ID: 1124658340

View in Genome Browser
Species Human (GRCh38)
Location 15:31526173-31526195
Sequence AAGGACGCACGGGAGGACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124658340_1124658346 4 Left 1124658340 15:31526173-31526195 CCACGGTCCTCCCGTGCGTCCTT 0: 1
1: 0
2: 1
3: 10
4: 85
Right 1124658346 15:31526200-31526222 TGAAGCTAATGCTGGAAAGCTGG 0: 1
1: 0
2: 1
3: 24
4: 218
1124658340_1124658345 -4 Left 1124658340 15:31526173-31526195 CCACGGTCCTCCCGTGCGTCCTT 0: 1
1: 0
2: 1
3: 10
4: 85
Right 1124658345 15:31526192-31526214 CCTTGTCTTGAAGCTAATGCTGG 0: 1
1: 0
2: 0
3: 9
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124658340 Original CRISPR AAGGACGCACGGGAGGACCG TGG (reversed) Intronic
901022086 1:6260776-6260798 GCGGACGGACGGGAGGACCCCGG - Intronic
906747022 1:48229144-48229166 AAGGTCACACGGGAGGACTGGGG + Exonic
909078932 1:71085878-71085900 AAGGATGCATGGGGGGACAGTGG - Intergenic
920185532 1:204156875-204156897 AAGGGTGCAGGGGAGGACAGAGG + Intronic
920956041 1:210620971-210620993 AAGGAAGCACGGTAGGAGCTGGG + Intronic
922899335 1:229123925-229123947 AAGGACACACAGGTGGACCAAGG + Intergenic
1065687698 10:28302731-28302753 CAGGAGGCTCCGGAGGACCGCGG + Intronic
1069753072 10:70757259-70757281 CAGGAGGCACCAGAGGACCGAGG - Intronic
1070954125 10:80453811-80453833 AGGGATACACGGGATGACCGTGG - Intergenic
1075226584 10:120634828-120634850 GAGGATGCAGGGAAGGACCGAGG - Intergenic
1085387420 11:76165025-76165047 ACGCACGCACGGGAGGACACAGG + Intergenic
1086338771 11:85826230-85826252 CAGGATGCACAGGAGGACTGAGG + Intergenic
1090535928 11:127641640-127641662 AAGGACACACGGGAAGAATGTGG - Intergenic
1103098443 12:118151318-118151340 CAGGAACTACGGGAGGACCGAGG + Intronic
1114490077 14:23095024-23095046 AAGGCCGCACTGGAGCAGCGAGG - Exonic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1116937852 14:50760628-50760650 AAGGATGCATGGGAAGACAGAGG - Intronic
1118043281 14:61939782-61939804 AAGGACGAATGGAAGGACAGAGG + Intergenic
1122273413 14:100578463-100578485 AAGGATGCATGGGAGGACTGTGG - Intronic
1124658340 15:31526173-31526195 AAGGACGCACGGGAGGACCGTGG - Intronic
1127272039 15:57410154-57410176 AAGGAGGCAAGAGAGGACTGTGG + Intronic
1130988620 15:88861120-88861142 ACGGACACACGGGAGGCCCGTGG + Intronic
1132393050 15:101452877-101452899 AAGGACACACTGGAGCACTGGGG + Intronic
1132494254 16:253320-253342 AAGTCCGCAGGGGAGGACAGGGG - Intronic
1133007836 16:2894575-2894597 AGGGCCGCACGGGAGGAACAGGG + Intronic
1134686139 16:16159887-16159909 AAGGACACACAGCAGGACCCAGG + Intronic
1138957936 16:61993656-61993678 AAGGAGGAACTGGAGGACAGGGG - Intronic
1139725161 16:68891812-68891834 AAGGACGGAGGGGAGGAGGGAGG + Intronic
1144190295 17:12839357-12839379 AAGGACCCACAGGGTGACCGAGG - Intronic
1147253160 17:39165621-39165643 TCGGACGCACGGGGGGACCTCGG - Intronic
1147311182 17:39596923-39596945 CAGGAGGCCCGGGAGGCCCGCGG + Intergenic
1147536624 17:41326252-41326274 AAGGAGGCACAGGGAGACCGTGG + Intergenic
1151570517 17:74923324-74923346 TAGGACCCAGGGGAAGACCGGGG - Intergenic
1152607539 17:81300308-81300330 AGGGACACACGGAAGGACCCAGG - Intergenic
1159214638 18:65375111-65375133 AAGGAGGGAGGGGAGGAGCGAGG - Intergenic
1160988544 19:1851342-1851364 AGGGACGCCCGGGAGGGTCGGGG + Intergenic
1162870041 19:13579584-13579606 CAGGAGGCATGGGAGGACCCAGG + Intronic
1163789955 19:19300826-19300848 AAGGACACACAGGAGGGCCGGGG + Intronic
1166764601 19:45245340-45245362 AAGGACGGGCAGGAGGACAGAGG - Intronic
925855285 2:8123636-8123658 AGGGAGGCAGGGGAGGACCCTGG + Intergenic
926112931 2:10194367-10194389 GAGGAGGCACGGCAGGACCAAGG - Intronic
929668481 2:43851878-43851900 AAGGCAGCAGGGGAGGAGCGGGG - Intronic
933725462 2:85424338-85424360 AAGGAAGCACAGGAAGACAGAGG - Intronic
935131478 2:100264385-100264407 AGGGAGGCAAGGGAGGAACGGGG + Intergenic
939965364 2:148605218-148605240 ACGGACGAACAGGAGGACAGGGG + Intergenic
944894658 2:204151639-204151661 AAGCACGCACGGGAGGGACGTGG - Intergenic
947529352 2:230898967-230898989 AAGGACGCTGGGGTGGACTGAGG - Intergenic
948356790 2:237384612-237384634 AAGGAGGCATGGGAGGATGGTGG - Intronic
1176073341 20:63237836-63237858 AAGGACACACCGGGGGCCCGGGG + Intronic
1176301587 21:5101421-5101443 AGGGACGCAGGGCAGGACAGGGG + Intergenic
1178668564 21:34570054-34570076 AAGGACAGACGGGAGGGCCCAGG + Intronic
1179855444 21:44160478-44160500 AGGGACGCAGGGCAGGACAGGGG - Intergenic
1180067350 21:45419025-45419047 AAGGATGGACGCGAGGACCAGGG + Intronic
953502913 3:43455193-43455215 AAGGAGGCACTGGAGGACTGAGG + Intronic
954458236 3:50611571-50611593 AGGGGCGCACGGGAGAACAGGGG - Intronic
961463112 3:127065546-127065568 AAGGAGGAAGGGGAGGGCCGAGG - Intergenic
966079237 3:175978653-175978675 GAGGACATACAGGAGGACCGCGG - Intergenic
968494769 4:909498-909520 ATGGACGCACGGGAGGGGCCGGG + Intronic
968568800 4:1328714-1328736 CAAGACGCACGGCAGAACCGCGG + Intronic
969054785 4:4394801-4394823 AAGGACCCACGGGCAGACCCAGG - Intronic
969153886 4:5193156-5193178 CAGGAGGCACGAGAGGACAGTGG - Intronic
978071633 4:104479794-104479816 AAGGAAGGACGGAAGGACGGAGG - Intronic
978193167 4:105939472-105939494 AAGGACACAGGGGAGGAATGTGG + Intronic
978458609 4:108924866-108924888 ATGGATGCAGGAGAGGACCGGGG - Intronic
984385397 4:179049285-179049307 AAGGAGGCACGGGAGCCCTGGGG + Intergenic
1002134013 5:177097226-177097248 CAGGAGGAAGGGGAGGACCGGGG - Intronic
1002565856 5:180112850-180112872 AAGGATGGACGGAGGGACCGAGG + Intronic
1004114126 6:12749856-12749878 GAGGACGCCCGGGAGGGGCGGGG - Intronic
1004427045 6:15513656-15513678 AAGGACGCACTGCAGGACCGAGG - Intronic
1006414095 6:33893174-33893196 AAGGCCGCGCGGCAGGACGGAGG - Intergenic
1006461811 6:34163719-34163741 GAGGAGGCGCGGGAGGCCCGGGG - Intergenic
1018924522 6:168197169-168197191 AAGGACGCAGGGGAGGAGCAGGG + Intergenic
1019270266 7:143266-143288 CAGGACGCACGTGAGGGCAGTGG + Intergenic
1019353097 7:564315-564337 ACGGAGCCACGGGAGGACCTGGG - Intronic
1019416728 7:931080-931102 AAGGACGGAAGGAAGGACGGAGG + Intronic
1019531240 7:1504457-1504479 AAGGAGGCGCGAGAGGCCCGCGG + Intergenic
1021231000 7:18086574-18086596 AAGGACGCGCGGGAGGCGGGAGG - Intergenic
1034344778 7:150379477-150379499 GAGGCAGCACGGGAGGAGCGGGG - Intronic
1034470373 7:151251626-151251648 AAGGAGGCCCGGGAAGAGCGTGG + Intronic
1035933475 8:3810437-3810459 AAGGGAGCACGGGAGGACCTGGG + Intronic
1037574078 8:20184590-20184612 AAGGACTCACGGGATGACCCTGG + Intergenic
1045404036 8:101847452-101847474 AAGGACGCTTGAGAGGACAGAGG + Intronic
1047298158 8:123589250-123589272 AAGGAGCCATGGGAGGACTGTGG - Intergenic
1049839620 8:144762718-144762740 AAGCAAGCCCGGGAGGACAGGGG + Intergenic
1053130409 9:35611386-35611408 AAGTACGCAAGGGAGCAGCGGGG - Intronic
1056719488 9:89059950-89059972 AAGGACGCAGTGGAGGACGATGG + Intronic
1056965684 9:91161412-91161434 GAGGACGCACAGGAGGGCCGGGG - Intergenic
1057197243 9:93121893-93121915 AAGGACACACAGCAGGTCCGTGG - Exonic
1060553529 9:124496842-124496864 GAGGATGCAAGGGAGGACCCGGG - Intronic
1061946278 9:133909941-133909963 AAGGATGCAGGGGAGGATGGAGG - Intronic
1061978752 9:134087760-134087782 GCAGAGGCACGGGAGGACCGTGG + Intergenic
1203787660 EBV:136798-136820 AAGGAGGCACGGGTGGAGGGGGG - Intergenic
1187294620 X:17986737-17986759 AAGGACTCAGGGGAGGAGCTGGG - Intergenic
1192360076 X:70433866-70433888 AAGGACTCGCGGGAGGCTCGCGG + Intergenic
1196804745 X:119574400-119574422 AAAGCCCCACGGGAGGCCCGGGG - Intergenic
1200336172 X:155353663-155353685 AAGGATCCATGGGAGGAGCGTGG - Intergenic
1200350298 X:155487564-155487586 AAGGATCCATGGGAGGAGCGTGG + Intergenic