ID: 1124656935

View in Genome Browser
Species Human (GRCh38)
Location 15:31516408-31516430
Sequence GAGGATCCCAGCTCCAGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 212}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124656921_1124656935 23 Left 1124656921 15:31516362-31516384 CCATGTGAGCAACTGAAACCTGC 0: 1
1: 0
2: 1
3: 8
4: 131
Right 1124656935 15:31516408-31516430 GAGGATCCCAGCTCCAGCGGGGG 0: 1
1: 0
2: 1
3: 30
4: 212
1124656930_1124656935 -7 Left 1124656930 15:31516392-31516414 CCCAGGGGGTGGCGGAGAGGATC 0: 1
1: 0
2: 2
3: 8
4: 190
Right 1124656935 15:31516408-31516430 GAGGATCCCAGCTCCAGCGGGGG 0: 1
1: 0
2: 1
3: 30
4: 212
1124656931_1124656935 -8 Left 1124656931 15:31516393-31516415 CCAGGGGGTGGCGGAGAGGATCC 0: 1
1: 0
2: 0
3: 21
4: 275
Right 1124656935 15:31516408-31516430 GAGGATCCCAGCTCCAGCGGGGG 0: 1
1: 0
2: 1
3: 30
4: 212
1124656926_1124656935 5 Left 1124656926 15:31516380-31516402 CCTGCTCAGTGACCCAGGGGGTG 0: 1
1: 0
2: 0
3: 23
4: 182
Right 1124656935 15:31516408-31516430 GAGGATCCCAGCTCCAGCGGGGG 0: 1
1: 0
2: 1
3: 30
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124656935 Original CRISPR GAGGATCCCAGCTCCAGCGG GGG Intronic
900432756 1:2610778-2610800 GAGGTCCCCAGCCCCAGAGGTGG - Intronic
900633761 1:3652046-3652068 GAGGAGCCCAGCGCTAGTGGCGG + Intronic
902282507 1:15384681-15384703 AAAGTTCCCAGCTCCAGCTGGGG - Intronic
903260360 1:22128564-22128586 GAGCATCCCAGCCCCAGCCAGGG + Intronic
903750240 1:25616905-25616927 GAGGAAGACAGCTGCAGCGGGGG + Intergenic
903938609 1:26913549-26913571 GAGGAGCCCAGCAGCAGTGGAGG - Exonic
904751280 1:32742407-32742429 GGGGATCCCTGCCCCAGCCGGGG - Intronic
905614106 1:39382043-39382065 CAGAATCCCAGCTCCGGCCGTGG + Exonic
906325701 1:44843932-44843954 GAGGATCCAGGCTCCAGCTGTGG - Intergenic
907268148 1:53275226-53275248 GAGGGTCCCTGCTCCTGCAGAGG + Intronic
907300362 1:53483013-53483035 TAGGATCCAAGCCCCAGAGGAGG + Intergenic
910101666 1:83583800-83583822 GAAGATGCCAGCTGCAGCAGGGG - Intergenic
912881972 1:113424214-113424236 GAGGATGCCAGCTGCAGCGGGGG - Intronic
912960314 1:114190141-114190163 GAGGATCCCAGCTTCACTGAAGG + Intergenic
913172172 1:116243012-116243034 GAGGCTCACAGCTCCGGGGGAGG - Intergenic
914790944 1:150876729-150876751 CAGCATCCCAGCCCCTGCGGCGG + Exonic
917854604 1:179090279-179090301 GAGGTTCCCCCCTCCAGCCGAGG + Intronic
918095620 1:181331474-181331496 GTGTATCCCAGCTCCAGGAGAGG + Intergenic
919548212 1:198949772-198949794 GAGGACCCAGGCTCCAGCTGTGG + Intergenic
923190833 1:231618900-231618922 GAGTATCACATCTCTAGCGGAGG + Intronic
923786366 1:237072220-237072242 GGGGATGCCAGCTGCAGCGGGGG - Intronic
924530399 1:244889071-244889093 TATAATCCCAGCTCCACCGGAGG - Intergenic
1063462241 10:6222117-6222139 GAGGATCCCATCGGCAGAGGAGG - Intronic
1066661028 10:37738276-37738298 CAGGCTCCCTGCACCAGCGGTGG + Intergenic
1068938287 10:62657353-62657375 GGGGATGCCAGCTGCAGCAGGGG + Intronic
1069077787 10:64056280-64056302 GAGGATCCCATGTCTAGTGGAGG + Intergenic
1077102327 11:827747-827769 GAGGATCCCAGCTCCCCGGTGGG + Intronic
1077178049 11:1199499-1199521 CAGGATCCCCGCTCCAGCCAAGG + Intronic
1077342507 11:2032319-2032341 GAGGCTCCCAGCTCCCGGTGTGG + Intergenic
1080485586 11:32704031-32704053 GAGGATGCCAGCTGCAGCAAGGG + Intronic
1083303884 11:61752972-61752994 GGGGAGCCCAACTTCAGCGGCGG - Intronic
1083348619 11:62011762-62011784 GAGGACCCAGGCTCCAGCTGTGG - Intergenic
1083890360 11:65592756-65592778 GAGGTTCCCAGGGCCAGCGGAGG + Intronic
1084178327 11:67434743-67434765 CAGGATGCCAGCTCCAGCCTTGG + Intronic
1084687658 11:70706435-70706457 GATGATTACAGCTCCAGCTGGGG + Intronic
1085085097 11:73661495-73661517 GAGGATCCCTGCTACAGCGCCGG + Exonic
1085702411 11:78756774-78756796 GAGGGCCCCAGCTCCAGCCAGGG - Intronic
1088328964 11:108629717-108629739 GAAGATGCCAGCTGCAGCGTGGG - Intergenic
1088879952 11:113965273-113965295 AAGGATTCCAGCTCCAGGGCTGG + Intergenic
1090204885 11:124878633-124878655 ACGGAGCCCAGCTCCAGTGGAGG + Exonic
1202825493 11_KI270721v1_random:87508-87530 GAGGCTCCCAGCTCCCGGTGTGG + Intergenic
1091983942 12:4892256-4892278 GAGGATCCAAGCTCAGGTGGAGG + Intergenic
1092206818 12:6619897-6619919 GAGCACCCCTTCTCCAGCGGTGG - Exonic
1093183172 12:15989245-15989267 GGGGATGCCAGTTGCAGCGGGGG - Intronic
1095099167 12:38163198-38163220 CAGGTGCCCAGCTCCAGCCGGGG - Intergenic
1096460165 12:51818057-51818079 GAGGATCCCAGCCCCAGTCTGGG + Intergenic
1098519752 12:71421506-71421528 GGGGATGCCAGCTGCAGCAGGGG - Intronic
1103030363 12:117607492-117607514 AGGGTTCCCAGCTCCAGCGCTGG - Intronic
1103560178 12:121789525-121789547 GTGGACCCCAGCTCCAGCTGCGG + Intronic
1105954574 13:25268684-25268706 GAGGATGCCAGCTGCAGTGGGGG + Intronic
1109982177 13:69923731-69923753 GATGATGCCAGCTGCAGTGGAGG + Intronic
1111549236 13:89784779-89784801 GAGGACCCTGGCTGCAGCGGGGG - Intergenic
1111900911 13:94198830-94198852 GTGAATCCCAGCTCCGGCAGGGG - Intronic
1113229178 13:108194462-108194484 GAGGATGCCAGCTGCAGTGGGGG + Intergenic
1115458443 14:33632552-33632574 GTGGAACCCAGCTCCAGCTCCGG - Intronic
1116167144 14:41349293-41349315 GGGGATGCCAGCTGCAGCGGGGG + Intergenic
1116790117 14:49330500-49330522 GAAGATGCCAGCTGCAGCAGGGG - Intergenic
1119236916 14:73027177-73027199 GAGGATCCCGGCGCCAGCAAGGG + Exonic
1119678587 14:76574894-76574916 GGGGTTCCCAGCCCCGGCGGGGG + Intergenic
1120592191 14:86389979-86390001 GAGGATGCCAGCTGCAGCAGGGG + Intergenic
1120678988 14:87456587-87456609 TAGGATCCCAGCTCCTCAGGAGG + Intergenic
1122155255 14:99746817-99746839 GAGGAGCCCTGCTCGAGGGGTGG - Intronic
1122235010 14:100326425-100326447 GAGGTTCCCACCTCCAGCAGAGG + Intronic
1124656935 15:31516408-31516430 GAGGATCCCAGCTCCAGCGGGGG + Intronic
1127663682 15:61123735-61123757 GAGAAGCACAGCTCCAGCAGAGG + Intronic
1129271807 15:74422900-74422922 GAGGAGTGCAGCTCCAGGGGAGG + Intronic
1129385142 15:75192235-75192257 GAGGATGCCAAATCCAGCTGAGG - Intergenic
1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG + Intronic
1131250684 15:90828198-90828220 GAGGATCCCACATCCATCCGGGG - Intergenic
1131568448 15:93506989-93507011 GAAGATGCCAGCTACAGCGGGGG - Intergenic
1132826419 16:1907707-1907729 GAGGACCCCTGCCCCAGGGGAGG + Intergenic
1132834757 16:1947159-1947181 GAGGATGGCAGCTCCAGGGCAGG - Intronic
1133076344 16:3283673-3283695 GAGGAGCCCCGCTCCAGCCCAGG - Exonic
1133758079 16:8777344-8777366 GAGTAATCCAGCTCCAGCAGGGG - Intronic
1136909184 16:34132827-34132849 CAGGAGCCCGGCTCCAGCCGGGG + Intergenic
1138484794 16:57332384-57332406 GAGGATCCAGGCTCCAACTGTGG - Intergenic
1139740966 16:69034494-69034516 GAGGACCCAGGCTCCAGCTGTGG + Intronic
1141431166 16:83970766-83970788 AAGGATCCCAGCTTCTGCGGTGG - Intronic
1141667103 16:85471228-85471250 CAGGTCCCCAGCTCCAGGGGTGG + Intergenic
1141741778 16:85898568-85898590 GAGAATCCCAGCTTCAAAGGAGG - Intergenic
1142306732 16:89290228-89290250 GAGGCTCAGGGCTCCAGCGGGGG + Intronic
1142306767 16:89290321-89290343 GAGGCTCAGGGCTCCAGCGGGGG + Intronic
1142306784 16:89290366-89290388 GAGGCTCAGGGCTCCAGCGGGGG + Intronic
1142306816 16:89290457-89290479 GAGGCTCAGGGCTCCAGCGGGGG + Intronic
1142849305 17:2696578-2696600 GCGCAGCCCAGCTCCACCGGTGG - Intronic
1142940821 17:3378638-3378660 GGGGATGCCAGCTGCAGCAGGGG - Intergenic
1143003703 17:3812948-3812970 GAGGGCGCCAGCTCCTGCGGGGG + Exonic
1146899569 17:36574470-36574492 GAGGACCCAGGCTCCAGCTGTGG - Intronic
1148377170 17:47159202-47159224 GAGGACCCGGGCTCCAGCTGTGG - Intronic
1148995912 17:51709537-51709559 GTGGACCCCACCTCCAGAGGTGG + Intronic
1149169334 17:53791639-53791661 GAGGACTCCAGCTGCAGTGGGGG + Intergenic
1152333991 17:79690042-79690064 GAGTATGTCAGATCCAGCGGTGG - Intergenic
1152823088 17:82446986-82447008 GAGGATCTAAGATCCAGCTGTGG - Intronic
1152964072 18:98353-98375 AAGGAGCCCAGCCCCAGCAGTGG - Intergenic
1157873509 18:51251264-51251286 GAAGATCCCAGACCCAGCTGCGG + Intergenic
1158773990 18:60555150-60555172 GGGGATGCCAGCTGCAGTGGGGG + Intergenic
1159601343 18:70431092-70431114 GAGGACCCAGGCTCCAGCTGTGG + Intergenic
1160329663 18:77979772-77979794 CAGGATCCCAGCCCCAGTGTGGG + Intergenic
1160506725 18:79431473-79431495 GAGGATCCCAGCCACACAGGAGG - Intronic
1162674091 19:12285152-12285174 GAGGACCCAGGCTCCAGCTGTGG + Intronic
1166717841 19:44980119-44980141 GAGGGTCCCAGCTCCAAGGCTGG - Intronic
1166984689 19:46652782-46652804 GAAGATCCCAGCTCTACAGGAGG - Exonic
1166990919 19:46692274-46692296 CAGGATCTCAGCACCAGGGGAGG + Intronic
1167704189 19:51068900-51068922 CAGGATACCAGCACCAGTGGAGG - Intergenic
926062383 2:9812522-9812544 GAGACGCCCAGCTCCAGTGGGGG - Intergenic
926608810 2:14924544-14924566 GAGTATCTCAGCTCCATTGGGGG - Intergenic
927553543 2:24017842-24017864 GAGGAGGCCAGCCCCAGAGGAGG + Intronic
927969350 2:27295198-27295220 GAGGATCCCAGCTACTCGGGAGG - Intronic
929779723 2:44949810-44949832 GGGCATCTCAGCTCCAGCGCTGG - Intergenic
929927718 2:46229403-46229425 CAGGGTCCCAGCTCCAGCCAGGG - Intergenic
930024790 2:47023471-47023493 GAGGCTCCCACCTGCAGCAGAGG + Intronic
931195458 2:60048364-60048386 CAGGGGCCCAGCTCCAGTGGGGG - Intergenic
934937936 2:98478647-98478669 GAGGGTCCCTGCCCCAGCTGGGG + Intronic
935367804 2:102313390-102313412 GAGAATCCCAGATCCTGCTGGGG - Intronic
935692620 2:105744889-105744911 GACGATCCCCGCGGCAGCGGCGG - Exonic
936634084 2:114235444-114235466 CTGGCTCCCAGCTCCAGCAGAGG + Intergenic
938051299 2:128174792-128174814 GAGGATCCAAGCTCCTGGGTTGG - Exonic
939997390 2:148932549-148932571 GGGGGTTCCAGCTCCAGCTGAGG + Intronic
940089201 2:149897056-149897078 GAGGATCCCAGCAGCACAGGAGG - Intergenic
940089416 2:149899001-149899023 GAGGATCCCAGCAGCACAGGAGG - Intergenic
940422957 2:153500019-153500041 GGGGATGCCAGCTGCAGTGGGGG - Intergenic
943345785 2:186735146-186735168 GAGGATGCCAGCTGCAGCAGGGG - Intronic
945029348 2:205649147-205649169 GAGGACTCCAGCCCCAGAGGTGG + Intergenic
948052388 2:234988496-234988518 AAGGACCCCAGCTCCAGCCAGGG + Intronic
948168513 2:235881642-235881664 GAGAATCCCAGCTCAAGGTGTGG + Intronic
1168881100 20:1206962-1206984 GAGGACGCCAGGTCCAGCGGAGG + Exonic
1171120010 20:22560078-22560100 GAGGAGCAGAGCTCCAGCGAGGG - Intergenic
1171771866 20:29327897-29327919 CAGGAGCCCGGCTCCAGCCGGGG - Intergenic
1172326815 20:34042221-34042243 GACGATCCCCGCTCCCGCCGAGG + Intronic
1172336825 20:34123257-34123279 GAGGACCCAGGCTCCAGCTGTGG + Intergenic
1173471511 20:43326814-43326836 GAGGATCCCAGCGGAAGCAGTGG + Intergenic
1174405705 20:50301811-50301833 GAGGAACCCAGGCCCAGTGGAGG + Intergenic
1175832829 20:61976467-61976489 CAGCACCCCAGCTCCAGCTGTGG - Intronic
1175913592 20:62415730-62415752 GAGGATCCCTGGTCCTGCGGGGG + Intronic
1176126050 20:63475322-63475344 GTGGTGCCCAGCTCCAGCGGAGG + Intergenic
1176177551 20:63735819-63735841 CAGGAGCCCAGCGCCAGCTGGGG + Exonic
1176288716 21:5033273-5033295 GAGGCTCCCAGCTCCAGGCGGGG - Intronic
1179026605 21:37683837-37683859 AAGGATCCCTTCTGCAGCGGGGG + Intronic
1179821564 21:43940148-43940170 GAGGAGCCGAGCTCAAGCGGAGG - Intronic
1179868468 21:44230202-44230224 AAGGCTCCCAGCTCCAGGCGGGG + Intronic
1180317263 22:11285732-11285754 CAGGAGCCCGGCTCCAGCCGGGG - Intergenic
1180338070 22:11597732-11597754 GAGGAGCCCGGCTCCAGCCGGGG + Intergenic
1180630649 22:17227280-17227302 GAGGATCCCAGCTACTTGGGTGG + Intergenic
1183298349 22:37045409-37045431 GATGACCCCAGCTCCAGAGCAGG - Intergenic
1184120044 22:42444229-42444251 GAGGACTCCTGCTCCAGCTGTGG + Intergenic
1184466306 22:44670375-44670397 CAGGATCCCAGCTCCAGCACTGG + Intronic
954554916 3:51510048-51510070 CAGGAACCCAGCTCCAGGGAGGG + Intergenic
955656179 3:61247217-61247239 GAGGATCACAGCAACAGCAGAGG - Intronic
964509919 3:157438613-157438635 GGGGATCCCAGCTCCACCCCAGG + Intronic
964876270 3:161372014-161372036 GGGGATCCCAGCCCCAGAGCGGG - Exonic
966254045 3:177898316-177898338 CAGGATGCCAGCTGCAGCAGGGG + Intergenic
967260223 3:187634576-187634598 GAGGAGGCCTGCTGCAGCGGTGG - Intergenic
967279505 3:187808350-187808372 GAGGCTCCAGGCTCCAGCCGAGG + Intergenic
967493776 3:190120986-190121008 CAGGCTCCCCGCTGCAGCGGCGG + Intronic
968434112 4:576204-576226 GAGGATGCGGGCTCCGGCGGCGG - Intergenic
968477412 4:818556-818578 CAGGACCCCAGCTCCAGCTCAGG - Intronic
968619181 4:1596064-1596086 GAGGGTCCCTGCTCCTGCGCTGG + Intergenic
971195639 4:24470537-24470559 CAGGCCCCCAGCTCCAGCGCCGG + Intergenic
971495381 4:27258809-27258831 GAGGACCACAGCTCCAGGGGGGG - Intergenic
971876972 4:32319464-32319486 AAAGATGCCAGCTGCAGCGGAGG - Intergenic
974432444 4:61816726-61816748 GGGGATGCCAGCTGCAGCAGGGG + Intronic
974607575 4:64173502-64173524 GGGGATGCCAGCTGCAGCAGGGG + Intergenic
975701781 4:77074855-77074877 GAGCCCCCTAGCTCCAGCGGAGG + Intronic
976129537 4:81870385-81870407 GGGGATGCCAGCTGCAGTGGGGG + Intronic
976728953 4:88243970-88243992 GAGGATACCAGCTGCAGGGAGGG + Intergenic
977388172 4:96371662-96371684 GAGGAAGCCAGCTGCAGTGGTGG + Intergenic
977985049 4:103373230-103373252 GAGCATTCCAGCTGCAGGGGAGG + Intergenic
978503500 4:109433669-109433691 CAGGATCCCCGCGCCCGCGGCGG + Intergenic
980544652 4:134244063-134244085 CAGGATGCCAGCTCCAGCATGGG + Intergenic
984811432 4:183798478-183798500 GGGGCTCCCAGCTGGAGCGGCGG + Intergenic
985147260 4:186906060-186906082 GAGAGTCCCAGCCCCAGCGAGGG - Intergenic
986254464 5:6090405-6090427 GGGGATCCTGGCTCCAGAGGAGG + Intergenic
986919147 5:12662724-12662746 CAGGCTGCCAGCTCCAGCAGCGG + Intergenic
995732848 5:115264659-115264681 GAGGACCCAGGCTCCAGCGGTGG - Intergenic
995988488 5:118208351-118208373 GAGGAAGCCAGCTCCAGCCTGGG + Intergenic
996176627 5:120367997-120368019 GAGGACACCAGCTGCAGTGGGGG + Intergenic
997445296 5:133935781-133935803 GAGGAGCCCAGAACCAGGGGAGG - Intergenic
997639777 5:135441650-135441672 GAGGCTTCCAGATCCAGCGCTGG - Intergenic
998355127 5:141529022-141529044 GAGGATCACAGCTCCAGAGCAGG + Intronic
999384999 5:151147826-151147848 GAGGATCCCAGGCCCAGAGAAGG + Intronic
999730929 5:154476340-154476362 GAGGCTCCCAGCTCCGGCTTAGG - Intronic
1001096937 5:168782637-168782659 CATGATCCCAACTCCAGGGGTGG - Intronic
1001477016 5:172057748-172057770 CTGGAACCCAGCTCCATCGGTGG + Intronic
1002699722 5:181114320-181114342 GAGCATCCCAGCCCCTCCGGAGG - Intergenic
1003438852 6:6121540-6121562 GAAGATGCCAGCTGCAGTGGGGG + Intergenic
1005533317 6:26730216-26730238 GAGGATCACAGCTCTAGAGCGGG + Intergenic
1005537477 6:26771448-26771470 GAGGATCACAGCTCTAGAGCGGG - Intergenic
1006766438 6:36510569-36510591 GAAGATGCCAGCTGCAGTGGGGG - Intronic
1007283455 6:40729966-40729988 GAGGATCACACCTACAGCAGAGG + Intergenic
1008591150 6:52995041-52995063 AAGGACCCCAGCTCCAGCCAAGG + Intronic
1009684147 6:66935591-66935613 GAGGATGCCAGCTGCATCAGGGG + Intergenic
1010320907 6:74508905-74508927 AAGAATCGCAGCTCCAGCTGAGG + Intergenic
1012100695 6:95083445-95083467 CAGGACGCCAGCTGCAGCGGGGG + Intergenic
1012133084 6:95520135-95520157 GAGGACGCTAGCTGCAGCGGGGG - Intergenic
1012206463 6:96466784-96466806 GATGATTCCAGCCCCAGCTGAGG + Intergenic
1012231406 6:96764790-96764812 GAGGATCCCAGCTATACCCGAGG + Intergenic
1012749640 6:103140862-103140884 GAAGATGCCAGCTACAGCAGGGG - Intergenic
1014384587 6:120785571-120785593 GAGGATGCCAGCTACAGTGGAGG + Intergenic
1016499539 6:144704013-144704035 GAGGATACCAGCTCAAACAGTGG + Intronic
1017373146 6:153736256-153736278 GGGGATGCCAGCTGCAGCAGAGG - Intergenic
1019058087 6:169237086-169237108 CCGGATCCCGGCTCCAGCTGTGG + Intronic
1019476675 7:1247701-1247723 CGGGATCCCAGCCCCAGCAGCGG + Intergenic
1019478580 7:1255703-1255725 GAGGGTCCCAGCCCCGCCGGCGG + Intergenic
1024857164 7:53795082-53795104 GGGGATGCCAGCTGCAGCAGCGG - Intergenic
1025242535 7:57289793-57289815 CAGAATCCCAGATCCAGTGGGGG - Intergenic
1029220736 7:98988075-98988097 GAGCAACCCAACTCCAGCAGCGG - Intronic
1031665874 7:124481362-124481384 GAGGACCCAGGCTCCAGCTGTGG + Intergenic
1032245304 7:130206238-130206260 GAGGAGCTCAACCCCAGCGGAGG + Intronic
1033921144 7:146393621-146393643 GAGGCTTTCAGCTCCAGTGGAGG - Intronic
1035183090 7:157105009-157105031 GAGGATCCCAGCACCTGCCTGGG - Intergenic
1036812142 8:11874549-11874571 CAGGGTCCCTGCTCCAGGGGAGG + Intergenic
1036920216 8:12845488-12845510 GAGGACCCAGGCTCCAGCTGTGG - Intergenic
1037403384 8:18516016-18516038 GAGGATCCCAGCTACCAGGGAGG + Intergenic
1040952841 8:52953770-52953792 GAGGAAGCCAGCTCCAGCCTCGG - Intergenic
1042556088 8:70034817-70034839 GCGGTTCCCAGATCCAGAGGCGG + Intergenic
1042733741 8:71964849-71964871 GAGGATGTGAGCTCCAGAGGAGG - Intronic
1044971411 8:97624214-97624236 GAGGACCCAGGCTCCAGCTGTGG - Intergenic
1045035015 8:98170097-98170119 GAGGATGCCAGCCCCAGAAGGGG + Intergenic
1046187147 8:110735314-110735336 AGGGATGCCAGCTTCAGCGGGGG - Intergenic
1047318479 8:123755629-123755651 GAGGATGCCAGCTGCAGCAGGGG - Intergenic
1047980205 8:130173338-130173360 GAGGGTCACAGTTCCAGCTGTGG + Intronic
1048339251 8:133526053-133526075 GGGGATGCCAGCTGCAGCAGGGG - Intronic
1049240864 8:141536822-141536844 CAGGATCTCAGGTCCAGCTGGGG + Intergenic
1049544406 8:143222876-143222898 GAGGATGCCAGCACCAGCCCTGG - Intergenic
1049747433 8:144268949-144268971 GGGGCTCCCAGCCCCAGCGAGGG + Intronic
1050589838 9:7149551-7149573 GAGGATGCCAGCTGCAGCGAGGG - Intergenic
1050808759 9:9718372-9718394 GAGGATGCCAGCTGCAGCAGGGG + Intronic
1055638316 9:78298518-78298540 GAGATTCCCTGCTCCAGCTGTGG + Intronic
1056378981 9:86040441-86040463 GAGGACCCCAGCCCCATGGGAGG - Intronic
1057152659 9:92808771-92808793 GAGGTCCCCAGCTCCAGCAGAGG + Intergenic
1057304325 9:93903564-93903586 GAGGGGCCCAGCTCCTGCTGTGG - Intergenic
1057705838 9:97394420-97394442 GAGGATCCCAGATCCAGCAAAGG + Intergenic
1060933476 9:127503224-127503246 GAGGACCCAAGCTCCTGCAGGGG - Exonic
1061178608 9:129011494-129011516 GAGGGTCTCACCTCCAGGGGCGG + Intronic
1061547836 9:131315065-131315087 CAGGGTCCCACCTCCAGCTGTGG + Intergenic
1061973271 9:134055978-134056000 AAGGAGCCCAGCTCCAGCCATGG + Intronic
1062105223 9:134751458-134751480 GAGGAGCCCAGCTCCAGCCCAGG - Intronic
1062734042 9:138125432-138125454 AAGGAGCCCAGCCCCAGCAGTGG + Intergenic
1203365504 Un_KI270442v1:251447-251469 CAGGAGCCCGGCTCCAGCCGGGG - Intergenic
1188727917 X:33607567-33607589 GAGGATGCCAGCTACAGCCAAGG - Intergenic
1189143588 X:38632965-38632987 GAGCATCCAAGCTCCAGAGATGG + Intronic
1189262802 X:39689787-39689809 GAGGACCCCGGCTCCAGGAGCGG + Intergenic
1193417335 X:81240827-81240849 GGGGATGCCAGCTACAGTGGGGG + Intronic
1199329572 X:146543094-146543116 GACCATCCCAGCTCCAGCCATGG - Intergenic