ID: 1124656935

View in Genome Browser
Species Human (GRCh38)
Location 15:31516408-31516430
Sequence GAGGATCCCAGCTCCAGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 212}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124656930_1124656935 -7 Left 1124656930 15:31516392-31516414 CCCAGGGGGTGGCGGAGAGGATC 0: 1
1: 0
2: 2
3: 8
4: 190
Right 1124656935 15:31516408-31516430 GAGGATCCCAGCTCCAGCGGGGG 0: 1
1: 0
2: 1
3: 30
4: 212
1124656921_1124656935 23 Left 1124656921 15:31516362-31516384 CCATGTGAGCAACTGAAACCTGC 0: 1
1: 0
2: 1
3: 8
4: 131
Right 1124656935 15:31516408-31516430 GAGGATCCCAGCTCCAGCGGGGG 0: 1
1: 0
2: 1
3: 30
4: 212
1124656931_1124656935 -8 Left 1124656931 15:31516393-31516415 CCAGGGGGTGGCGGAGAGGATCC 0: 1
1: 0
2: 0
3: 21
4: 275
Right 1124656935 15:31516408-31516430 GAGGATCCCAGCTCCAGCGGGGG 0: 1
1: 0
2: 1
3: 30
4: 212
1124656926_1124656935 5 Left 1124656926 15:31516380-31516402 CCTGCTCAGTGACCCAGGGGGTG 0: 1
1: 0
2: 0
3: 23
4: 182
Right 1124656935 15:31516408-31516430 GAGGATCCCAGCTCCAGCGGGGG 0: 1
1: 0
2: 1
3: 30
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124656935 Original CRISPR GAGGATCCCAGCTCCAGCGG GGG Intronic