ID: 1124658709

View in Genome Browser
Species Human (GRCh38)
Location 15:31528099-31528121
Sequence TTTAGGAACTTCATGTGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 172}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124658709_1124658716 9 Left 1124658709 15:31528099-31528121 CCGGGACACATGAAGTTCCTAAA 0: 1
1: 0
2: 2
3: 12
4: 172
Right 1124658716 15:31528131-31528153 AGCACATGTTGTGGGGAAGTGGG 0: 1
1: 0
2: 0
3: 20
4: 274
1124658709_1124658717 17 Left 1124658709 15:31528099-31528121 CCGGGACACATGAAGTTCCTAAA 0: 1
1: 0
2: 2
3: 12
4: 172
Right 1124658717 15:31528139-31528161 TTGTGGGGAAGTGGGAAGTGAGG 0: 1
1: 0
2: 7
3: 88
4: 789
1124658709_1124658715 8 Left 1124658709 15:31528099-31528121 CCGGGACACATGAAGTTCCTAAA 0: 1
1: 0
2: 2
3: 12
4: 172
Right 1124658715 15:31528130-31528152 GAGCACATGTTGTGGGGAAGTGG 0: 1
1: 0
2: 3
3: 33
4: 281
1124658709_1124658712 0 Left 1124658709 15:31528099-31528121 CCGGGACACATGAAGTTCCTAAA 0: 1
1: 0
2: 2
3: 12
4: 172
Right 1124658712 15:31528122-31528144 ATCTCATGGAGCACATGTTGTGG 0: 1
1: 0
2: 0
3: 15
4: 125
1124658709_1124658718 29 Left 1124658709 15:31528099-31528121 CCGGGACACATGAAGTTCCTAAA 0: 1
1: 0
2: 2
3: 12
4: 172
Right 1124658718 15:31528151-31528173 GGGAAGTGAGGATAGCCACGAGG 0: 1
1: 0
2: 1
3: 10
4: 195
1124658709_1124658713 1 Left 1124658709 15:31528099-31528121 CCGGGACACATGAAGTTCCTAAA 0: 1
1: 0
2: 2
3: 12
4: 172
Right 1124658713 15:31528123-31528145 TCTCATGGAGCACATGTTGTGGG 0: 1
1: 0
2: 0
3: 17
4: 235
1124658709_1124658714 2 Left 1124658709 15:31528099-31528121 CCGGGACACATGAAGTTCCTAAA 0: 1
1: 0
2: 2
3: 12
4: 172
Right 1124658714 15:31528124-31528146 CTCATGGAGCACATGTTGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124658709 Original CRISPR TTTAGGAACTTCATGTGTCC CGG (reversed) Intronic
901640653 1:10691437-10691459 TTCAGGACCTAGATGTGTCCGGG + Intronic
902140146 1:14346683-14346705 TTTCTGAACATCCTGTGTCCTGG - Intergenic
902687710 1:18089663-18089685 TTTAGGCAGTTCATGTCTCTGGG + Intergenic
903434878 1:23341227-23341249 TTAAGGAACTTCATGTACACCGG + Intronic
904843932 1:33394008-33394030 TTAAGGAATCTCATGTATCCTGG + Intronic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
907272091 1:53297086-53297108 TTTAGGAACATCACATGTCCAGG - Intronic
908306223 1:62820653-62820675 ATTAGGAAATTCATTTGTTCAGG + Intronic
916476412 1:165173596-165173618 TTAAGGAACAACCTGTGTCCAGG - Intergenic
918170191 1:181989036-181989058 TGAAGAAACTTCATGTGTCATGG + Intergenic
918614189 1:186525299-186525321 TTTTGTAACTTCATGTTTCCAGG + Intergenic
919735992 1:200951404-200951426 TTTATGAACTTCATATCTCAGGG + Intergenic
920041521 1:203100767-203100789 TTTAGGACCTTCCTGTTTACTGG + Intronic
921763465 1:218943101-218943123 TTTGGGAAATTCATGTGCCTAGG - Intergenic
921822931 1:219638382-219638404 TTTAAGTACTTCATGGGTGCAGG - Intergenic
922866204 1:228863483-228863505 TTTGGGAAGTTCAGGTGTGCAGG + Intergenic
922881841 1:228986889-228986911 TTAAAGAACTGCAGGTGTCCTGG - Intergenic
1063861588 10:10314429-10314451 TTTCTGATCTGCATGTGTCCAGG + Intergenic
1065800310 10:29345970-29345992 TTTAGGAACTCCATTCCTCCTGG + Intergenic
1067255485 10:44634452-44634474 TTTAGGTAATTCATATGTCAAGG - Intergenic
1067624658 10:47916304-47916326 TTGAGGAACTTCAAGTGCTCTGG + Intergenic
1071155844 10:82687937-82687959 TTTAGGAAACTCATGTGTGCTGG - Intronic
1073523765 10:104160035-104160057 TTTAGCCACTTCATGGGTGCAGG + Intronic
1074560592 10:114532166-114532188 TTTTGGAGCTTGATGTGGCCTGG - Intronic
1074702834 10:116107433-116107455 TTTAAGGTCTTCATGTGTTCAGG + Intronic
1075593093 10:123706824-123706846 GTTAGGAGCCCCATGTGTCCTGG - Intronic
1075794141 10:125106909-125106931 TTTAGCATCTACATGGGTCCAGG - Intronic
1076100322 10:127772451-127772473 TTTAGGATCTTGATTTTTCCAGG + Intergenic
1079056783 11:17213059-17213081 TGGAAGAACTTCATGTGTTCAGG + Intronic
1079394821 11:20052669-20052691 TTCAGGCAATTGATGTGTCCTGG + Intronic
1080091305 11:28352480-28352502 ATCATAAACTTCATGTGTCCAGG + Intergenic
1080554504 11:33403900-33403922 CTTAGAAACTTCCTGTCTCCTGG - Intergenic
1082121097 11:48380398-48380420 TTTCAGCTCTTCATGTGTCCTGG + Intergenic
1085475469 11:76786196-76786218 TTTATCACCTTCATGTGGCCAGG + Intronic
1087028261 11:93673862-93673884 TTTAAGAACTTCTCGTGTCTTGG - Intronic
1087205069 11:95385958-95385980 TTTTTGGACTCCATGTGTCCAGG - Intergenic
1088085840 11:105979147-105979169 TTTAGGTACTTCATTAGTTCTGG + Intronic
1088507670 11:110542140-110542162 TCCAGGAACTTCCTGTGGCCAGG - Intergenic
1088661419 11:112051016-112051038 TTTAGAAACTACAGTTGTCCGGG + Intronic
1089382335 11:118044090-118044112 TTTAGGAACTCCTTCTCTCCAGG - Intergenic
1090369702 11:126240363-126240385 AATAGGAACTTAATTTGTCCTGG + Intronic
1091885847 12:4016512-4016534 TTTAGGAACTTCTTGAGATCAGG - Intergenic
1094111334 12:26866006-26866028 TTTGGGAACTACATGTCTCCTGG - Intergenic
1094541147 12:31364176-31364198 TTTAGGATCTTCATGCTTGCAGG - Intergenic
1096864971 12:54557059-54557081 TTTGGAAACTTCTTGTGGCCTGG + Intronic
1101181468 12:102223177-102223199 TTGAGGAACGTCATGTGCCAAGG + Intergenic
1102252274 12:111395436-111395458 TTTAGTTACTTCATGAGGCCGGG - Intergenic
1105045266 12:132997901-132997923 TTTAGGGACTTCTTGTAGCCAGG + Intronic
1108722018 13:53141898-53141920 TTTAGGTACTATATGTGTGCTGG + Intergenic
1111961384 13:94814472-94814494 TTTAAGAACTTTTGGTGTCCAGG + Intergenic
1112042462 13:95560526-95560548 TATAGGAAATTCATGTCTCTTGG - Intronic
1112490224 13:99856296-99856318 TTTAGGAAGTTGATGTTGCCAGG + Intronic
1113130548 13:107031866-107031888 TTCATGAACTTCATTTGTCATGG - Intergenic
1113532975 13:111042752-111042774 TTCAGCCACTTCAGGTGTCCAGG - Intergenic
1114745589 14:25143163-25143185 TTTAGCAACTTAATATATCCAGG + Intergenic
1121106381 14:91282668-91282690 TTTAGGAACTCCCTGTCTCCAGG - Intronic
1122507629 14:102241822-102241844 GTTTGGAAGTTCTTGTGTCCTGG - Intronic
1123186242 14:106519908-106519930 TTTAGGAAGTTCATTTTTCCAGG + Intergenic
1124658709 15:31528099-31528121 TTTAGGAACTTCATGTGTCCCGG - Intronic
1126348736 15:47722621-47722643 TTTTGGAAATTGATGTGTCAAGG + Intronic
1130078278 15:80708944-80708966 CTCAGGAACTTCATGTCCCCAGG - Intronic
1130406299 15:83605074-83605096 TCTAGGAACTTAATCTGTCTAGG - Intronic
1131658590 15:94488709-94488731 TCTTGGAAGGTCATGTGTCCTGG - Intergenic
1133827993 16:9296012-9296034 TCAAGTAACTTCAAGTGTCCAGG + Intergenic
1134000849 16:10781616-10781638 TTTGTGAAATTCATGTGTCCAGG - Intronic
1138012013 16:53389989-53390011 ATTAGGAACATCTTGTGTCTTGG - Intergenic
1140796937 16:78447198-78447220 TTTAGAAAATCCATCTGTCCAGG - Intronic
1141002149 16:80318095-80318117 TTCAGGAACTTCTTGTTTCATGG + Intergenic
1141821051 16:86446068-86446090 TATAGGAACTTGGTGTGTTCTGG - Intergenic
1142022731 16:87794282-87794304 TCTCTGAACTTCATCTGTCCTGG + Intergenic
1147642642 17:42013678-42013700 TTTATGTTTTTCATGTGTCCTGG - Intronic
1148597818 17:48870927-48870949 TTTAGGAACTTAATGTTGACAGG + Intergenic
1149761120 17:59231254-59231276 TTTAGTAATTCCATGTGACCAGG + Intronic
1153080552 18:1218596-1218618 TTCAGCAACTTCTTTTGTCCTGG - Intergenic
1153850858 18:9092813-9092835 TTTAGGAACTGCATATGCTCTGG + Intergenic
1154142784 18:11840343-11840365 TTTAGTCACTGCATGTATCCTGG - Intronic
1155473453 18:26214506-26214528 TTAAGGAACTTAAAGTGTTCTGG + Intergenic
1158512444 18:58102809-58102831 TTTAGTATCCTCAGGTGTCCTGG + Intronic
1160217171 18:76942423-76942445 TTTAGGAACATCATCTTTCATGG - Intronic
1164152963 19:22570436-22570458 GTTTGGAACTTCTTGTGTGCTGG - Intergenic
928753962 2:34501743-34501765 TTTAGAAACTTAATGTATCTTGG - Intergenic
928882370 2:36112342-36112364 TTTAGGCACTTCATGTGTCTAGG - Intergenic
928993177 2:37257329-37257351 TTGAGTACCTTTATGTGTCCAGG - Intronic
929648344 2:43652558-43652580 TCTAGGGACTCCATGAGTCCAGG + Intronic
929676717 2:43940295-43940317 TTTAGCATCTTCATTTGTACTGG - Intronic
932067594 2:68582824-68582846 GTTAGGAACTTTCTGTGTCACGG + Intronic
932833364 2:75011554-75011576 TATAAGAACTTTATGTTTCCAGG - Intergenic
936601354 2:113898681-113898703 TTTATGAAAGTCATCTGTCCTGG - Intronic
937004694 2:118500904-118500926 TTTAGGAACTTCATTTCTAGAGG - Intergenic
939473046 2:142649718-142649740 TTTAAGAACTAAATGTGGCCAGG + Intergenic
940866057 2:158818785-158818807 CTCAGCAACTTCATGTTTCCTGG - Intronic
940975493 2:159938742-159938764 TATAAGAACTTGCTGTGTCCTGG - Exonic
941734263 2:168955900-168955922 TTTTGGACCTGCATGTGGCCTGG - Intronic
942287570 2:174435812-174435834 TTTGGGATCTTCAGGAGTCCTGG + Exonic
943519847 2:188934902-188934924 TTTAGGATCTTGATGCCTCCAGG - Intergenic
943562917 2:189484398-189484420 TTTAGGAACTGTATTTGTCAGGG + Intergenic
945945923 2:215995371-215995393 TTTAGAAGTGTCATGTGTCCCGG - Intronic
946215040 2:218177546-218177568 TTTTGGAAGTTCTTGTGTGCTGG + Intergenic
1169354104 20:4893529-4893551 TTTAAGACCTTCAAGTCTCCTGG + Intronic
1170106226 20:12756068-12756090 TTTTGGAAATTCTTGTGTGCCGG - Intergenic
1170262263 20:14423402-14423424 TTTAAGAACTTGATGCGGCCTGG + Intronic
1171998917 20:31756214-31756236 TTTAGGAACTTCGAGTCTACTGG + Intronic
1172234607 20:33362221-33362243 TTTAGGAATTTGATGTGGCTGGG - Intronic
1172555374 20:35836387-35836409 TTTAAAAACTTAATGTGTCATGG + Intronic
1173672524 20:44808858-44808880 TTTAGGAAGTTCCTGGGCCCAGG - Intronic
1174844202 20:53927697-53927719 TTTAGTATCCTCACGTGTCCTGG + Intergenic
1175201061 20:57277942-57277964 TCTGGGAACATCATGTTTCCCGG - Intergenic
1179015292 21:37590525-37590547 GTTTGGAAGTTCTTGTGTCCTGG + Intergenic
951316326 3:21192713-21192735 GTTTGGAAGTTCTTGTGTCCTGG + Intergenic
952129779 3:30347790-30347812 TCTAGGACATTCATGTTTCCTGG - Intergenic
953796856 3:45992571-45992593 TTTAGGCACTCTATCTGTCCTGG + Intronic
954234212 3:49243461-49243483 TTTAAGAACTGGATGTGGCCAGG + Intronic
955785507 3:62533845-62533867 GAGAGGAACTTCTTGTGTCCTGG + Intronic
957992324 3:87642408-87642430 TTTTGTTAGTTCATGTGTCCAGG + Intergenic
959343047 3:105156076-105156098 TTTAGGAACTTCTTGTGTCATGG + Intergenic
960749877 3:120936834-120936856 TTTAAAAACTGCATGTGGCCAGG - Intronic
963278094 3:143352982-143353004 TGTAGGGACCGCATGTGTCCCGG - Intronic
965070320 3:163909738-163909760 GTTTGGAAGTTCTTGTGTCCTGG - Intergenic
967731468 3:192910959-192910981 TATATGTACTTCATGTGTTCAGG - Intronic
971048586 4:22833440-22833462 CTTACGAACTTCATGTGTCTAGG - Intergenic
971170786 4:24230560-24230582 TATAGCACCTTCATTTGTCCTGG + Intergenic
972368363 4:38396832-38396854 TTTAGGAAGTTCATGGGCCATGG + Intergenic
978296463 4:107210894-107210916 GTGAAGAGCTTCATGTGTCCAGG - Intronic
978352568 4:107835541-107835563 TTTAGAAACTTCTTGAGCCCTGG + Intronic
979811887 4:125046464-125046486 TTTAAGAAATTAATGTGGCCAGG - Intergenic
980544489 4:134240819-134240841 TTTAGGTAAGTCATTTGTCCAGG + Intergenic
980624957 4:135363440-135363462 CTTAAGAACTTCATGAGGCCGGG + Intergenic
981058181 4:140388097-140388119 TTTATGAAATTCTTGTGTCTGGG - Intergenic
981173211 4:141648982-141649004 TTTAGGAACTTATTGTCTCGTGG + Intronic
981327560 4:143468168-143468190 TTTATGAATTTCATCTGTCATGG + Intronic
981836037 4:149054585-149054607 TTTTGCAACTTGATGTGTACAGG - Intergenic
982712616 4:158771989-158772011 TTTCAGGACTTCATGTTTCCTGG + Intronic
985139670 4:186826909-186826931 TTTAGAAACTTCCTTTATCCAGG - Intergenic
986792399 5:11174736-11174758 TTTAGGAATTTCCTGAGTCAAGG + Intronic
987558025 5:19480669-19480691 TTTAGAAACTTTATATGGCCGGG - Intronic
990073822 5:51817812-51817834 GTGAGCAACTTCATGTGTCCTGG + Intergenic
991055894 5:62319854-62319876 TTTTGGAACTTCATTAGTCATGG - Intronic
992381837 5:76245178-76245200 TTTATAAACTTCATGTGGCCAGG + Intronic
993240557 5:85378699-85378721 TCTAGGAACTTCATAATTCCAGG + Intergenic
995313108 5:110735769-110735791 TCTATGAACTTCATGTGGCAAGG + Intronic
999888523 5:155950935-155950957 TTTAGGAATTGCATGTGAGCTGG + Intronic
1003334451 6:5157475-5157497 TTTAGGTACTTCCTGTTTGCAGG - Intronic
1004119934 6:12811258-12811280 TTTAGGAGGTTTATGTGACCAGG - Intronic
1004456578 6:15797164-15797186 TTGAGGCCCTTCATATGTCCAGG + Intergenic
1007538462 6:42618357-42618379 TCAAGGATCTTCAAGTGTCCTGG - Intronic
1007799371 6:44379019-44379041 TTTCAGAAGTTAATGTGTCCTGG - Intergenic
1009269809 6:61602294-61602316 CTTTGGAAGTTCTTGTGTCCTGG - Intergenic
1009343595 6:62588143-62588165 ATTTGGAACTTCTTGTGTGCTGG - Intergenic
1009861348 6:69337610-69337632 TTTGGCAACTACATGTGCCCTGG + Intronic
1011144592 6:84199050-84199072 TATAGGAAGTTCATGTGTTCAGG - Intronic
1011367906 6:86601882-86601904 TTTTGGAAGTTCTTGTGTGCTGG + Intergenic
1012689564 6:102295117-102295139 TTTTGGAAGTTCTTGTGTGCTGG - Intergenic
1013067396 6:106697031-106697053 CCTAAGAACTTCATGTTTCCTGG - Intergenic
1015271363 6:131341073-131341095 GTTTGGAACTTCTTGTGTGCTGG - Intergenic
1015540355 6:134307470-134307492 TTTAGGATCTGCAGGGGTCCTGG - Intronic
1016248852 6:142017999-142018021 TTTTGGAACTTCTTGTGTGCTGG - Intergenic
1021393612 7:20122794-20122816 GTTTGGAAGTTCTTGTGTCCTGG - Intergenic
1022048280 7:26640844-26640866 TTTAGGAAATTCATGAACCCAGG + Intronic
1023087104 7:36581923-36581945 TTTAGGAACTGCATTTCTCAAGG + Intronic
1026200664 7:68211828-68211850 TTGAGGAACTTTAGGTGCCCAGG + Intergenic
1030338787 7:108353842-108353864 TCTAGCAACTTCATGAGACCAGG + Intronic
1033257889 7:139817594-139817616 TTTAGTAACTTCAAGTGCTCAGG + Intronic
1035110814 7:156480142-156480164 TCTTAGAACCTCATGTGTCCTGG - Intergenic
1035657954 8:1325288-1325310 TTTGGGAACTTCCTTGGTCCAGG - Intergenic
1041991373 8:63996085-63996107 TTTAGGCTCTTCCTGAGTCCTGG + Intergenic
1042151743 8:65794327-65794349 TTGAGGAAGTTCATGTGGCTTGG - Intronic
1044090229 8:87991207-87991229 ATTAGGAACTTAATCTCTCCTGG - Intergenic
1044810820 8:96059498-96059520 TTTAAGGGTTTCATGTGTCCGGG - Intergenic
1046837785 8:118822057-118822079 TTTAGTACCTGCAGGTGTCCTGG - Intergenic
1047818192 8:128488056-128488078 TTAAGGCACTTTCTGTGTCCAGG - Intergenic
1048480621 8:134788767-134788789 TTTAGGATCTTTATGTGTTTTGG + Intergenic
1049099675 8:140569841-140569863 TTTAGGAGCTTCGTGTGTAAGGG + Intronic
1050127969 9:2379357-2379379 TTTATGAACATCATGGGTCAGGG + Intergenic
1050952082 9:11610285-11610307 TACAGGATCTCCATGTGTCCTGG + Intergenic
1052332386 9:27282855-27282877 TTAAGGAACCTTATGTGTCTTGG + Intergenic
1055626712 9:78183001-78183023 TTTTGGAAGTTCTTGTGTGCTGG - Intergenic
1056125691 9:83534836-83534858 TTTGCAAACTTAATGTGTCCTGG - Intronic
1057018447 9:91676460-91676482 TTTTGGAACTTTTTTTGTCCAGG + Intronic
1061799822 9:133107627-133107649 ATTAGGCACTTGGTGTGTCCTGG - Intronic
1062672495 9:137719834-137719856 GTTCGGCACCTCATGTGTCCTGG - Intronic
1188467142 X:30494686-30494708 TTTAGCAACTTTATATGTTCTGG - Intergenic
1193358196 X:80548057-80548079 TATAGGAAAATCATGTGTACAGG - Intergenic
1193657375 X:84214781-84214803 TTTAGGAACTTCATAGTTTCAGG - Intergenic
1194260781 X:91692852-91692874 TTTAAGCACTTCATATGTACAGG + Intergenic
1196082918 X:111651878-111651900 TTTAGTAAATTTATGTCTCCTGG - Intergenic
1200579471 Y:4931916-4931938 TTTAAGCACTTCATATGTACAGG + Intergenic
1200648631 Y:5815273-5815295 TTTATGAACTTATTGTTTCCCGG + Intergenic