGGGGTTGTGTTGAGAAGGTTGG + Intergenic
1122488110 14:102095159-102095181 AAGGGATGTATTGAGAAGGAAGG + Intronic
1124655928 15:31507288-31507310 CAGGGTTATATTGAGAAGGTTGG + Intronic
1127453731 15:59139789-59139811 CAGAGTAATAATGAGCAGGTCGG - Intronic
1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG + Intronic
1128725529 15:69985580-69985602 TAGAACTATATTGAGAAGGTAGG + Intergenic
1128826798 15:70725745-70725767 CAGAGGTATATTAAGAAGGAAGG + Intronic
1130117271 15:81016011-81016033 CAGGACTATTCTGAGAAGGTTGG - Intronic
1130667726 15:85884032-85884054 CAGAGTTAGATTAAGAAAGTGGG + Intergenic
1132875307 16:2134543-2134565 CAGGGTTGGATTGAAAAGGGCGG - Intronic
1133863399 16:9618475-9618497 CCAGGTTATATCAAGAAGGTAGG - Intergenic
1134130386 16:11645532-11645554 CACAGGTGTATTGAGAAGGTAGG - Intergenic
1134163623 16:11913216-11913238 CAGGGTTATATTGAGACTGTTGG - Intronic
1134352429 16:13450267-13450289 TAGGGTTATATTGTGAAGATTGG + Intergenic
1135983815 16:27169025-27169047 CAGGATTGTAGTGAGAAGGATGG + Intergenic
1143928584 17:10396515-10396537 CAGGGATATATGGAGTAGGGAGG + Intronic
1144622596 17:16827756-16827778 TATGAATATATTGAGAAGGTGGG + Intergenic
1144883832 17:18444954-18444976 TATGAATATATTGAGAAGGTGGG - Intergenic
1145148400 17:20499423-20499445 TATGAATATATTGAGAAGGTGGG + Intergenic
1146131848 17:30283820-30283842 TAGGGTTAGATTAAGATGGTGGG - Intronic
1146167640 17:30601938-30601960 CAGGGGTAAATGGTGAAGGTAGG - Intergenic
1146220048 17:31009860-31009882 CAGGGGTAAATGGTGAAGGTAGG - Intergenic
1147576933 17:41607682-41607704 TATGAATATATTGAGAAGGTGGG + Intergenic
1150373287 17:64660772-64660794 CAGGGGTAAATGGTGAAGGTAGG + Intronic
1150778935 17:68103011-68103033 CAGGGGTAAATGGTGAAGGTAGG - Intergenic
1152884073 17:82838253-82838275 TAGGGTAATAGTGAGAAGTTGGG + Intronic
1153357623 18:4155161-4155183 CAGGGTTATAGTGCTAAGGTGGG + Intronic
1156858608 18:41811945-41811967 CAGGGGGATGTTGAGAAGGGTGG + Intergenic
1161679375 19:5672002-5672024 CGGGGTTATATTGAGGATGGTGG - Intergenic
1161873791 19:6891769-6891791 AAGGGCTTTATTGAGATGGTTGG + Intronic
926299412 2:11591357-11591379 CAGGCTTCCATTTAGAAGGTGGG - Intronic
926697935 2:15783809-15783831 CACTGTTATAATGAGGAGGTTGG - Intergenic
929711779 2:44273594-44273616 CATGGTTAAATAGAGAAAGTGGG - Intergenic
932374673 2:71225613-71225635 GAGGGTTTTATTTTGAAGGTTGG - Intronic
935605480 2:104968870-104968892 CAGGGTTACATAGACAGGGTCGG + Intergenic
936712922 2:115153643-115153665 AAGGGTTATTTTGGGAAGATAGG - Intronic
940734110 2:157429719-157429741 CAGTGTTCTATTAAGAAGTTTGG + Intronic
944136317 2:196403924-196403946 CTGGGTTCTATAGAGAAGGTTGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
1169346647 20:4834265-4834287 TAGGGTTATATCTAGAAGGATGG + Intergenic
1170507030 20:17037636-17037658 CAGTGTTATCTTTAGAAGGGTGG - Intergenic
1171196237 20:23201677-23201699 CAGGGTTTTCTTGAGTAGTTTGG + Intergenic
1171900147 20:30848751-30848773 CTGGGGTATATTGAGAAGAATGG + Intergenic
1174786951 20:53441876-53441898 AAGGGTTATAATGAAAAGGCTGG - Intronic
1175700772 20:61135435-61135457 CAGGGTGATAAACAGAAGGTTGG + Intergenic
1179587317 21:42381779-42381801 CAGGGTAACATTGAAAATGTAGG + Intronic
1180318221 22:11296570-11296592 AAGGGTCATTTTGAGAAGGCAGG - Intergenic
1182481738 22:30613726-30613748 CAGGTTTATATTGAAAAGGCTGG - Intronic
1183225577 22:36547693-36547715 CAGAGTTCCATGGAGAAGGTGGG + Intergenic
949870202 3:8581864-8581886 CAGGGTTTTGTTGAGAATGGAGG - Intergenic
949939088 3:9140459-9140481 CATGGTTATTTTGAGGTGGTAGG + Intronic
951520381 3:23605687-23605709 CAGGGTGATACGGAGAAGTTAGG + Intergenic
952882855 3:37996059-37996081 CAGGGACATATTGAGAACATGGG + Intronic
953704161 3:45218854-45218876 CAAGGTTATTTTGAGGAGGGTGG - Intergenic
955518151 3:59748520-59748542 CAGGGTTGTATTAACAAGGCAGG + Intergenic
957353921 3:79058095-79058117 CAGGTTTATATTGAAAGTGTGGG - Intronic
957556667 3:81770837-81770859 CAGGGTTCTCTTGAGAAGCTGGG - Intergenic
959151195 3:102610313-102610335 CAGGGTGATATTGAGAGTGAGGG - Intergenic
959730853 3:109600331-109600353 CAGGGTTATAGTTAGATAGTAGG + Intergenic
960159795 3:114338309-114338331 GAGGGGGATATGGAGAAGGTGGG + Intronic
963808698 3:149753026-149753048 CAGAGTTAGATGGAGAGGGTTGG + Intergenic
964301401 3:155289447-155289469 CATGGTAATATTGATATGGTTGG - Intergenic
964507013 3:157410540-157410562 CAAGGTTTTATTTAGAAAGTTGG + Intronic
966981653 3:185141748-185141770 CAGGGTTTTACTGACAAGGGAGG + Intronic
968357123 3:198117770-198117792 CTGGGGTATATTGAGAAGAATGG + Intergenic
974980093 4:68945116-68945138 CGGTATTATATTGAGAAAGTAGG - Intronic
976056542 4:81075577-81075599 TAGAGAAATATTGAGAAGGTAGG + Intergenic
976683876 4:87788765-87788787 CAGGCCTACATTGAGCAGGTAGG + Intergenic
986465378 5:8015985-8016007 CAGGGTTAACTGGAGAAAGTGGG + Intergenic
993354567 5:86890073-86890095 TAGGGTTTTATGGATAAGGTGGG + Intergenic
993954398 5:94214628-94214650 CAGGGTTATATTTACAAGGAGGG - Intronic
997425517 5:133800160-133800182 CAGGCTTATTTTGGAAAGGTTGG + Intergenic
1002978748 6:2112896-2112918 CAGGTTGATAGTGAGAGGGTGGG - Intronic
1005059023 6:21758667-21758689 CAGCGTTATTTGGTGAAGGTGGG + Intergenic
1006864557 6:37198805-37198827 CAGGGATATATTGAACAGCTGGG - Intergenic
1007910153 6:45505389-45505411 TGGAGTTATATTGAGAAGGGAGG - Intronic
1008834774 6:55812287-55812309 TAGGGATAAATTGGGAAGGTGGG + Intronic
1009549399 6:65067946-65067968 CAGGTTAATAGTGTGAAGGTAGG + Intronic
1010053907 6:71541262-71541284 CAGGGTTGTACTGAGAATATGGG + Intergenic
1011920075 6:92563276-92563298 CATGGTTATGTTGAAAATGTAGG - Intergenic
1014327047 6:120010813-120010835 CAGCGTGATATTGAGTAGGAGGG + Intergenic
1015606837 6:134966149-134966171 TAGGGTTATATTTGGAAGATTGG - Intronic
1018801467 6:167225913-167225935 CAGGGTTCTATTGAGATGAAGGG + Intergenic
1018808510 6:167280409-167280431 CAGGGTTCTATTGAGATGAAGGG - Intronic
1020018753 7:4848692-4848714 CATGGCTCTATTGAGAAGATCGG + Intronic
1021803686 7:24333816-24333838 CAAGGTGTAATTGAGAAGGTAGG + Intergenic
1023346209 7:39273768-39273790 AAGTGTTACATTGAGAAAGTAGG - Intronic
1026916652 7:74123984-74124006 AAGGGTTCTATCGAGAAGATGGG + Intergenic
1028545099 7:91989490-91989512 CAGGGTTATTTGGAGGAAGTTGG + Intronic
1030581700 7:111364473-111364495 CAGGATCATATTCAGTAGGTAGG + Intronic
1030825638 7:114154313-114154335 CAGGGCAATATAGATAAGGTGGG + Intronic
1031461004 7:122048753-122048775 CCTGGTTATATTTTGAAGGTGGG - Intronic
1032994775 7:137432815-137432837 CAGGGAAATATTGGGAAGGAAGG - Intronic
1033822165 7:145147880-145147902 TTGGGTTGTATGGAGAAGGTTGG + Intergenic
1034331354 7:150285947-150285969 CAGGGTTAAAATTAGAAGTTAGG + Intronic
1034666690 7:152823909-152823931 CAGGGTTAAAATTAGAAGTTAGG - Intronic
1040957942 8:52998769-52998791 CAGGGCTACAGTGAGGAGGTGGG - Intergenic
1042506815 8:69569674-69569696 CAGGGCTACATAGATAAGGTAGG - Intronic
1046595155 8:116252585-116252607 CAGGATTATATTCAGAATTTTGG + Intergenic
1053729223 9:41035556-41035578 CAGAGATTTATTGAGAAGGAGGG + Intergenic
1054699290 9:68396510-68396532 CAGAGATTTATTGAGAAGGAGGG - Intronic
1054743363 9:68830439-68830461 CAGGCTAATAATGAGAGGGTTGG - Intronic
1055759096 9:79587994-79588016 CAGGGTTATATATAGCTGGTAGG + Intronic
1056700224 9:88898135-88898157 CAGGGTGTTAATGAGAAGCTAGG + Intergenic
1057363118 9:94393268-94393290 TTGGGTCATATTGAGAAAGTAGG + Intronic
1057458127 9:95233101-95233123 CAGGGTACTATTAAGAAGGCGGG + Intronic
1057660220 9:96994838-96994860 TTGGGTCATATTGAGAAAGTAGG - Intronic
1058709180 9:107664582-107664604 CAGGGTAAAATCGAGAAGGCTGG + Intergenic
1059951438 9:119466470-119466492 CAGGGAGATATTGTGAAGATGGG + Intergenic
1060254118 9:122011911-122011933 CAGGGTTAATTTCAGAAGGAAGG + Intronic
1203366449 Un_KI270442v1:262332-262354 AAGGGTCATTTTGAGAAGGCAGG - Intergenic
1186134028 X:6499823-6499845 CAGGTTTAAATTGAGAAGTGTGG - Intergenic
1197752188 X:129972574-129972596 TAGGGTTTTATTGAATAGGTTGG - Intergenic
1198113214 X:133521215-133521237 CAAGTATATATTGACAAGGTGGG - Intergenic
1199059993 X:143344108-143344130 GAGGATTATAATGAGAATGTGGG + Intergenic
1200861177 Y:7994357-7994379 CAGGTTTATATTGAAAATATGGG + Intergenic